a pilot study on genetic diversity in indian · a, cerana yellow belgaum acblg 74° 30’00.00”e...

~ 7 ~

Journal of Entomology and Zoology Studies 2014; 2 (3): 07-13 ISSN 2320-7078 JEZS 2014; 2 (2): 07-13 © 2014 JEZS Received: 06-04-2014 Accepted: 28-04-2014 Chethana V Chalapathy Division of Biological Sciences, School of Natural Sciences, Bangalore University, Bangalore, India. H.P. Puttaraju Division of Biological Sciences, School of Natural Sciences, Bangalore University, Bangalore, India. V. Sivaram Department of Botany, Bangalore University, Bangalore, India. Correspondence: Dr. H.P. Puttaraju Division of Biological Sciences, School of Natural Sciences, Bangalore University, Bangalore, India.

A pilot study on genetic diversity in Indian honeybees-Apis cerana of Karnataka populations

Chethana V Chalapathy, H.P. Puttaraju, V. Sivaram ABSTRACT Unravelling the genetic diversity studies of Apis cerana, the indigenous strain of India is very much essential as it provides significant guidance to beekeepers about breeding strategies that would aide in their colonies to survive. There are two predominant species of Indian honey bees, Apis cerana cerana (black strain) and Apis cerana indica (yellow strain). Currently there are no reports on diversity studies on these subspecies are available. The current research in this paper describes the pilot study undertook to evaluate the genetic diversity of Apis cerana from populations of Karnataka. Bee colonies from 12 localities of Karnataka have been genetically characterized through COI gene of mitochondrial genome, providing discreet characteristics for intra-specific diversity studies. This has led to infer the taxonomic status of two subspecies of Apis cerana. The results suggest that Indian populations have larger effective size and genetic diversity. The paper discusses the possibility of introduction of honeybees in India in evolutionary time frame and resolving the diversity in Indian honeybees by assessing the phylogeography.

Keywords: Mitochondrial DNA, Genetic diversity, COI gene, Strains of Apis cerana. 1. Introduction The history of Apiculture dates back to several centuries, however the rich distribution and diversity of bees largely remains uncharacterized. The morphological [1, 2, 3] and mitochondrial haplotype [4] diversity across the range of Apis cerana does not provide a holistic view of the rich biological diversity in honey bees. Smith & Hagen (1996) based on sequence analysis of mitochondrial DNA, identified three major lineages of Apis cerana [4]. These include mainland Asia group (includes the bees from Japan), Sundaland group and Philippine group. However, exhaustive molecular characterization of honeybees needs to be taken up to resolve its rich diversity. The rich pool of mitochondrial DNA provides adequate insights on the origin and the phylogenetic variation in honeybees over evolutionary time scales. Molecular studies on Asian honeybee-Apis cerana is carried out to a limited extent in few countries like China, Japan, Thailand, Philippines, Korea, Burma and India. The maternal inheritance and relatively rapid evolution of mitochondrial DNA has led to its widespread use of genetic marker for studies of maternal gene flow and the dynamics of hybrid zones [5]. Over the past 2 decades, mitochondrial DNA studies have shed light on the biogeography of the Asian cavity nesting honeybee Apis cerana Fabricius1793 [6]. The mitochondria of insects contain their own double stranded genomes, the size of which ranges from 14,503bp [7] to 19,517bp [8] in size. With few exceptions, it encodes 37 genes, including 13 protein coding subunits from 3 of the oxidative phosphorylation complexes, plus the 2 ribosomal RNA and 22 transfer RNA genes necessary to translate the protein coding genes [9]. Due to the relative ease of amplification and sequencing, in the last two decades the insect mitochondrial genome has become the most commonly used molecular markers for population genetics, phylogeography and molecular diagnostics. In India, based on morphological features, two “races” of Apis cerana are identified: a black ‘Hill’ morph, that is often said to live at higher elevation and a yellow “plain” morph found at lower elevations [10, 11, 12]. The molecular studies of these two races were earlier identified in Indian samples [13] Analysis of mitochondrial DNA diversity in Apis cerana has shown two major haplotype families. The first “Western” haplotype group appears to be confined to India and Sri Lanka and may be associated with yellow plain morphology. The second major haplotype “Eastern” group includes all other Apis cerana, A. nigrocincta, Apis nuluensis [14]. Within the eastern group of haplotypes, there are at least 5 lineages, one of which is the” Mainland Asia” group which has a broad range from India and Japan [4, 6].

