a ph-independent dna nanodevice for quantifying chloride ... · a ph independent dna nanodevice for...

1

A pH independent DNA nanodevice for quantifying chloride

transport in organelles of living cells

Sonali Saha, Ved Prakash, Saheli Halder, Kasturi Chakraborty and Yamuna Krishnan*

Supplementary Information

Reagents: All unmodified oligonucleotides (Table S1 and Table S4) were purchased from Sigma (India).

All modified oligonucleotides (Table S1) were obtained from IBA GmbH (Germany). Fluorescently

labelled oligonucleotides were subjected to ethanol precipitation prior to use to remove any contaminants

from synthesis. The peptide nucleic acids (PNA) oligomer, P (Table S1) was synthesized using standard

solid phase Fmoc chemistry on Nova Syn® TGA resin (Novabiochem, Germany) using analytical grade

reagents (Applied Biosystems®, USA), purified by reverse phase HPLC (Shimadzu, Japan) and stored at

-20 °C until further use.

Nigericin, valinomycin, monensin, bafilomycin, CCCP (Carbonyl Cyanide m-Chlorophenylhydrazone),

tributyltin chloride (TBT-Cl), NPPB (5-nitro-2-(3-phenylpropylamino) benzoic acid) and human holo-

transferrin were obtained from Sigma (USA). FITC labelled 10 kDa dextran (FD10), Fluorescein-5-

Isothiocyanate and Alexa Fluor® 568 NHS ester were obtained from Molecular probes, Invitrogen

(USA). All other reagents were purchased from Sigma-Aldrich (USA) unless otherwise specified. Sources

for antibodies used in this study are mentioned in the western blot section. Plasmids for transient

transfection in S2R+ cells were obtained from Addgene, USA.

Fly stocks and cell culture: All the Drosophila stocks were obtained from Bloomington Stock Centre at

Indiana University, unless otherwise indicated (Table S6) and maintained as described 1.

Hemocytes were obtained from Drosophila 3rd instar larvae as described previously 1. Briefly, third instar

larvae were surface sterilized, and hemolymph was collected by puncturing the integument using

A pH-independent DNA nanodevice for quantifying chloride transport in organelles of

living cells

SUPPLEMENTARY INFORMATIONDOI: 10.1038/NNANO.2015.130

NATURE NANOTECHNOLOGY | www.nature.com/naturenanotechnology 1

© 2015 Macmillan Publishers Limited. All rights reserved

http://dx.doi.org/10.1038/nnano.2015.130

2

dissection forceps into 150 μL Schneider’s complete media (SCM) containing 10% non-heat inactivated

fetal bovine serum (Gibco, Invitrogen, USA) and 1 μg/mL bovine pancreatic insulin (Sigma, USA) in 35-

mm coverslip-bottom dishes. Labelling incubations were performed on adherent hemocytes 2 h post-

dissection.

S2R+ cells were a generous gift from Prof. Satyajit Mayor’s lab 2, and maintained in Schneider’s medium

(Gibco, Invitrogen, USA) supplemented with 10% FBS (Gibco, Invitrogen, USA) and 1X Penicillin-

Streptomycin-Glutamine (Gibco, Life Technologies, USA) in T25 flask (Nunc, Denmark) and grown at

room temperature (25 °C). These cells stably express human transferrin receptor and were maintained

using 1 μg/mL puromycin (Sigma, USA).

Sample preparation: HPLC purified and lyophilized oligonucleotides and PNA oligomer were dissolved

in Milli-Q water (Milli-Q Integral Water Purification System, Millipore, Germany), aliquoted into small

fractions and stored at -20°C until further use. Stock solutions of Clensor were prepared at a final

concentration of 10 μM by mixing D1, D2 and P in equimolar ratio in 10 mM sodium phosphate buffer,

pH 7.4. The solution was briefly vortexed to mix all the components. Annealing was done by heating the

solution at 90°C for 5 min and cooling at the rate of 5°C / 15 min. For ClensorTf

samples, D1Tfapt, D2

and P were mixed in equimolar ratios at a final concentration of 10 μM in 10 mM sodium phosphate

buffer, pH 7.4 containing 1 mM EDTA, pH 8. Annealing was done as described above. All the samples

were incubated at 4°C for 48 h. Prior to use, stock solution of 100 mM sodium phosphate buffer, pH 7.4

and 500 mM EDTA, pH 8 were filtered using 0.22 μm disk filters (Millipore, Germany).

For modified I-switch (I4LY

A488/A647) sample preparation, 5 μM of I4 and I4′ were mixed in equimolar

ratios in 20 mM potassium phosphate buffer, pH 5.5 containing 100 mM KCl. The resulting solution was

heated to 90 °C for 5 minutes, cooled to the room temperature at 5 °C/15 min and equilibrated at 4 °C

overnight.


3

Gel electrophoresis: Native polyacrylamide gels containing 10% or 15% acrylamide [19:1 acrylamide/

bisacrylamide] were used for gel electrophoresis. Gels were run in 1X TBE buffer (100 mM Tris.HCl, 89

mM boric acid, and 2 mM EDTA, pH 8.3) at 4 °C. Post run, gels were stained with ethidium bromide

(1μg/ml) and observed under a UV- transilluminator (Alpha Imager, Alpha Innotech, USA).

Steady state fluorescence measurements: All fluorescence studies were carried out on a Fluoromax-4

(Horiba Scientific, Japan) spectrophotometer. 10 μM stock of Clensor was diluted to a final concentration

of 200 nM using 10 mM sodium phosphate buffer, pH 7.4 and incubated for 30 min at room temperature

prior to experiments. The emission spectra of BAC and Alexa 647 were acquired by exciting the samples

at 435 nm (Ex of BAC) and 650 nm (Ex of Alexa 647) respectively. Emission spectra of BAC and Alexa

647 were collected between 495-550 nm and 650-700 nm respectively. An emission value of 10 mM

sodium phosphate buffer, pH 7.4 served as blank and was subtracted from relevant acquired spectra. In

order to study the chloride sensitivity of Clensor, final chloride concentrations ranging between 5 mM to

200 mM were achieved by addition of microliter aliquots of 1 M stock of NaCl to 400 μL of sample.

Emission intensity of BAC at 505 nm (G) was normalized to emission intensity of Alexa 647 at 670 nm

(R). Fold change in R/G ratio was calculated from the ratio of R/G values at two specific values of [Clˉ].

To investigate chloride sensitivity of Clensor at pH 5, the stock solution of Clensor was diluted to a final

concentration of 200 nM using 1X modified pH clamping buffer (150 mM KNO3, 5 mM NaNO3, 1 mM

Ca(NO3)2, 1 mM Mg(NO3)2, 20 mM HEPES, pH adjusted to 5 using 1 N HNO3), pH 5 prior to

experiment and fluorescence spectra at different added chloride concentrations were recorded as

described above.

I4LY

A488/A647 samples were diluted to 50 nM in 1× pH clamping buffer of desired pH for all in vitro

fluorescence experiments. All samples were vortexed and equilibrated for 30 min at room temperature.

An in vitro pH calibration curve was obtained by plotting the ratio of donor intensity (D) at 520 nm and


4

acceptor intensity (A) at 669 nm (for A488/A647) as a function of pH when excited at 488 nm. Mean of

D/A from three independent experiments and their SEM were plotted for each pH value.

Labeling hemocytes: Cells were washed with 1X M1 buffer (150 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1

mM MgCl2, 20 mM HEPES, pH 7.4 containing 1 mg/mL BSA and 2 mg/mL D-glucose) prior to

labelling. 10 μM Clensor stock was diluted to a final concentration of 2 μM with 1X M1 buffer and added

to the coverslip containing hemocytes. This step is referred to as a ‘pulse’. Hemocytes were incubated

with Clensor for 5-10 minutes (depending on the signal, *for measurements in early endosomes 5 min

pulse was given*). The cells were then washed 3 to 4 times with 1X M1 and incubated for an additional 5

to 120 minutes as specified. This step is referred to as a ‘chase’. For a chase longer than 5 minutes, 1X

M1 was replaced by SCM and transferred to a 20°C incubator. The cells were then washed 3 to 4 times

with 1X M1 and imaged.

For pHEE and pHRE measurements hemocytes were labelled with a mixture of 10 kDa FITC dextran

(FD10, 2 mg/mL) and ClensorA647 (1 μM), diluted in 1X M1 as described for Clensor.

For pHLY measurements hemocytes were labelled with I4LY

A488/A647 (1 μM), diluted in 1XM1 as described

for Clensor.

Labeling S2R+ cells: In order to facilitate the folding of the aptameric region of the D1Tfapt in ClensorTf

for efficient binding, the stock solution of the ClensorTf

was diluted to a final concentration of 2 μM with

1X M1 and incubated at room temperature for 30 min prior to pulse. To mark REs, we chose Drosophila

S2R+ lines stably expressing the well characterized human transferrin (Tf) receptor 2. The S2R+ cells

were washed with 1X M1 and then incubated with diluted ClensorTf

for 15 min on ice. The labeling

mixture was removed and cells were washed with 1X M1 for 3 to 4 times. The cells were then chased in

1X M1 for 15 min at room temperature and quickly transferred on ice. Surface bound probes were

removed using stripping buffer (160 mM sodium ascorbate, 40 mM ascorbic acid, 1 mM CaCl2, and 1


5

mM MgCl2, pH adjusted to 4.5 using 1N HCl) for 10 min on ice. The cells were further washed 3 to 4

times with 1X M1 and fixed using 2.5% PFA for 10 min at room temperature. The cells were then washed

3 to 4 times with 1X M1 and imaged. Similarly the S2R+ cells were labelled with 100 nM Tf-FITC or

TfA568 for pH measurement and colocalization assays respectively.

Competition assays: Three different dishes containing hemocytes were prepared. The first dish was

incubated with a mixture of 1 μM ClensorA647 and 10 fold excess of maleylated BSA (+ mBSA) for 5 min.