~ 8 ~

Journal of Entomology and Zoology Studies

One region of the Apis mitochondrial genome has proven to be particularly informative for intraspecific studies because the sequence does not appear to be subject to strong purifying selection and accumulate numerous base substitutions and insertions/deletions [15, 16]. Keeping the above in view, an attempt has been made in the present study to recognise geographic and genetic variability of Apis cerana within Karnataka through molecular tools and characterize the relationships of Apis cerana with samples from various parts including adjacent regions of Karnataka. This novel study would pave way for exemplifying the introduction of honey bees in India in evolutionary time scales and resolving the diversity in Indian honey bees. 2. Materials & Methods 2.1 Sampling of honeybees Honeybee samples were collected during the year 2012 to 2013 from different regions of Karnataka representing different climatic/

vegetation zones, ranging from 12°00’00.22” N– 17°19’47.03” latitude, 74° 30’00.00”E – 77° 35’40.43”E longitude and 49 - 1236 m elevation level. Adult Apis cerana worker honeybees were collected from managed hives (from beekeeping centres) or feral colonies of local origin. A sample size of Yellow and Black strains varied between eight to ten samples of different strains of Apis cerana. The collected bees were immediately transferred to vials with 95% alcohol and later stored at -80 °C until DNA extraction. 2.2 DNA Extraction Genomic DNA was isolated from the legs of each individual using Chromus DNA isolation kit method. The legs were homogenized in suspension buffer followed by RNAase treatment to degrade the RNA content. Lysis buffer was used to lyse the cell contents and the solution was run on the spin column repeatedly as per the Chromous Biotech protocol. Trace of alcohol was removed through wash buffer and DNA was eluted with the elution buffer. Isolated DNA was stored at -20 °C until use.

Fig 1: The list of sampled places across Karnataka state for current diversity studies.

2.3. Primers & PCR Amplification Target DNA from mitochondrial gene, i.e., Cytochrome C Oxidase subunit I (Table 2) was amplified using specific COI primer [17]

from samples with following PCR profile. The gene was amplified in 25 µL PCR reaction mixture with 12.5 µL PCR master mix (Fermentas), 1 µL of each forward and reverse primer, ≈1 µg of template DNA and nuclease free water. The PCR cycling conditions for COI is detailed in Table-1. The amplified products were checked under UV light and documented.

2.4 DNA purification and sequencing The amplified DNA fragments were extracted from agarose gels and purified using the DNA purification kit “Easy pure” from Biozyme. The primers used were the same primers used in PCR amplification and directly sequenced in “Big dye terminator version 3.1” cycle sequencing kit with sequencing machine–ABI 3500xL Genetic analyser. Then the data analysis of sequences was done using MEGAv5.4.

~ 9 ~


Table 1: Places of sample collection with geographical location and the Genbank accession numbers of COI gene.

Sl. No

Species Name

Strain (Race)

Sample Location Geographical Location Gene Accession No.

Place Labelled Longitude Latitude Altitude COI 1. A. cerana Black Bangalore ACBLR 77° 35’40.43”E 12° 58’17.76” N 913 m KF760518

2. A. cerana Yellow Bangalore ACBLR 770 35’40.43”E 12° 58’17.76” N 913 m KF760519

3. A. cerana Black B.R.Hills ACBRH 77° 08’18.10”E 12° 00’00.22” N 1236 m KF760520

4. A. cerana Black Dharmastala ACDSL 75° 22’52.75”E 12° 56’48.66” N 121 m KF760521

5. A. cerana Yellow Madikeri ACMDK 75° 44’17.47”E 12° 25’27.91” N 1132 m KF760523

6. A. cerana Black Madikeri ACMDK 75° 44’17.47”E 12° 25’27.91” N 1132 m KF760524

7. A. cerana Yellow Mangalore ACMLR 74° 51’21.45”E 12° 54’50.91” N 49 m KF760525

8. A. cerana Black B.G.Kere ACBGK 76° 40’38.81E 14° 39’12.93” N 623 m Submitted

9. A. cerana Yellow Gulbarga ACGLB 76° 50’03.41”E 17° 19’47.03” N 470 m Submitted

10. A. cerana Yellow Raichur ACRCH 77° 21’15.70”E 16° 12’25.27” N 410 m Submitted

11. A, cerana Yellow Belgaum ACBLG 74° 30’00.00”E 15° 52’00.12” N 709 m Submitted

12. A. cerana Yellow Davanagere ACDVG 75° 55’25.82”E 14° 27’58.84” N 598 m Submitted

Table 2: List of primers sequences and PCR thermocycling profile with the expected product size