The second dish was incubated with ClensorA647 alone (- mBSA) for 5 min, and the third dish containing

unlabelled cells was imaged to measure the contribution of auto-fluorescence (AF). The cells were then

chased for 5 min to allow internalization by receptor mediated endocytosis, washed 3 times with 1X M1

and then imaged under a wide-field microscope. Whole cell intensities in the Alexa 647 channel was

quantified for ~ 20 cells per dish. The mean intensity from three different experiments were normalized

with respect to the autofluorescence and presented as the fraction of Clensor internalized.

Four independent dishes containing S2R+ cells were prepared. In the first dish, cells were labelled with a

mixture of 1 μM of Clensor Tf

A647 and 25 μM human holo transferrin (+ Tf). Cells in the second and third

dishes were labelled with 1 μM Clensor Tf

A647 without any exogenously added Tf (- Tf) and 1 μM of

ClensorA647 that lacks Tf aptamer (Clensor) respectively. The fourth dish containing unlabelled cells was

imaged to quantify the contribution of auto-fluorescence (AF). Whole cell intensities in the Alexa 647

channel was quantified for ~ 20 cells per dish. The mean intensity from three different experiments were

normalized with respect to autofluorescence and presented as the amount of ClensorTf

A647 internalized.

Chloride clamping of cells: As described earlier, hemocytes and S2R+ cells were pulsed and chased

with 2 μM of Clensor and ClensorTf

respectively. Hemocytes are then fixed with 200 μL 2.5% PFA for 2

min at room temperature, washed 3 times and retained in 1X M1. To obtain the intracellular chloride

calibration profile, perfusate and endosomal chloride concentrations were equalized by incubating the

previously fixed cells in the appropriate chloride clamping buffer containing a specific concentration of


6

chloride (see later), 10 μM nigericin, 10 μM valinomycin, and 10 μM tributyltin chloride (TBT-Cl) for 1 h

at room temperature.

S2R+ cells, pulsed with 2 μM of ClensorTf

are then fixed with 200 μL 2.5% PFA for 20 min at room

temperature, washed 3 times and retained in 1X M1. To obtain the intracellular chloride calibration

profile, perfusate and endosomal chloride concentrations were equalized by incubating the previously

fixed cells in the appropriate chloride clamping buffer containing a specific concentration of chloride (see

later), 10 μM nigericin, 10 μM valinomycin, 5 μM CCCP, 10 μM monensin and 200 nM bafilomycin for

3 h at room temperature.

Chloride calibration buffers containing different chloride concentrations were prepared by appropriately

mixing the 1X +ve chloride buffer (120 mM KCl, 20 mM NaCl, 1 mM CaCl2, 1 mM MgCl2, 20 mM

HEPES, pH, 7.4) and 1X -ve chloride buffer (120 mM KNO3, 20 mM NaNO3, 1 mM Ca(NO3)2, 1 mM

Mg(NO3)2, 20 mM HEPES, pH 7.4) in different ratios.

Chloride measurements: For chloride measurements, hemocytes were pulsed with 2 μM Clensor and

then chased for (i) 5 min (EE), (ii) 60 min (LE) and (iii) 120 min (LY). Each set of cells are then washed

3 to 4 times with 1X M1 and imaged, acquiring images in BAC as well as Alexa 647 channels for each

field of view as described in the image analysis section. To measure chloride concentrations in REs,

S2R+ cell were labelled with ClensorTf

as described as earlier and imaged in two different channels (BAC

and Alexa 647) as described in the image analysis section. A period of 5-10 min was assigned with a

stopwatch, all the images for each time point was captured within this time frame.

pH clamping: For the intracellular pH calibration curve, hemocytes and were labelled with FD10 (2

mg/mL) and I4LY

A488/A647 (1 μM) and S2R+ cells were labelled with Tf-FITC (100 nM). The cells were

then briefly fixed with 200 μL 2.5% PFA for 2 min, washed 3 times and retained in 1X M1. 1X pH

clamping buffer of desired pH (150 mM KCl, 5 mM NaCl, 1 mM CaCl2, 1 mM MgCl2, 20 mM HEPES,


7

pH adjusted to 4.5 to 7 appropriately using 1N NaOH or 1N HCl) containing nigericin (10 μM) was

added to the previously fixed cells and incubated for 30 min followed by imaging in the same buffer.

pH measurements: Hemocytes were labelled with a mixture of 1 μM ClensorA647

and FD10 (2 mg/mL)

and chased for (i) 5 min (EE) and (ii) 60 min (LE). For pHLY measurements, hemocytes were labelled

with 1 μM I4LY

A488/A647 and chased for 120 min. Each set of cells were then washed with 1X M1 and then

imaged, acquiring two images for each field of view as described in the image analysis section.

Fluorescence microscope set up: All wide-field images for chloride measurements were acquired using

Olympus IX81 (Olympus, Japan) an inverted microscope illuminated with mercury halide lamp

(Olympus, Japan). Electronic shutters (Uniblitz, model VMM-D1, NY) in the illumination and detection

paths minimized sample illumination. All the images were acquired using a 512×512, iXonEM

CCD

camera (Andor,UK). Cells were viewed using a 100X, 1.3 NA, phase contrast oil immersion objective

(UPlanFLN, Olympus, Japan). Filter wheel, shutter and CCD camera were controlled using Micro-

Manager 1.4.7 software (developed at the University of California, San Francisco). BAC channel images

(referred to as ‘G’) were acquired using 480/20 band pass excitation filter, 535/40 band pass emission

filter and 86023bs-FITC/ Cy5 as dichroic filter. Alexa 647 channel images (referred to as ‘R’) were

obtained using 640/30 band pass excitation filter, 690/50 band pass emission filter and HQ665lp-665 long

pass dichroic filter. G and R images were acquired using 500 msec and 100 msec exposure times

respectively. GFP and YFP fluorescence were viewed using same filter set used for acquiring G images.

Co-localization experiments with TfA568 were performed on an inverted wide field microscope IX81R

(Olympus, Japan) equipped with iXon CCD camera (Andor technology, UK), X-CiteR metal halide lamp

(Olympus, Japan) and coupled to MetaMorph ver 7.7.1.0 (Molecular Devices, PA) for image acquisition.

Fluorescence images of cells labelled with TfA568 were acquired using 545/25 band pass excitation filter,

595/50 band pass emission filter and 89016bs-FITC/Cy3/Cy5 as dichroic filter. All the images were


8

obtained with a 100X oil immersion objective with 1.4 NA (UPlanSApo, Olympus, Japan). All excitation,

emission and dichroic filters used in this study were purchased from Chroma technology corp.,USA.

pH measurements were performed by dual excitation method of fluorescein 4 on an inverted wide field

microscope IX81R (Olympus, Japan) equipped with iXon CCD camera (Andor technology, UK), X-

CiteR metal halide lamp (Olympus, Japan) and coupled with MetaMorph ver 7.7.1.0 (Molecular Devices,

PA) for image acquisition. Two sets of images were acquired by exciting the cells using 430/30 (referred

as ‘Ex430’) and 480/30 (referred as ‘Ex480’) band pass excitation filters. In both the cases emissions

were collected using 535/40 band pass emission filter and 89006bs-CFP/YFP/RFP as dichroic filter. For

pH measurements in hemocytes, one extra set of images were acquired in the Alexa 647 channel using

655/20 band pass excitation filter, 710/75 band pass emission filter and 86020bs-FITC/Texas Red®/Cy5

as dichroic filter.

For pH measurements with I4LY

A488/A647, hemocytes were imaged in three channels to yield three images,

(i) donor channel by exciting at 488 nm and collecting at 520 nm (ii) FRET channel by exciting at 488 nm

and collecting at 669 nm and (iv) acceptor channel by exciting at 550 nm and collecting at 669 nm. All

the images for pH measurements were obtained with a 100X oil immersion objective with 1.4 NA

(UPlanSApo, Olympus, Japan). All excitation, emission and dichroic filters used in this study were

purchased from Chroma technology corp.,USA.

Image analysis: Images were analyzed with ImageJ ver 1.47 (NIH, USA). For chloride measurements,

regions of cells containing single well-demarcated endosomes/lysosomes in each Alexa 647 (R) image

were identified and marked manually using ‘elliptical’ selection tools and the coordinates saved in the

ROI plugin in ImageJ. Similarly for background computation, four nearby regions outside each of the

endosomes were marked and saved as ROI. The same regions were identified in the BAC (G) image

recalling the ROIs and appropriate correction factor for chromatic aberration if necessary. The average

background was computed for each selected endosome region from the mean intensity of the three lowest


9

of the four selected background regions. After background subtraction, integrated intensity and mean

intensity for each endosome (present in R and G images) were measured and recorded in an OriginPro 8.5

(OriginLab, USA) file. A ratio of R to G intensities (R/G) was obtained from these values by dividing the

integrated intensity of a given endosome in the R image with the corresponding intensity in the G image.

For a given experiment, mean [Clˉ] of an organelle population was determined by converting the mean

R/G value of the distribution to [Clˉ] values according to the intracellular calibration profile. The mean

[Clˉ] value of each organelle population across multiple trials on different days is determined and the final

data is presented as mean of this mean [Clˉ] value ± standard error of the mean. Data for chloride

clamping experiments was analyzed similarly.

Colocalization of GFP/YFP and Alexa 647 or Alexa 568 and Alexa 647 was determined by counting the

numbers of Alexa 647 positive puncta that colocalize with GFP/YFP or Alexa 568 positive puncta and

expressing them as a percentage of the total number of Alexa 647 positive puncta.

Auto-fluorescence was measured on unlabelled cells. For competition assays, first all the images were

subjected to background subtraction by taking mean intensity over a large cell-free area. The cell

boundary was determined from the phase contrast image and stored as ROI in ImageJ. These ROIs were

recalled after opening the fluorescence image and the total cell intensity in Alexa 647 channel was

measured in all dishes.

For pHEE and pHLE measurements in hemocytes Ex480 and Alexa 647 images were overlapped using

ImageJ and endosomes showing colocalization were selected for further analysis. After background

subtraction, endosomes were demarcated in each image and their mean intensity calculated for both

Ex430 and Ex480 images. Ex480 to Ex430 intensity ratio (Ex480/Ex430) was computed from the

integrated intensity of a given endosome in the Ex480 image with the corresponding intensity in the

Ex430 image. Similar analysis was performed to measure pH in S2R+ cells. For a given time point or a

given pH clamping experiment, the mean Ex480/Ex430 was determined for a collection of endosomes.


10

The mean Ex480/Ex430 for three experiments were collected and plotted along with s.e.m for a given

experimental condition such as chase time or pH clamp.

For pHLY measurements with I4LY

A488/A647 integrated intensity in each endosome was measured in donor

(D) and FRET (A) channels and D/A ratio of each endosome was obtained. The mean D/A of each

distribution for lysosomes or pH clamped endosomes were converted to pH according to the intracellular

calibration curve. Data was represented as mean pH value ± standard error of the mean.

Immunofluorescence imaging were carried out on the Olympus Fluoview 1000 confocal microscope

(Olympus) using an Argon ion laser for 488 nm excitation and He-Ne laser for 633 excitation with a set

of dichroics, excitation, and emission filters suitable for each fluorophore.

Generation of dsRNA for DmClC-b and DmClC-c gene: Firstly, the cDNA of a region of DmClC-b

(~557 bp) and DmClC-c (~564 bp) gene was PCR-amplified using specific primers to add T7

polymerase-binding sites (Table S5). These ethanol precipitated PCR products were used as templates for

in vitro transcription (IVT). The dsRNA to both genes were synthesized using the Ambion MEGAscript

kit (AM1334, Life Technologies, USA). Each reaction mixture was then precipitated using 3M sodium

acetate and 100% ethanol at -20° C and the pellet was air-dried. The RNA pellet was resuspended in 20

μL of MilliQ water, heated at 65° C for 30 min and then cooled to room temperature to allow annealing of

the strands. The dsRNA was characterized by 1.5% agarose gel to verify the size and integrity, quantified

by UV spectrophotometry and stored at -20° C.

RNAi in S2R+ cells: S2R+ cells were plated in 12 well plates (Greiner Bio-One GmbH, Germany) in

Schneider’s complete media with a seeding density of 106 cells/well. The cells were then allowed to settle

down for 45 min to 1 h. After that, the complete media was removed and ~ 600 μL of Schneider’s

incomplete media containing 7.5 μg of dsRNA was added to the cells and incubated for 1 h. Control cells

were incubated in ~ 600 μL of Schneider’s incomplete media without dsRNA for same time. After 1 h,


11

Schneider’s incomplete media was replaced with ~ 600 μL of Schneider’s complete media and incubated

at 25 °C for 4 days. After 96 h the cells were plated for chloride concentration and pH measurements 2-3

h before the assays.

RT-PCR: To check the expression of DmClC-b and DmClC-c, total RNA was isolated from both S2R+

cells and Drosophila 3rd

instar larvae using the Trizol-chloroform method (Invitrogen, USA). Briefly, 1

μg of total RNA was reverse-transcribed using MuMLV reverse transcriptase (Invitrogen, USA) with

oligo dT18 primers. 2 μL of the cDNA was used for a standard PCR using Taq DNA Polymerase (New

England Biolabs, UK). The RT-PCR products were analyzed on a 1.5% agarose gel.

S2R+ cells were labelled with 200 nM Tf-FITC as described earlier. The cells were then washed with 1X

M1 and then imaged, acquiring two images for each field of view as described in the image analysis

section.

Western blot: To isolate total protein for western blot analysis, wild type or transgenic Drosophila 3rd

instar larvae were thoroughly cleaned in double distilled water to remove food. 5-10 larvae were

homogenized using a plastic pestle in 100 μL of homogenizing buffer (40 mM Tris pH 7.4, 1 mM EGTA,

1 mM EDTA, 0.05% Triton X-100) containing 1X protease inhibitor cocktail (Sigma, USA). Then the

sample was heated at 70°C for 10 min and briefly vortexed. Then the sample was spun at 100 g for 2 min

to settle debris. Protein was estimated using BCA assay in 96-well protocol (Thermo Scientific, USA).

An aliquot (~ 100 μg) of each lysate was subjected to 8% SDS-PAGE and transferred to nitrocellulose

using standard protocol. The nitrocellulose membrane was cut into two parts. One part was incubated

with a 1:100 dilution of a custom raised rabbit anti-DmClC-b antibody against the N-ter 14 aa sequence

of DmClC-b (Abmart, Chaina) and another part was incubated with 1:500 dilution of rabbit anti-CLCN3

antibody (Abcam) overnight at 4 °C. Then both the membranes were washed and probed with 1: 3000

dilution of HRP conjugated goat anti-rabbit antibody (Abcam) for 1 h at room temperature. Binding of

primary antibody was detected by the ECL method (Pierce) according to the manufacturer’s instructions.


12

Those membranes were further stripped using a mild stripping protocol and re-probed for tubulin using

1:5000 dilution of anti-tubulin antibody (Abcam).

Immunofluorescence staining: S2R+ cells were transfected with GFP-Rab5 / YFP-Rab7 / LAMP1-GFP/

YFP-Rab11 using Effectene (Qiagen). Immunofluorescence staining was carried out on S2R+ cells

transiently expressing GFP-Rab5 / YFP-Rab7 / LAMP1-GFP/ YFP-Rab11 after fixing the cells with 2.5%

paraformaldehyde for 20 min at room temperature. To detect intracellular antigens, the cells were

permeabilized with 0.37 % NP-40 (Sigma) in 1X M1 buffer. Non specific antibody binding was blocked

using 5% BSA (Sigma) in 1X M1 for 1.5 h at room temperature. The cells were then either stained with

rabbit anti-DmClC-b (Abmart, China) or rabbit anti-CLCN3 antibody (Abcam) for overnight at 4 °C

followed by incubation with Alexa 647 conjugated goat anti-rabbit (Invitrogen, USA) secondary antibody

for 1 h at room temperature. The cells were then imaged in a confocal microscope.

FRET and FLIM measurements: To quantitate the amount of dissociation of BAC-PNA if any from

Clensor, J774 cells were pulsed with 5 µM ClensorN-5ʹ

or ClensorN-3ʹ

in M1 buffer (pH 7.4) for 30 min at

37oC. Cells were then washed with PBS followed by a brief fixation using 2.5% PFA for 2 min at RT.

Cells were again washed with PBS and were clamped at pH 5 and 5 mM chloride for 1 hour.

Fluorescence images were acquired for BAC (λEx = 430/24 nm, λEm = 520/40 nm), Atto 565 (λEx = 545/25

nm, λEm = 595/50 nm) and FRET (λEx = 430/24 nm, λEm = 595/50 nm).

Mean autofluorescence in the FRET and acceptor channels were measured from unlabelled cells

subjected to identical conditions. These mean values were subtracted from whole cell intensity data

followed by calculation of FRET/A value for each cell. To compare these values to in vitro values, a drop

of 1μM ClensorN-5ʹ

or ClensorN-3ʹ

in pH 5 and 5 mM chloride clamping buffer was imaged under identical

imaging settings and corresponding FRET/A values were calculated.

In vitro temperature dependent fold change of FRET Clensor: 10 μM stock of ClensorN-5ʹ

or ClensorN-

3ʹwas diluted to a final concentration of 200 nM in pH 5 and 10 mM chloride clamping buffer and


13

incubated for 30 min at room temperature prior to experiments. Emission spectra was acquired by

exciting the samples at λEx = 435/5 nm and λEm = 450-700 nm at RT and 70 oC. An emission value of pH

5 and 10 mM chloride clamping buffer served as blank and was subtracted from relevant acquired spectra.

DDIR/AFRET values (DDIR, λEx = 435/5 nm and λEm = 505/5 nm; AFRET, λEx = 435/5 nm andλEm = 590/5 nm)

were calculated and were used for comparison of ClensorN-5ʹ

or ClensorN-3ʹ

.

Statistical analysis of R/G values: Mann–Whitney U test were used to check the statistical significance

of the R/G distributions. Statistical significance level was set to P < 0.05 and marked as asterisks (*) in

the figures. All data were analyzed using online Mann-Whitney U-value Calculator

(http://www.socscistatistics.com/tests/mannwhitney/).

Name Sequence Comment

P BAC-NHε-Lys-ATC AAC ACT GCA-Lys-COOH PNA strand: Sensing module

D2 5′ TATATATA GGATCTTGCTGTCTGGTG TGC AGT GTT GAT 3′ DNA strand: Normalizing module; internal Alexa

647 modification on the T shown in bold

D1 5′CACCAGACAGCAAGATCC TATATATA 3′ DNA strand: Targeting module

D1Tfapt5ʹ

CACCAGACAGCAAGATCCTATATATAGGGGGAUCAAUCCAAGGGA

CCCGGAAACGCUCCCUUACACCCC 3ʹ

DNA RNA hybrid strand : Targeting module with

RNA aptamer against human transferrin

receptor.

I4 5ʹ

GACTCACTGTTTGTCTGTCGTTCTAGGATATATATTTTGTTATGTGTTA

TGTGTTAT 3ʹ

DNA strand: internal Alexa 647 modification on

the T shown in bold

I4ʹ 5ʹ

CCCCTAACCCCTAACCCCTAACCCCATATATATCCTAGAACGACAGAC

AAACAGTGAGTC 3ʹ

DNA strand: 5ʹ Alexa 488 modification

Clensor and ClensorTf sequences

Supplementary Table S1 | Sequences used for Clensor, ClensorTf and I4LYA488/A647 assemblies.