Gene Primer Sequence PCR conditions Product Size

Cytochrome C Oxidase subunit I (Bar code gene)

Forward-LCOF1490

GGTCAACAAATCATAAAGATATTGG Reverse – HCOR2198

TAAACTTCAGGGTGACCAAAAAATCA

94 °C for 1min

710bp

94 °C for 40sec 45 °C for 40 sec 72 °C for 1min

6 cycles

94 °C for 40 sec 50 °C for 40 sec 72 °C for 1min

36 cycles

72 °C for 5 min

2.5 Sequence and Phylogenetic analysis DNA sequences were aligned using the multiple sequence alignment program CLUSTAL O [18]. MEGA program version 5.4 [19, 20] was used for estimating evolutionary distances [21] and phylogenetic analysis was constructed using Neighbour Joining, DNA Parsimony methods [22]. Analyses were performed on 1000 bootstrapped data sets generated by the program. DNADIST with the Kimura two parameter distance option [23] was used to estimate divergence between sequences with a transition/transversion ratio [24]. 3. Results 3.1 Sequence submission and alignment Seven sequences of Apis cerana (table1) are accessed with accession numbers and the remaining accession numbers for sequences are awaited from Genbank. Amongst the aligned

sequences, 550 positions of COI were considered. All positions containing gaps and missing data have been eliminated. 3.2 Nucleotide content analysis of COI gene 3.2.1. Relative importance of Transitions and Transversions The overall mean distance of sequences of COI gene was 12.455. The frequencies of transitions: A⬌G is 19.65%, (C⬌T) is 33.99% and transversions: A⬌T is 18.01%, A⬌C is 6.14%, G⬌T is 18.01% and C⬌G is 6.14% (Table 3). The percentage of sites showing transitions (53.64%) is higher than the number of sites showing transversions (48.30%). The estimated transition/transversion (Ts/Tv) bias of COI (R) is 0.588. The nucleotide frequencies are A=33.68 %, T/U = 41.73%, C= 14.09% and G=10.50%.

~ 10 ~


Table 3: Frequency percentage (%) of transitions and transversions and Transition/Transversion ratio (Ts/Tv) of COI gene.

3.2.2. Base composition at each Codon positions The high numbers of polymorphic sites verified in the COI gene were evenly distributed among the 3 codon positions. The A+T bias was pronounced in general for this region for all codon

positions (Table 4). The nucleotide content of all the samples and the total C+G and A+T were calculated using MEGA software (5.4).

Table 4: Mean frequencies (%) for base compositions at different codon positions for COI region.

Samples First Codon Second Codon Third Codon Total

A C G T A C G T A C G T C+G A+T

ACGLB_COIB 30.4 15.7 17.4 37 17.4 23.0 14.8 45 49.8 9.2 1.7 39 27.266

72.866

ACRCH_COIY 29.4 14.0 17.8 39 17.7 24.2 14.0 44 50.9 3.3 1.9 44 25.166 74.9 ACBGM_COIY 26.4 15.0 19.1 40 23.6 22.3 11.8 42 48.6 3.2 2.7 45 24.66 75.5 ACBGK_COIY 53.3 2.6 0.0 44 29.5 12.3 18.9 39 16.7 23.3 14.1 46 23.733 76.166 ACDVG_COIY 18.3 23.0 14.8 44 53.5 3.0 0.0 43 29.3 14.0 18.3 38 24.366 75.366 ACMLR_COIY 30.9 13.5 18.3 37 17.4 23.9 14.3 44 50.7 4.8 1.3 43 25.366 74.33 ACDSL_COIB 29.1 15.7 18.7 37 17.4 23.9 14.8 44 51.1 6.1 1.7 41 26.966 73.2 ACMDK_COIB 52.2 3.9 1.3 43 30.4 12.6 19.1 38 17.0 24.0 14.4 45 25.1 75.2 ACMDK_COIY 53.0 3.5 1.7 42 30.9 12.6 17.8 39 17.0 23.6 15.3 44 24.833 75.3 ACBRH_COIB 29.2 14.4 15.9 41 15.5 24.7 13.9 46 55.2 6.3 1.0 38 26.033 74.133 ACBLR_COIB 28.8 14.8 18.3 38 16.6 24.0 14.8 45 52.4 6.1 1.3 40 26.433 73.6 ACBLR_COIY 31.0 13.5 18.3 37 18.0 22.8 14.0 45 50.9 3.9 1.3 44 24.6 75.3

3.3 Phylogenetic analyses of COI sequences: Phylogenetic analyses of COI datasets were carried out to identify two criteria: (i) genetic divergence from total populations of

Karnataka and (ii) sequence divergence amongst and between two strains of Apis cerana populations.

Fig 2: Phylogenetic tree of COI constructed by DNA Parsimony using sequences.

Transitions (%) Transversions (%) Ts/Tv ratio

G/A C/T A/T A/C G/T G/C T/A T/G C/A C/G 0.588 COI

gene 19.65 33.99 5.97 2.07 5.97 2.07 12.04 12.04 4.07 4.07

~ 11 ~


a) DNA Parsimony tree: The tree has 3 haplotypes of which 2 yellow strains form distinct clusters followed by black strains (Figure 2). However, it was interesting to note that the black strain ACMDK_B merged with the yellow strains ACBLR_Y, ACMLR_Y, ACMDK_Y, ACRCH_Y and ACBGM_Y.DNA Parsimony tree length inferred the highest branch length from root to the node as 0.234565 for ACBRH_COIB and the least length as 0.002778 for ACBGM_COIY.

(b) Neighbour Joining tree: The NJ tree was quite similar to the DNA Parsimony tree, in which the ACMDK_COIY stood as an out-group. Amongst three haplotypes constructed, the Black and Yellow were separated from each other, but one haplotype had a Black strain along with two Yellow strains. Figure 3 illustrates the Neighbour joining phylogenetic tree of COI gene. The distance matrix calculated using the NJ method amongst the strains (Black & Black and Yellow & Yellow) and between strains (Black and Yellow) is illustrated in Table 5

Table 5: Illustrates the distance matrix amongst and between the strains

Fig 3: Phylogenetic tree of COI constructed by Neighbour Joining method.

4. Discussion The indigenous hive bees Apis cerana of Asia, occurs in two different strains viz., black and yellow strain. The current studies confirmed the occurrence of these two strains which are morphologically different. Earlier studies by Oldroyd [13] suggest that mitochondrial COI genes are ideally suited for characterization of genetic divergence within species. Meixner et al. [25] have previously shown that this technique is effective in inferring bee evolutionary subspecies identification and human mediated contemporary history. The current study was taken up in similar lines to characterize the genetic diversity in 12 populations of Apis cerana honeybees from Karnataka state. The transition/transversion ratio is instrumental in inferring the direction and magnitude of natural selection. The Ts/Tv value of 0.588 suggests that there is insignificant neutral selection in honeybees of Karnataka. The ratio value of greater than 1, it implies positive or Darwinian selection; and if less than 1, it implies purifying selection and a ratio of one indicates neutral (i.e.,

no) selection. However the positive and purifying selection at different points within the gene or at different times along its evolution may cancel each other out giving an average value that may be lower, equal or higher than, and thus it could be inferred that the honeybees of Karnataka might be in the verge of diversification. Additionally, the exact transition (53.64%) and transversion (46.36%) suggests no significant difference indicating frequent gene flow, migration, mutations among these populations. Transitions do not contribute heavily to genetic divergence, whereas transversions create significant impact on the evolution of the species. The comparable values of transitions and transversions in the current study suggest the possible occurrence of genetic divergence over evolutionary time scales. In congruence with Willis et al. [26], suggesting honeybees are AT-biased, the average of A+T and C+G content of the findings is in the ratio of 3:1 respectively. Willis et al. [26] further opined the AT-rich sequence may be the result of various factors comprising selection drift, small effective population size and mitochondrial