Oligo P, Oligo D1 and Oligo D2 combine to form Clensor. Oligo P, Oligo D1Tfapt and Oligo D2

combine to form ClensorTf. The sequences in matching colors are complementary. D1Tfapt a 69-

mer RNA-DNA hybrid sequence. The portion of the sequence in black correspond to the RNA

aptamer against human transferrin receptor, bold letters indicate 2ʹ fluoro modified bases.

Bases shown in green correspond to a DNA segment.


14

a b c

Supplementary Figure S1 | Gel mobility shift assay showing the formation of Clensor and

ClensorTf. a, 10% Native PAGE run in 1X TBE buffer (pH 8.3) at 4°C. Lane 1: D1Tfapt, 2: D2, 3:

D1+D2 (Clensor-P), 4: D1+D2+P (Clensor). b, 10% Native PAGE run in 1X TBE buffer (pH 8.3)

at 4°C. Lane 1: D1, 2: D2, 3: D1+D2 (Clensor-P), 4: D1+D2+P (Clensor), 5: D1Tfapt+D2. c, 15%

Native PAGE run in 1X TBE buffer (pH 8.3) at 4 °C. Lane 1: D1Tfapt+D2 (ClensorTf-P), 2:

D1Tfapt+D2+P.

Formation of Clensor and ClensorTf

: The formation of Clensor and ClensorTf

was confirmed by a gel

mobility shift assay using native polyacrylamide gel electrophoresis (PAGE) (Fig. S1). To see whether P,

D1 and D2 could associate to form Clensor, we annealed 10 μM of all three components in equimolar

ratios in 10 mM Sodium phosphate buffer, pH 7.4 and investigated the sample by PAGE. The formation

of Clensor (Fig. S1a, lane 4) was revealed by its lower electrophoretic mobility with respect to its

component single strands (Fig.S1a, lane 1 and 2) and all possible bimolecular complexes (Fig. S1a, lane

3). Similarly, we annealed 10 μM each of P, D1Tfapt and D2 in 10 mM Sodium phosphate buffer, pH 7.4

and analyzed the sample by PAGE. ClensorTf

showed a band with significantly reduced mobility (Fig.

S1c, lane 2) as compared to its component single strands and all possible bimolecular complexes (Fig.

S1b, lane 1, 2 and 5; Fig. S1c, lane 1) confirming the formation of ClensorTf

in excellent yield. Due to the


15

0 50 100 150 200

1

2

3

4

5 Clensor, pH 5

No

rma

lize

d R

/G

[Cl-](mM)

a b

0.0

0.5

1.0

1.5

2.0

2.5

3.0

pH 5.0

Fo

ld C

ha

ng

e

(Be

twe

en

0-1

20

mM

Cl- )

pH 7.4

U

W

small but significant mobility difference between the D2+D1Tfapt and ClensorTf

, we could not analyze

component single strands, bimolecular complex and ClensorTf

on 10% native PAGE. However, the

bimolecular complexes and ClensorTf

were resolved clearly in 15 % native PAGE with a 9 h run time.

Supplementary Figure S2 | In vitro characterization of Clensor (200 nM) as a function of

pH. a, Clˉ calibration profile of Clensor showing Alexa 647/BAC fluorescence intensity ratio

(R/G) versus [Clˉ] in 1X pH clamping buffer of pH 5. b, In vitro fold change in R/G ratios of

Clensor at 0 mM to 120 mM Clˉ measured at pH 7.4 and pH 5.0. Error bars indicate the mean of

three independent experiments ± s.e.m.

Effect of pH on chloride sensitivity of Clensor: To study the effect of pH on the chloride sensitivity of

Clensor, fluorescence spectra of Clensor (200 nM) were recorded in 1X modified pH clamping buffer

(buffer Clˉ replaced with NO3ˉ), pH 5 containing different added [Cl−] ranging from 5 mM to 200 mM.

The plot of normalized R/G as a function of [Cl−] indicates that Clensor, at pH 5, varies linearly with Clˉ

from 0 -200 mM with negligible change in its Clˉ sensitivity compared to pH 7.4 (Fig. S2a). The in vitro

fold change in R/G ratios of Clensor within 1 mM to 120 mM Clˉ concentration at pH 5 is similar to that

observed at pH 7.4 (Fig. S2b) indicating that the Clˉ sensitivity of Clensor is pH independent. The

denominator in the R/G is chloride sensitive whereas the numerator remains constant at different chloride


16

Clensor ClensorTf

a b

concentrations similar to the F0/F ratio in the Stern-Volmer equation. Therefore, R/G vs [Clˉ] plot is

equivalent to F0/F vs [Clˉ] plot or the Stern-Volmer plot.

Comparison of BAC with other chloride sensitive small molecule: BAC is the best candidate for a

chloride sensitive small molecule for chloride measurements of subcellular compartments5. (1) It is

bioconjugatable and hence can be targeted to specific intracellular locations, ii) it can be excited in the

visible range and (iii) it can sense chloride over a wide range (0-200 mM) of chloride. Compared to BAC,

most other chloride-sensitive fluorophores are not bioconjugatable6. An attempt to make them

bioconjugatable often leads to loss of their chloride sensitivity. For example, lucigenin, the precursor

molecule of BAC has very high chloride sensitivity with Stern-Volmer constant for the collisional

quenching of 390 M-1

which decreases around 10 fold in case of BAC conjugated to dextran (36 M-1

)5,7

.

Most of them are excited at wavelengths in the UV range and not suitable for live cell imaging7. Their

limited range of chloride sensitivity has been an issue to measure high chloride concentrations8.

Supplementary Figure S3 | Clensor and ClensorTf integrity are maintained post-

endocytosis. a, Hemocytes were pulsed with Clensor (2 μM, 50 μL) for 5 min and chased for 2

h and imaged. Quantitative colocalization of BAC (green) and Alexa 647 (red) upto 2 h post

internalization in distinct punctate endosomes reflects Clensor integrity. Scale bar: 10 μm. b,

S2R+ cells were pulsed with ClensorTf (2 μM, 50 μL), chased for 15 min and then imaged under


17

a wide field microscope. Quantitative colocalization of BAC (green) and Alexa 647 (red) in

distinct punctate endosomes reflects ClensorTf integrity post-internalization. Scale bar: 10 μm.

0 50 100 150 200 2500.8

1.2

1.6

2.0

2.4

[Cl -] (m

M)

Time (min)

(E

x480/

Ex430)

Bafilomycin

20

40

60

80

100

120

60 min

Bafilomycin

20 mM

110 mM

[Cl-]

5 min 120 min

a b

Supplementary Figure S4| Integrity of Clensor during endo-lysosomal maturation. a, Plot

showing endo-lysosomal [Clˉ] (blue trace) and (Ex

480/Ex

430) ratios indicating endo-lysosomal

pH as a function of time (black trace). Red arrow head indicates time of was added external

addition of bafilomycin. Error bars indicate the mean of three independent experiments ± s.e.m.

(n >25 cells, ≥75 endosomes) b, Representative pseudocolour R/G map of hemocytes labelled

with Clensor and imaged at the indicated chase times before and after addition of bafilomycin

shown by red arrow head. Scale bar: 10 μm.

Integrity of Clensor during endo-lysosomal maturation: We confirmed the integrity of Clensor and the

photostability of BAC in the intracellular environment over 120 min of endosomal/lysosomal maturation,

using the following assay. Compartmental [Clˉ] and [H+] were depleted by the addition of bafilomycin at

45 min post endocytosis in macrophages 9. Therefore, bafilomycin was used to perturb endosomal [Clˉ]

and these perturbations were followed by changes in R/G ratios in Clensor labelled endosomes of

hemocytes. pH was simultaneously measured in this system by pulsing with 2 mg/mL 10 kDa FITC-

dextran (FD10) for 5 min at room temperature and chased for 120 min at 20 °C. The cells were then


18

incubated with 1X M1 buffer containing 200 nM bafilomycin followed by a 120 min chase at 20 °C in the

same buffer. Intracellular pH was measured by the dual excitation method. Ex480/Ex 430 emission

ratios show ~2.1 fold decrease as a function of time till 120 min post endocytosis, indicating the expected

decrease in pH (Fig. S4a, black) 9. Upon bafilomycin treatment, endosomal pH is reversed as given by

gradual increase (~2.2 fold) in Ex480/Ex 430 emission ratios (Fig. S4a, black).

Independently, changes in [Clˉ] were mapped by pulsing hemocytes with Clensor for 5 min at

room temperature and followed by 120 min chase at 20 °C. We observed a decrease in R/G ratios as a

function of time till 120 min post endocytosis, corresponding to a change in mean endosomal [Clˉ] from

~37.1 mM to ~108.5 mM that then remained quite constant till 180 min, when bafilomycin was added in

the external buffer (Fig. S4a, blue). After bafilomycin treatment, R/G ratios gradually decreased

indicating the reversal of endosomal [Clˉ] (Fig. S4a, blue). Here the decrease in R/G ratios or the recovery

of BAC fluorescence indicates that reduction in BAC fluorescence was not due to photobleaching but due

to collisional quenching by Clˉ present in the lumen of endosomal compartment. Fig. S4b shows the

representative pseudocolour R/G map of hemocytes during the time course of this experiment.

Additionally, colocalization of BAC and Alexa 647 in the endosomal compartments during the time

course of this experiment indicate the integrity of the Clensor scaffold. To overcome the issue of

photobleaching, same dishes were not imaged continuously. Instead, multiple dishes were chased for

different time period with or without bafilomycin treatment over the full duration of the assay.