Combination COI Difference of distance

Apis cerana Black & Black 0.026090 to 0.088401 0.06231 Apis cerana Yellow & Yellow 0.004418 to 0.04674 0.04233 Apis cerana Black & Yellow 0.027005 to 0.89995 0.87295

~ 12 ~


polymerase inefficiency. Historical evidence also points to rapid morphological change in Apis and predicts the rapid changes during approximately 10 million years between the Upper Eocene and the Oligocene (35-40 Mya.) [27]. The variation in nucleotide content almost completely resides in the third position, which is also rich with AT, compared to the first and second position of codons (Table-4). The A+T bias described for different codons has been explained either as a mutational process favouring the accumulation of those nucleotides or the result of an ineffective repair system. The phylogenetic characterization of the COI genes through DNA Parsimony tree and Neighbour Joining tree revealed the distance matrix amongst and between the strains and the evolutionary status of strains of Apis cerana respectively. However, the DNA Parsimony and Neighbour Joining trees showed similar topology with slight variations in terminal branch resolution, indicating the need for exclusive studies on the black and yellow strain with respect to the altitude (above the sea elevation level). The phylograms exemplify the black and yellow strains to form separate clusters; the third cluster with yellow includes a black strain. The distance matrix clearly signifies the vast distance between the strains and least difference amongst the strains. The distance between strains proves that there is diversity between them. The strains of Apis cerana i.e., the Black and Yellow were identified with the morphological studies. The first three tergites of the abdomen of the bee were main criteria to discriminate them, followed with the mitochondrial haplotype studies. The study is in congruence with the previous reports of Oldroyd [13] with little queries on the ACMDK black with the other yellow strains. Though these strains are reproductively isolated, there might be the possibilities of genetic recombination and strain diversity due to human mediated migratory beekeeping. Indian sub-continent is rich in bio-diversity due to varied ecological constraints and elevations from mean sea levels. The temperate and tropical climatic zones of India further enhance this genetic divergence. When the current study, which is limited to a particular state of India is showing such great divergence, a detailed sampling of honeybees across India with different agro-climatic zones would provide interesting insights on the genetic diversity. The pioneering study will be of impeccable importance in this direction as would be influential in filling up the empty niche of characterizing the genetic diversity of Apis cerana in India. 5. Conclusion The current study identifies the Western and Eastern group of Apis cerana in 12 populations of Karnataka. Apis cerana in India occurs in two strains viz., Apis cerana indica (the yellow plain morphs) and the Apis cerana cerana (the black hill morph). The investigations involved characterization of honeybees through morphological and molecular studies. The morphometric microscopic examination of the tergites of abdomen and mitochondrial DNA-COI gene characterization revealed the presence of two strains of Apis cerana in Karnataka populations. The pilot study is of vital importance in establishing the genetic diversity of the indigenous honeybees of Apis cerana in the Indian sub-continent. 6. References 1. Ruttner F. Biogeography and Taxonomy of Honey Bees.

Springer-Verlag, Berlin, 1988.

2. Hepburn HR, Smith DR, Radloff SE, Otis GW. Infraspecific categories of Apis cerana: morphometric, allozymal and mtDNA diversity. Apidologie 2001a; 32:3-23.

3. Radloff SE, Hepburn HR, Hepburn C, Fuchs S, Otis GW, Sein MM et al. Multivariate morphometric analysis of Apis cerana of southern mainland Asia. Apidologie 2005; 36:127-139.

4. Smith DR, Robert Hagen H. The Biogeography of Apis cerana as revealed by Mitochondrial DNA Sequence Data Journal of Kansas Entomological Society 1996; 69(4):294-310.

5. Moritz C, Dowling TE, Brown WM. Evolution of Animal Mitochondrial DNA Relevance for population Biology and systematics. Annual Review of Ecology and systematics. 1987; 18:269-292.

6. Smith DR, Warrit N, Hepburn HR. Apis cerana from Myanmar (Burma): Unusual distribution of mitochondrial lineages. Apidologie 2004; 35:637-644.