Quantitative imaging to probe chemical integrity of Clensor: Using a set of quantitative imaging

experiments that utilizes the difference in photophysical properties of BAC-PNA alone, and BAC-PNA

when it hybridized to the Clensor scaffold, we show negligible Clensor dissociation in endosomes of

cells on the timescales of the study outlined in this manuscript. These include quantitative FRET and

FLIM experiments outlined below. Chemical integrity of dsDNA domain in Clensor (Fig. S5a, black

rectangle) has already been probed in a previous study from our lab 11

.


19

1. FRET reveals negligible Clensor disintegration within lysosomes: To measure the extent of

any dissociation of BAC-PNA from Clensor, we performed a quantitative FRET-based assay. A variant

of Clensor called ClensorN-3'

carrying a FRET pair was designed (Fig. S5b). Here, an acceptor dye

(Atto565) was attached to the 3ʹ terminus of D2 (with an inter-fluorophore distance of < 3 nm) such that it

undergoes efficient FRET with the BAC label on BAC-PNA. As a non-FRET control, we designed

ClensorN-5'

where the Atto 565 label was placed on the 5ʹ terminus, ~11 nm away from the BAC label,

well beyond the regimes conducive for FRET. ClensorN-5'

in endosomes serves as a mimic of a scenario

where BAC-PNA is dissociated from Clensor in the endosome and is somehow trapped in the endosome

along with the normalizing flourophore in a specific ratio, and thereby still able to give an accurate [Clˉ]

read-out, despite the DNA nanodevice having disintegrated.

0.0

0.5

1.0

1.5

No

rma

lize

dA

FR

ET

/AD

IR

Atto 565 AFRET/ADIR

0 1 20

5

10

15

20

Fre

qu

en

cy

AFRET/ADIR

ClensorN-5'

0 1 20

5

10

15

20

Fre

qu

en

cy ClensorN-3'

da

ClensorN-3' ClensorN-5'

c

e

P

D1D2

P

D1D2

D1 D2

P

Clensor

b

Cle

nso

rN-3

' C

len

so

rN-5

'

Supplemenatry Figure S5 | In cellulo integrity of Clensor. a, Dotted rectangle indicates

dsDNA domain of Clensor. b, Design of FRET Clensor. P: sensing module (pink line) containing

BAC (green filled star); D2: normalizing module containing acceptor, Atto 565 (red filled circle)

at 3ʹ (ClensorN-3ʹ) or 5ʹ end (ClensorN-3ʹ) of D2. c, in vitro fold change in AFRET/ADIR for two

constructs. d, Atto 565 channel and corresponding pseudocolour AFRET/ADIR map of J774 cells


20

pulsed with ClensorN-3ʹ or ClensorN-5ʹ, clamped at 5 mM Clˉ and pH 5. e, Histograms showing

typical spread of AFRET/ADIR values of whole cells clamped at 5 mM Clˉ and pH 5. (n> 30 cells).

Fluorescence images were acquired for BAC (λEx = 430/24 nm, λEm = 520/40 nm), Atto 565 (λEx

= 545/25 nm, λem = 595/50 nm) and FRET (λEx = 430/24 nm, λEm = 595/50 nm). Scale bar 10

μm.

ClensorN-3'

shows higher AFRET/ADIR value while ClensorN-5'

shows a lower AFRET/ADIR value (AFRET =

intensity in the acceptor channel when exciting BAC; ADIR = intensity in the acceptor channel upon direct

excitation of Atto565) (Fig. S5d). A quantitative measure of a fully associated nanodevice, with

quantitative retention of structural integrity, is given by the ratio of AFRET/ADIRvalues between ClensorN-

3'to Clensor

N-5'. In vitro, this corresponds to an AFRET/ADIR value of 1.4 (Fig. S5c). All the FRET

measurements in vitro and in cellulo were done in clamping buffer, pH 5 (to mimic lysosomal pH) and 5

mM Clˉ, to enhance BAC fluorescence in order to have efficient FRET. Next, J774 cells were labelled

with either 5 µM ClensorN-5ʹ

or ClensorN-3ʹ

and clamped as described in methods section. Fluorescence

images were acquired in the Atto channel (λem = 595/50 nm) by direct excitation (ADIR, λex = 545/25 nm)

and by FRET (AFRET, λex = 430/24 nm). Whole cell intensities in the ADIR and AFRET channels were each

background subtracted from autofluorescence levels (values obtained from unlabelled cells under the

excitation and emission conditions). A ratio of background corrected AFRET/ADIR values for n >30 cells of

ClensorN-3'

to ClensorN-5'

was ~1.4, indicating no detectable dissociation of BAC-PNA from ClensorN-3ʹ

within endosomes of cells on the timescales employed in this entire study (Fig. S5e).

We provide the thermal melting profile of the sensing module of Clensor that indicates a very high Tm

(~78 oC) (Fig. S6a). This was a critical, primary consideration in the choice of duplex sequence that went

into the design of Clensor12

. In fact, DDIR/AFRET values (DDIR, λEx = 435/5 nm and λEm = 505/5 nm; AFRET,

λEx = 435/5 nm and λEm = 590/5 nm) of ClensorN-3'

to ClensorN-5'

showed an in vitro value close to 2.2 at


21

RT and ~2.3 even at 70 oC, indicating negligible thermal denaturation at this high temperature (Fig. S6b).

This is consistent with the observed integrity of the device at room temperature in cells.

Supplemenatry Figure S6 | In vitro integrity of Clensor. a, in vitro UV melt of D2+P duplex.

b, comparison of fold change in DDIR/AFRET at RT and 70oC (DDIR, λEx = 435/5 nm and λEm = 505/5

nm; AFRET, λEx = 435/5 nm and λEm = 590/5 nm).

2. FLIM reveals that free BAC-PNA cannot be retained in endosomes: To mimic conditions

where Clensor is dissociated and to illustrate the fundamentally different behavior of BAC-PNA post-

disintegration from the Clensor scaffold, 100 µM BAC-PNA in M1 buffer (pH 7.4) was pulsed for 30 min

at 37oC in J774 cells, washed with PBS, briefly fixed (2.5% PFA for 2 min) at RT and clamped at pH 5

and 5 mM Clˉ as described. Confocal FLIM (Fluorescence Lifetime Imaging Microscopy) images of cells

were acquired on Nikon ISS Alba (λEx= 448 nm, λEm = 530/43 nm, frequency modulation of 20-140 MHz

with peak counts of ~1000). Identical images were obtained from unlabelled J774 cells. A comparison of

BAC-PNA labelled J774 cells with autofluorescence of unlabelled cells shows a marked difference in

intensity and labelling pattern (Fig. S7a, b). BAC-PNA “paints” the entire cytoplasm, along with

significant enrichment in the nucleolus (Fig. S7a, c). This is in dramatic contrast to the punctate pattern

seen in the autofluorescence image (Fig. S7b, d). In all our studies deploying Clensor in J774 cells and

0

1

2

No

rmalized

DD

IR/A

FR

ET

a

RT 70oC

b

40 50 60 70 80 900.435

0.440

0.445

0.450

0.455 1 M D2+P

A2

60

Temperature (C)


22

hemocytes, we have never observed BAC intensity in the nucleolus, which one anticipates as a clear

indicator of Clensor dissociation.

The molecular identity of the fluorophore in BAC-PNA labelled cells was obtained from the lifetimes

(Fig. S7e-h). The long lifetime component of BAC-PNA stained cells was found to be 6.7 ± 1.1 ns and is

notably different from the long lifetime component of autofluorescence (4.5 ± 0.7 ns) (Table S2). Further,

the in vitro FLIM of a solution of 1µM BAC-PNA in 5 mM chloride clamping buffer, pH 5 obtained

under identical instrument settings yielded a long lifetime component of 7.3 ± 0.5 ns. This was consistent

with the in cellulo data within experimental error. The short lifetime component in vitro for BAC-PNA is

due to Photoinduced Electron Transfer (PET) from PNA nucleobases 13–15

. Taken together this data

confirms(i) negligible Clensor dissociation in endosomes of cells, and (ii) that if BAC intensity is

observed in an endosome, it arises from BAC-PNA which is hybridized to its complementary DNA strand

on Clensor.

c d

g h

a b

e f

Supplemenatry Figure S7 | Subcellular localization of BAC-PNA. Comparison of J774 cells

labelled with BAC-PNA (100 μM) and unlabelled cells clamped at 5 mM Chloride and pH 5. a,

Raw fluorescence intensity for BAC-PNA labelled cells. b, Raw fluorescence intensity for

unlabelled cells. c, Zoom in of a. d, Zoom in of b. e, long fluorescence lifetime component for


23

0

20

40

60

80

100

120 min60 min5 min

% o

f c

olo

ca

liza

tio

n

YFPRab5

YFPRab7

GFPLAMP

BAC-PNA labelled cells. Scale bar 10 μm. f, long fluorescence lifetime component for unlabelled

cells. g, Zoom in of c. scale bar 5 μm. h, Zoom in of d.

Supplementary Table S2| Comparison fluorescence lifetimes of BAC-PNA and

autofluorescence clamped at 5 mM Clˉ and pH 5.8 Frame average and 8 pixel binning was done

to improve S/N ratio and individual pixels were fitted to multiexponential functions. The

goodness of fit was determined by using the reduced χ2 values. Data acquisition and processing

were utilized Vista Vision version 4.1.031.08 software. Uncertainties in the phase and

modulation values were 0.2 and 0.004, respectively. Instrument was calibrated against

fluorescein in 0.1 M NaOH.

Supplementary Figure S8 | Trafficking of Clensor (ClensorA647

) in Drosophila hemocytes

isolated from flies expressing YFP-Rab5, YFP-Rab7 and GFP-LAMP at the indicated chase

times. Percentage colocalization of ClensorA647

with fluorescent protein-tagged endosomal

SampleIndividual lifetime components and

populationsAverage lifetime (ns)

In vitro BAC-PNA 2.1 1.6 (0.47 0.21), 7.3 0.5 (0.53 0.21) 7.0 0.3

In cellulo BAC-PNA 1.4 0.7 (0.76 0.06), 6.7 1.1 (0.24 0.06) 4.9 0.8

Autofluorescence 1.3 0.4 (0.27 0.09), 4.5 0.7 (0.73 0.09) 3.2 0.4


24

markers (Rab5, EE, black bars; Rab7, LE/LY, white bars; LAMP, LY, gray bars) at indicated

times (n >10 cells, ~75 endosomes). Error bars indicate the mean of three independent

experiments ± s.e.m.

Trafficking of Clensor in Drosophila hemocytes: To follow endosomal maturation along the ALBR

pathway, we determined the residence times of internalized Clensor in compartments along the endo-

lysosomal pathway namely early endosomes (EEs), late endosomes (LEs) and lysosomes (LYs).

Therefore, time-course experiments were performed with a Clensor scaffold carrying only Alexa 647

called ClensorA647, in Drosophila hemocytes expressing fluorescent fusions of well-known endocytic

compartment markers such as YFP-Rab5 for EEs, YFP-Rab7 for LEs/LYs and GFP-LAMP for LYs 16

.

Initially, ClensorA647 shows negligible colocalization (~12%) with LAMP that gradually increases and

reaches a maximum at 120 min (~84%) (Fig. S8). At 5 min, ClensorA647 shows highest colocalization with

Rab5 (~78%) that decays with increasing time (Fig. S8). However, colocalization with Rab7 is negligible

at 5 min and saturates at 60 min (~78%) (Fig. S8). This reveals that in Drosophila hemocytes, Clensor is

resident predominantly in the EEs, LEs and LYs at 5 min, 60 min and 120 min respectively. Fig. 2b

shows representative co-localization images in hemocytes between the indicated fluorescent endosomal

marker and ClensorA647 at the indicated chase times, consistent with previous studies 10

.


25

0

12

A647 R/G

5mM

80mM

- fixation + fixation- fixation + fixation

0.0

0.5

1.0

1.5

2.0

J774 - Fix

J774 + Fix

Hemocytes - Fix

Hemocytes + Fix

Fo

ld C

ha

ng

e (

5 m

M -

80 m

M)

In vitro

a b

c d

Supplementary Figure S9 | Chloride clamping with or without fixation. a, Representative

bright field images of Drosophila hemocytes after incubation in chloride clamping buffer

containing 10 µM nigericin, 10 µM valinomycin and 10 µM TBT-Cl for 1 h, without (-fixation) and

with mild fixation (+fixation). Scale bar: 10 µm; b, Representative bright field images of J774

macrophages after incubation in chloride clamping buffer containing 10 µM nigericin, 10 µM

valinomycin and 10 µM TBT-Cl for 1 h, without (-fixation) and with mild fixation(+fixation). Scale

bar: 10 µm; c,Alexa 647 channel and respective pseudocolour R/G map of J774 macrophages

pulsed with Clensor and clamped at 5 mM and 80 mMClˉ. Scale bar: 5 μm. Macrophages were

pulsed with Clensor (2 μM, 50 μL) for 45 min, fixed and clamped at [Clˉ] values 5 mM and 80

mM through the external addition of 10 μMnigericin, 10 μMvalinomycin and 10 µM TBT-Clˉ.


26

Cells were incubated for 1 h and then imaged on a wide field microscope. Scale bar: 5 μm. d,

Comparison of fold change in R/G ratios of Clensor at 5 mM and 80 mMClˉ in vitro, in

hemocytes fixed (+Fix) and unfixed (-Fix)and in J774 macrophages fixed (+Fix) and unfixed (-

Fix).

Justification of fixation prior to chloride clamping: Live cells maintain specific cytosolic and intra-

organellar ionic concentrations for their proper function. Therefore enforcing an equilibration (i.e.,

clamping) of ionic concentrations of the extracellular and intracellular milieu in order to calibrate a probe

is, by definition, a non-physiological condition – whether it is in a “live”, unfixed state or a fixed state. It

is well documented that cell health deteriorates rapidly post-exposure to the ionophores such as nigericin

and tributyltin chloride (TBT-Cl) 17,18

. Infact, PC12 cells treated with 5 µM TBT-Cl for 1 h shows nearly

100% cytotoxicity 19

. Therefore after 1 h of incubation with 10 µM nigericin, 10 µM valinomycin and 10

µM TBT-Cl for chloride clamping, anyway the relevant Drosophila cells would not be expected to be

‘alive’.

We have performed our clamping experiments in Drosophila hemocytes. Hemocytes are primary cells

that are loosely adherent in nature. When incubated with ionophores for 1 -3 h without a priori fixation,

hemocyte morphology and adherence to the supporting surface was remarkably poor compared to the

hemocytes that were mildly fixed before the same procedure (Fig. S9a). Typically dying hemocytes round

up and detach from the surface and these observations support that chloride clamping is indeed toxic to

these cells. However, we found that mildly fixing hemocytes using 2.5% paraformaldehyde for 2 min at

room temperature helped preserve cell morphology and as well as retain cell adherence resulting in large

numbers of labelled cells to obtain meaningful statistics. In fact, in the literature, pH clamping studies to

evaluate different kinds of pH probes in Drosophila hemocytes and S2R+ cells incorporates a mild

fixation protocol for precisely the above reasons 10,20

.


27

There is no literature report for the chemical modification of lucigenin (precursor of BAC) or BAC in

presence of paraformalhedyde. In fact, the only functional groups on BAC are the quinolinium nitrogen

and the carboxy moiety, neither of which are reactive to formaldehyde or any of its polymeric forms

under these aqueous reaction conditions. The quantitative overlap between the in vitro and intracellular

calibration profile for Clensor (that normalizes to an independent fluorophore such as Alexa 647)

confirms that fixation protocol does not affect the chloride-sensitive module of Clensor (i.e., BAC).

Similar correspondence between in vitro and intracellular calibration profile was also observed for a

DNA-based pH sensor, in hemocytes where the cells were subjected to a similar fixation protocol prior to

pH clamping 10

.

The Verkmann group has performed chloride clamping without fixation on cell lines such as J774.1

macrophages and CHO cells that much more robust and strongly adherent5,9

. For comparison, we have

now performed chloride clamping on J774 cells with and without fixation (Fig. S9b-d). The negligible

difference in R/G fold change observed in J774 cells with and without fixation prior to clamping indicates

that Clensor’s characteristics or performance is essentially invariant whether one includes a fixation step

or not (Fig. S9d).


28

0 10 20 300

10

20

No

. o

f en

do

so

mes

R/G

60 mM

0

10

20 mM

a

d

b

20 30 40 50 60

1.0

1.2

1.4

[Cl-] (mM)

No

rma

lize

d m

ea

n R

/G In vitro

Intracellular

0

Alexa 647 BAC

202

0 m

M60 m

M

0.0

0.5

1.0

1.5

Intracellular

Fo

ld c

han

ge in

R/G

(20 -

60 m

M C

l- )

In vitro

c

Supplementary Figure S10 | Quantitative performance of ClensorTf

within the endosomes

of S2R+ cells. a, Alexa 647 channel and respective pseudocolour R/G map of S2R+ cells

labelled with ClensorTf

and clamped at 20 mM and 60 mM Clˉ. Scale bar: 10 m. b, Histograms

showing typical spread of R/G ratios of endosomes clamped at 20 mM (green) and 60 mM (red)

Clˉ. (n ≥ 10 cells, ≥ 30 endosomes). c, In vitro and intracellular fold change in R/G ratios of

ClensorTf

at 20 mM and 60 mM Clˉ. d, The normalized R/G intensity (Alexa 647/BAC) ratios

inside the endosomes, plotted as a function of [Clˉ], yield the intracellular calibration profile

(red), which is overlaid on the in vitro chloride calibration profile (black). In vitro and intracellular

R/G values were normalized against 20 mM Clˉ. Error bars indicate the mean of three

independent experiments s.e.m. (n >10 cells, ≥30 endosomes)


29

Intracellular performance of ClensorTf

: To check the intracellular functionality of ClensorTf

, a standard

Clˉ calibration profile was generated by clamping the [Clˉ] of endosomes to that of an externally added

buffer. Representative bitmap images shown in Fig. S10a reveal that at different [Clˉ] distinct R/G map

are observed as expected. Fig. S10b shows a histogram of a population of endosomes clamped at 20 mM

and 60 mM [Clˉ]. Endosomal R/G ratios as a function of [Clˉ] presented a linear profile with the expected

~1.5 fold change in R/G values between 20 mM and 60 mM [Clˉ] (Fig. S10c). The R/G versus [Clˉ]

calibration was used to determine recycling endosomal [Clˉ] under physiological conditions in S2R+

cells. The intracellular standard R/G profile showed excellent correspondence with the in vitro curve,

indicating that post internalization ClensorTf

also recapitulates its sensing properties inside cells

quantitatively.


30

Supplementary Figure S11 | Distribution of R/G

values along the endolysosomal pathway in

living cells. (a – c) Box plots showing the [Clˉ]

distributions for (a) EE, (b) LE and (c) LY in

hemocytes of the indicated genetic background. n ~

15 cells, ~ 75 endosomes/lysosomes. The box

represents 25-75% of the population, the line within

the box represents the median and filled circle

represents the mean of the data obtained for each

indicated genotype. Mann-Whitney U test; * P-value

< 0.05, ** P-value < 0.0001, NS: not significant.

0

5

10

15

NS

**

c RNAi

b mutant

b RNAi

CS

R/G

LY

*

0

5

10

15

c RNAi

b mutant

b RNAi

CS

*

R/G

LE

*NS

0

5

10

15

*

NS

c RNAi

b mutant

b RNAi

CS

R/G

EE

NS

a

b

c


31

Mean [Clˉ] s.e.m. (mM) Mean pH s.e.m.