7. Wolstenhome DR, Macfarlane JL, Ronald O, Clary DO, Wahleithner JA. Bizarre tRNAs inferred from DNA sequences of mitochondrial genomes of nematode worms. Proceedings of National Academic Sciences. 1987; 84:1324-1328.

8. Lewis DL, Farr CL, Kaguni LS. Drosophila melanogaster mitochondrial DNA: completion of the nucleotide sequence and evolutionary comparisons. Insect Molecular Biology. 1995; 4(4):263-278.

9. Li Hu, GaoJianyu, Liu Haiyu, CaiWanzhi. Progress in the Researches on Insect Mitochondrial Genome and analysis of Gene Order. Science Foundation in China 2009; 17:39-42.

10. Kapil RP. Variation in the biometric characters of the Indian honeybee Apis cerana indica. Indian Journal of Entomology 1956; 28:440-457.

11. Narayanan ES, Sharma PL, Phadke KG. Studies on biometry of the Indian bees. III. Tongue length and number of hooks on the hind wings of Apis cerana indica F. collected from Madras State. Indian Bee Journal 1960a; 23:3-9.

12. Narayanan ES, Sharma PL, Phadke KG. Studies on biometry of the Indian bees. 1. Tongue length and number of hooks on the hind wings of Apis cerana indica F. Indian Bee Journal. 1960b; 22:81-88.

13. Oldroyd BP, Reddy MS, Chapman NC, Thomson GJ, Beekman M. Evidence for reproductive isolation between two colour morphs of cavity nesting honeybees (Apis) in South India. Insect Sociux. 2006; 53:428-434.

14. Tanaka H, Roubik DW, Kato M, Liew F, Gunsalam G. Phylogenetic position of Apis nuluensis of northern Borneo and phylogeography of Apis cerana as inferred from mt. DNA sequence. Insects Sociux 2001; 48:44-51.

15. Cornuet JM, Garnery L. Mitochondrial DNA variability in honeybees and its phylogeographic implications. Apidologie 1991; 22:627-642.

16. Yin L, Ji T. Genetic diversity of the honeybee Apis cerana in Yunnan, China, based on mitochondrial DNA. Genetics and Molecular Research 2013; 12(2):2002-2009.

17. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. DNA primers for amplification of mitochondrial cytochrome C oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology. 1994; 3(5):294-299.

18. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W et al. Molecular Systems Biology. 2011; 7:539.

19. Tamura K, Nei M, Kumar S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proceedings of the National Academy of Sciences (USA)

~ 13 ~


2004; 101:11030-11035. 20. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar

S. MEGA5.4: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 2011; 28:2731-2739.

21. Tamura K, Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution. 1993; 10:512-526.

22. Felsenstein J. PHYLIP-Phylogeny Inference Package (Version 3.2). Cladistics. 1989; 5:164-166.

23. Kimura M 1980. A simple method for estimating evolutionary rates of substitutions. Journal of Molecular Evolution 16:111-120.

24. Saitou N, Nei M. The neighbor-joining method A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 1987; 4:406-425.

25. Meixner MD, Maria Alice P, Maria B, Per K, Evgeniya I, Stefan F. Standard methods for characterizing subspecies and ecotypes of Apis mellifera. Journal of Apicultural Research 2013; 52(4):1-27.

26. Willis LG, Winston ML, Honda BM. Phylogenetic Relationships in the Honeybee (Genus Apis) as determined by the Sequence of the Cytochrome Oxidase II Region of Mitochondriial DNA. Molecular Phylogenetics and Evolution 1992; 1(3):169-178.

27. Culliney TW. Origin and evolutionary history of the honeybees. Apis Bee World 1983; 64:29-38.

28. Helms Cahan, Parker SJD, Rissing SW, Johnson RA, Polony TS, Weiser MD et al. Extreme genetic differences between queens and workers in hybridizing Pogonomyrmex harvester ants. Proceedings of the Royal Society Biological Sciences Series B 2002; 269(1503):1871-1877.

29. Bhaskaran M. Mitochondrial DNA variations in Apis cerana populations of TamilNadu and Karnataka, South India. Biotechnol Bioinf Bioeng 2011; 1(2):221-227.

a pilot study on genetic diversity in indian · a, cerana yellow belgaum acblg 74° 30’00.00”e...

Documents