EE LE LY EE LE LY*

CS 37.0 1.6 60.4 2 108.5 1.4 5.9 0.06 5.2 0.11 5 .012

DmClC-b

RNAi37.8 2 50.1 0.5 70.9 2.8 5.8 0.09 5.4 0.14 5 0.26

DmClC-c

RNAi28.9 0.8 63.6 1.4 113.9 5.3 6.4 0.03 5.5 0.3 5 0.09

Supplementary Table S3 | Summary of mean [Clˉ] and pH in EEs, LEs and LYs in hemocytes

of the indicated genetic background. Values of [Clˉ] corresponding to the observed R/G values

were extracted from the intracellular calibration profile shown in Fig. 3d. pHEE and pHLE

measurements using the dual excitation method were performed using FD10 and compartment

identification was achieved by colocalization with ClensorA647

. Asterisk indicates pHLY

measurements were performed using I4LYA488/A647. n > 20 cells, ~ 100 endosomes. Data indicate

the mean of three independent experiments ± s.e.m.

Endosomes (min)Mean [Cl-] s.e.m (mM)

-NPPB +NPPB

EE (5) 37.0 1.6 9.3 1.5

LE (60) 60.4 2 33.8 2.5

LY (120) 108.5 1.4 86.5 3.5

Supplementary Table S4 | Variation in [Clˉ] in the EEs, LEs and LYs reported by Clensor upon

treatment with NPPB. –NPPB and +NPPB indicate endo-lysosomal [Clˉ] determined from cells

incubated in 1X M1 buffer and 1X M1 buffer containing 400 M NPPB respectively.

[Clˉ] measurement under chemical perturbation: To see if Clensor is capable of detecting changes in

Clˉ accumulation in specific endosomal stages under perturbed conditions, we treated hemocytes with 400


32

DmClC-b (CG8594)

ClC-7

ClC-6

ClC-3

ClC-4

ClC-5

DmClC-c (CG5284)

ClC-1

ClC-2

ClC-Ka

ClC-Kb

DmClC-a (CG6942)

M NPPB (5-nitro-2-(3 to phenylpropylamino)benzoic acid), which is a well-known non-specific Clˉ

channel blocker. It is known that endosomal Clˉ conductance is partially inhibited by NPPB at a high

concentration of 100 M in isolated endosomes 21–23

. It has also been shown 300 M NPPB partially

inhibits endosomal Clˉ accumulation and acidification in intact cells 24

. We labelled hemocytes with 2 μM

Clensor for 5 min at room temperature. Then the cells were chased for 5, 60 and 120 min at 20 °C in 1X

M1 buffer containing 400 M NPPB and [Clˉ] were measured at those chase time points (Table S4). The

table shows that, as expected, endosomal Clˉ accumulation is abrogated in presence of NPPB compared to

untreated cells at each stage of endosomal maturation 9. Endosomal [Clˉ] falls to 9.3 ± 1.5 mM in the EEs,

33.8 ± 2.5 mM in the LEs and 86.5 ± 3.5 mM in the LYs upon NPPB treatment. This data suggests that

Clensor can reliably capture the differences in Clˉ accumulation caused due to chemical perturbation at

every stage of endosomal maturation along the endolysosomal pathway.

Supplementary Figure S12 | Phylogenetic tree comparing the CLC proteins from D.

melanogaster (bold) with mammalian CLC channels (italics).


33

DmClC-b

Tubulin

DmClC-c

Tubulin

DmClC-b

Tubulin

DmClC-c

Tubulin

ba

DmClC channels and transporters: The D. melanogaster genome encodes three CLC family Clˉ

channels and transporters (CG6942, CG8594, and CG5284) that represent all three known branches of the

mammalian CLC gene family 25

. Among them plasma membrane resident DmClC-a is most closely

related to ClC-2 and is fairly well characterized 26

. However, nothing was known about putative

intracellular CLC family proteins, DmClC-b and DmClC-c.

Supplementary Figure S13| Western blot showing depletion of DmClC-b and DmClC-c

proteins by RNAi. a, Immunoblot of total protein isolated from S2R+ cells treated with or

without dsRNA to DmClC-b. Lanes marked as S2R+: total protein from S2R+ cells (100 g

protein/ lane). Lanes marked as DmClC-b RNAi: total protein from S2R+ cells treated with

dsRNA to DmClC-b (100 g protein/ lane). Upper panel: probed with anti-DmClC-b (1:100

dilution), lower panel: probed with anti-CLCN3 (1:500 dilution). b, Immunoblot of total protein

isolated from S2R+ cells treated with or without dsRNA to DmClC-c. Lanes marked as S2R+:

total protein from S2R+ cells (100 g protein/ lane). Lanes marked as DmClC-c RNAi: total

protein from S2R+ cells treated with dsRNA to DmClC-c (100 g protein/ lane). Upper panel:

probed with anti-DmClC-b (1:100 dilution), lower panel: probed with anti-CLCN3 (1:500 dilution).

Tubulin was used as loading control.


34

c

a

b

500 bp

700 bp

1000 bp

M 1 2 3

CS T

DmClC-b

Tubulin

DmClC-c

Tubulin

Lane 1:

Lane 2:

Lane 3:

dy1 w*; P{EP}ClC-bG2453

EE LE LY

Mean [Clˉ] s.e.m. (mM) 37.9 1.4 46.8 3.4 58.6 4.1

Mean pH s.e.m.5.8 0.3 5.4 0.12 5 0.09*

Supplementary Figure S14| Molecular characterization of flies containing the EP-element

insertion in DmClC-b, y1

w*

; P{EP}ClC-bG2453

. a, Schematic showing the primer binding sites

in each PCR reaction shown in Fig. S14b. Green arrows show EP element specific primers. Red

arrows show DmClC-b specific primers. Red box indicates position of the EP element. b, PCR

amplicons of genomic DNA of wild type and transgenic fly for the indicated primer set. The

genomic DNA samples from wild type (lane 1) and the transgenic (y1

w*

; P{EP}ClC-bG2453

) flies

(lane 2 and lane 3). Lane numbers correspond to primer sets shown in Fig. S14a. Lane M: 100

bp DNA ladder. c, Immunoblot of total protein isolated from larvae of wild type and transgenic


35

(y1

w*

; P{EP}ClC-bG2453

) flies. Lanes, CS: total protein from wild type (100 g protein/ lane); T:

total protein from transgenic flies (100 g protein/ lane). Upper panel: probed with anti-DmClC-b

(1:100 dilution), lower panel: probed with anti-CLCN3 (1:500 dilution). d, Summary of mean [Clˉ]

and pH in EEs, LEs and LYs in hemocytes isolated from the transgenic flies. Asterisk indicates

that measurement has been carried out using I4LYA488/A647. Data indicate the mean of three

independent experiments ± s.e.m.

[Clˉ] measurements under genetic perturbation: To complement the studies done in DmClC-b RNAi

depleted system, we chose a transgenic fly line (y1 w

*; P{EP}ClC-b

G2453; Bloomington Drosophila Stock

Center at Indiana University, see Table S6) where the DmClC-b gene is supposed to be disrupted by the

insertion of 7.98 Kb EP element in the second intron of this gene. We first characterized this transgenic

fly line, by confirming the genomic location of this inserted transposon using PCR (see Table S5 for

primer sets) with primers spanning the sequences flanking the insertion (DmClC-b FP and DmClC-b RP,

Table S5) as shown in Fig. S14a. When DNA from wild-type flies was used as a template, a predicted

product of ~0.92 kb was produced (Fig. S14b; lane 1). When genomic DNA from transgeneic flies was

used as template, products of ~ 420 bp and ~ 653 bp with the P element specific primers were observed as

expected (Fig. S14b; lane 2 and 3).

Further, western blot analysis of the total protein isolated from the 3rd

instar larvae of this transgenic line

shows significant reduction of DmClC-b protein levels in these larvae compared to wild type, whereas the

level of DmClC-c remained unaffected in both the cases (Fig. S14c). After confirming the depletion of the

DmClC-b gene in this transgenic line, we carried out Clˉ measurement in hemocytes along the ALBR

pathway using Clensor. For quantifying [Clˉ] the observed R/G values were converted to their

corresponding [Clˉ] values from the intracellular chloride calibration profile shown in Fig. 3d. For pHEE

and pHLE measurements, hemocytes were labelled with a mixture of FD10 (2 mg/mL, 50 μL) and

ClensorA647 (1 μM, 50 μL) for 5 min and imaged at previously indicated chase times. For pHEE and pHLE


36

measurements, Ex480/Ex430 ratios were obtained from only those endosomes that co-localized with

ClensorA647 and converted to their corresponding pH values from the intracellular calibration curve (Fig.

S15a). pHLY was determined using I4LY

A488/A647 (1 μM, 50 μL) (Fig. S15b). Notably, the phenotypes were

even more severe compared to DmClC-b RNAi depleted cells as expected with mean [Clˉ] decreasing to

46.8 ± 3.4 mM in LEs and 58.6 ± 4.1 mM in LYs (Fig. 14d).

5.0 5.5 6.0 6.5 7.01

2

3

4

E

x4

80

/E

x4

30

pH4.5 5.0 5.5 6.0 6.5 7.0

2

4

6

8

10 In vitro

Intracellular

No

rma

lize

d D

/A

pH

a b

Supplementary Figure S15 | a, Intracellular calibration profile of FD10 in hemocytes. Ratios of

the intensity inside endosomes at 530 nm when FITC is excited at 480 nm and 430 nm

(Ex

480/Ex

430) are plotted as a function of pH. b, Intracellular calibration profile of I4LYA488/A647 in

hemocytes. The normalized donor/acceptor (D/A) intensity (Alexa-488/Alexa-647) ratios inside

the endosomes, plotted as a function of pH (red), yield the intracellular calibration profile which

is overlayed on the in vitro pH profile (black).


37

Supplementary Figure S16 | Representative confocal images showing localization of

DmClC-b and DmClC-c by immunofluorescence. a, S2R+ cells transiently expressing GFP-

Rab5 (first column, green), YFP-Rab7 (second column, green), LAMP1-GFP (third column,


38

Name Sequences (5ʹ to 3ʹ) Description

CF1 CGGATCGATATGCTAAGCTGT Forward primer: RT PCR loading control RpL32

CB1 GCGCTTGTTCGATCCGTA Reverse primer: RT PCR loading control RpL32

F1b CGGAACTTTTCGTGACCATC Forward primer: RT PCR DmClC-b gene

B1b TGGACAAATGCCATGCTTTA Reverse primer: RT PCR DmClC-b gene

F1c ATTTCACGTTCACGGGTCTC Forward primer: RT PCR DmClC-c gene

B1c ATGGTCATTCGAAGCACTCC Reverse primer: RT PCR DmClC-c gene

RNAiCR1F TAATACGACTCACTATAGGGCATCTGGTATGTGCTGTG Forward primer: DmClC-c RNAi template round 1

RNAiCR1R TAATACGACTCACTATAGGGACGAAAAAGAGCACGGAATG Reverse primer: DmClC-c RNAi template round 1

RNAiCR2F ATTCGCCCTTTAATACGACTCACTATAGGGCATC Forward primer: DmClC-c RNAi template round 2

RNAiCR2R ATTCGCCCTTTAATACGACTCACTATAGGGACG Reverse primer: DmClC-c RNAi template round 2

RNAiBR1F TAATACGACTCACTATAGGGGAGTTTCAGCTGCTTTTGG Forward primer: DmClC-b RNAi template round 1

RNAiBR1R TAATACGACTCACTATAGGGGCCACGGCATTATATTCGTT Reverse primer: DmClC-b RNAi template round 1

RNAiBR2F ATTCGCCCTTTAATACGACTCACTATAGGGGGA Forward primer: DmClC-b RNAi template round 2

RNAiBR2R ATTCGCCCTTTAATACGACTCACTATAGGGGCC Reverse primer: DmClC-b RNAi template round 2

PE5-1 AATTCGTCCGCACACAAC 5ʹ EP specific

PE3-1 TCGCACTTATTGCAAGCA 3ʹ EP specific

DmClC-b FP-1 CTGCTAATGGGCAACAAT Forward primer: DmClC-b gene

DmClC-b RP-1 ATTGGACCCTCCTTTCCT Reverse primer: DmClC-b gene

Genotype Reference

CS Bloomington Drosophila Stock Center at Indiana University

y1 w*; P{EP}ClC-bG2453 Bloomington Drosophila Stock Center at Indiana University

y1 v1; P{TRiP.JF01844}attP2 Bloomington Drosophila Stock Center at Indiana University

y1 w*; P{EP}ClC-cG4477 Bloomington Drosophila Stock Center at Indiana University

y1 v1; P{TRiP.JF02360}attP2 Bloomington Drosophila Stock Center at Indiana University

w1118; P{Cg-GAL4.A}2 Bloomington Drosophila Stock Center at Indiana University

y1 w*; P{UASp-YFP.Rab5}02 Bloomington Drosophila Stock Center at Indiana University

y1 w*; P{UASp-YFP.Rab7}21/SM5 Bloomington Drosophila Stock Center at Indiana University

W1118; P [w+, uasGFP-

LAMP]2M/Cyo;TM6b, Hu boss /Sb

boss1

A gift from H. Krämer (University of Texas Southwestern

Medical Center, Dallas, TX) J. Cell Sci. 2005, 118, 3663-3673.

green) and YFP-Rab11 (fourth column, green) were fixed and stained with the anti DmClC-b

antibody (red). b, S2R+ cells transiently expressing GFP-Rab 5 (first column, green), YFP-Rab7

(second column, green), LAMP1-GFP (third column, green) and YFP-Rab11 (fourth column,

green) were fixed and stained with the anti CLCN 3 antibody (red). Scale bar: 5 μm

Supplementary Table S5 | PCR primer sequences used in this study

Supplementary Table S6 | Fly stocks used in the study


39

References

1. Sriram, V., Krishnan, K. S. & Mayor, S. deep-orange and carnation define distinct stages in late

endosomal biogenesis in Drosophila melanogaster. J. Cell Biol. 161, 593–607 (2003).

2. Gupta, G. D. et al. Analysis of Endocytic Pathways in Drosophila Cells Reveals a Conserved Role

for GBF1 in Internalization via GEECs. PLoS ONE 4, e6768 (2009).

3. Bhatia, D., Surana, S., Chakraborty, S., Koushika, S. P. & Krishnan, Y. A synthetic icosahedral

DNA-based host–cargo complex for functional in vivo imaging. Nat. Commun. 2, 339 (2011).

4. Sonawane, N. D., Thiagarajah, J. R. & Verkman, A. S. Chloride Concentration in Endosomes

Measured Using a Ratioable Fluorescent Cl− Indicator EVIDENCE FOR CHLORIDE

ACCUMULATION DURING ACIDIFICATION. J. Biol. Chem. 277, 5506–5513 (2002).

5. Geddes, C. D. Optical halide sensing using fluorescence quenching: theory, simulations and

applications-a review. Meas. Sci. Technol. 12, R53 (2001).

6. Biwersi, J., Tulk, B. & Verkman, A. S. Long-wavelength chloride-sensitive fluorescent indicators.

Anal. Biochem. 219, 139–143 (1994).

7. Weinert, S. et al. Lysosomal Pathology and Osteopetrosis upon Loss of H+-Driven Lysosomal Cl-

Accumulation. Science 328, 1401–1403 (2010).

8. Sonawane, N. D. & Verkman, A. S. Determinants of [Cl-] in recycling and late endosomes and Golgi

complex measured using fluorescent ligands. J. Cell Biol. 160, 1129–1138 (2003).

9. Modi, S. et al. A DNA nanomachine that maps spatial and temporal pH changes inside living cells.

Nat. Nanotechnol. 4, 325–330 (2009).

10. Modi, S., Nizak, C., Surana, S., Halder, S. & Krishnan, Y. Two DNA nanomachines map pH changes

along intersecting endocytic pathways inside the same cell. Nat. Nanotechnol. 8, 459–467 (2013).

11. Ratilainen, T., Holmén, A., Tuite, E., Nielsen, P. E. & Nordén, B. Thermodynamics of sequence-

specific binding of PNA to DNA. Biochemistry (Mosc.) 39, 7781–7791 (2000).


40

12. Johnson, I. M., Kumar, S. G. B. & Malathi, R. De-intercalation of Ethidium Bromide and Acridine

Orange by Xanthine Derivatives and Their Modulatory Effect on Anticancer Agents: A study of

DNA-directed Toxicity Enlightened by Time Correlated Single Photon Counting. J. Biomol. Struct.

Dyn. 20, 677–685 (2003).

13. Sauer, M. et al. Dynamics of the electron transfer reaction between an oxazine dye and DNA

oligonucleotides monitored on the single-molecule level. Chem. Phys. Lett. 284, 153–163 (1998).

14. Seidel, C. A. M., Schulz, A. & Sauer, M. H. M. Nucleobase-Specific Quenching of Fluorescent Dyes.

1. Nucleobase One-Electron Redox Potentials and Their Correlation with Static and Dynamic

Quenching Efficiencies. J. Phys. Chem. 100, 5541–5553 (1996).

15. Huotari, J. & Helenius, A. Endosome maturation. EMBO J. 30, 3481–3500 (2011).

16. Chao, A. C., Widdicombe, J. H. & Verkman, A. S. Chloride conductive and cotransport mechanisms

in cultures of canine tracheal epithelial cells measured by an entrapped fluorescent indicator. J.

Membr. Biol. 113, 193–202 (1990).

17. Huang, S. J., Chan, H. C. & Wong, P. Y. Adrenaline-regulated Cl- transport in cultured single rat

epididymal cells measured by an entrapped Cl-(-)sensitive fluorophore. J. Physiol. 474, 183–191

(1994).

18. Nakatsu, Y., Kotake, Y. & Ohta, S. Concentration Dependence of the Mechanisms of Tributyltin-

Induced Apoptosis. Toxicol. Sci. 97, 438–447 (2007).

19. Swetha, M. G. et al. Lysosomal Membrane Protein Composition, Acidic pH and Sterol Content are

Regulated via a Light-Dependent Pathway in Metazoan Cells. Traffic 12, 1037–1055 (2011).

20. Busch, G. L., Lang, H. J. & Lang, F. Studies on the mechanism of swelling-induced lysosomal

alkalinization in vascular smooth muscle cells. Pflüg. Arch. Eur. J. Physiol. 431, 690–696 (1996).

21. Marshansky, V. & Vinay, P. Proton gradient formation in early endosomes from proximal tubules.

Biochim. Biophys. Acta 1284, 171–180 (1996).


41

22. Schmid, A., Burckhardt, G. & Gögelein, H. Single chloride channels in endosomal vesicle

preparations from rat kidney cortex. J. Membr. Biol. 111, 265–275 (1989).

23. Sonawane, N. D. Determinants of [Cl-] in recycling and late endosomes and Golgi complex measured

using fluorescent ligands. J. Cell Biol. 160, 1129–1138 (2003).

24. Dow, J. T. & Davies, S. A. Integrative physiology and functional genomics of epithelial function in a

genetic model organism. Physiol. Rev. 83, 687–729 (2003).

25. Rose, U., Derst, C., Wanischeck, M., Marinc, C. & Walther, C. Properties and possible function of a

hyperpolarisation-activated chloride current in Drosophila. J. Exp. Biol. 210, 2489–2500 (2007).


a ph-independent dna nanodevice for quantifying chloride ... · a ph independent dna nanodevice for...

Documents