A nonsense mutation in agrA accounts for the defect in agr expression and the avirulence of Staphylococcus

aureus 8325-4 traP-

Rajan P. Adhikari1, Staffan Arvidson2, and Richard P. Novick1,3

1Program in Molecular Pathogenesis, Skirball Institute, and Departments of Microbiology and Medicine, New York University Medical Center,

New York, NY, 10016, USA

2Dept. of Microbiology Tumor and Cell Biology Karolinska Institute

S 171 77 Stockholm Sweden

Running title: agrA defect accounts for the traP- phenotype

3Corresponding author

voice: 1-212-263-5290

fax: 1-212-263-5711

email: novick@saturn.med.nyu.edu

ACCEPTED

Copyright © 2007, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.00679-07 IAI Accepts, published online ahead of print on 2 July 2007

on May 30, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

ABSTRACT

TraP is a triply phosphorylated staphylococcal protein that has been hypothesized to be the mediator of a second Staphylococcus aureus quorum-sensing system, “SQS1”, that controls expression of the agr system, and therefore is essential for the organism's virulence. This hypothesis was based on the loss of agr expression and virulence by a traP mutant of strain 8325-4 and was supported by full complementation of both phenotypic defects by the cloned traP gene in strain NB8 (Reference 5), in which the wild-type traP gene was

expressed in trans in the 8325-4 traP mutant. We initiated a study of the mechanism by which TraP activates agr and found that the traP mutant strain used for this and other recently published studies has a second mutation, an adventitious stop codon in the middle of agrA, the agr response regulator. The traP mutation, once separated from the agrA defect by outcrossing, had no effect on agr expression or virulence, indicating that the agrA defect accounts fully for the lack of agr expression and for the loss of virulence ascribed to the traP mutation. In addition, DNA sequencing showed that the agrA gene in strain NB8 (Reference 5), in contrast to that in the agr-defective 8325-4 traP

- strain, had the

wild-type sequence; further, the traP mutation in that strain, when outcrossed, also had no effect on agr expression.

INTRODUCTION

Staphylococcal virulence is largely the province of a large set of extracellular proteins that enable the organism to resist host defenses, attach to the tissue matrix, degrade macromolecules, and lyse cellular elements. This constellation of functions is known as the virulon. The production of staphylococcal virulence factors is coordinately controlled by an intricate regulatory network, involving several two-component signaling modules (TCSs) and a family of homologous winged helix transcription factors (1) (3). Central to this regulatory network is the quorum-sensing agr TCS, which triggers expression of the virulon in response to population density (12). We have recently encountered attenuated clinical strains that possess the wt agr sequence but do not express it (19), suggesting that there may be genes extrinsic to the agr locus that stringently control its expression. As identification and characterization of such genes would be basic to our understanding of virulence regulation in staphylococci, we noted with great interest reports that the staphylococcal gene traP (not to be confused with the Eschericha coli conjugation gene, traP) is absolutely required for agr expression (2) (5). Accordingly, we have initiated studies to determine the role of this gene in agr activation. TraP is a phosphoprotein with three conserved histidine residues, which must all be phosphorylated for the protein to activate agr (5). TraP phosphorylation is induced by RAP, a secreted form of ribosomal protein L2, and is inhibited by RIP, a synthetic heptapeptide, YSPWTNF (2). Rap-Trap is thus considered to represent a second agr activation pathway, denoted “SQS1” (8) superficially similar to the second activating pathway in the competence-regulating system of Bacillus subtilis, which uses the CSF peptide (10).

ACCEPTED

on May 30, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

We were surprised to find, however, that TraP does not, in fact, have any role in agr activation and is not involved in virulence. Therefore, no second agr activation pathway has yet been identified. We find that the derivative of strain 8325-4 containing the traP mutation used in recent studies (5) has an adventitious stop codon in agrA that eliminates agr activation. This mutation is responsible for the failure of the traP mutant to express agr, for its avirulence in the murine abscess model (5), and for the identity of the traP transcriptome with that of agr (7). These findings are entirely consistent with two other reports (Shaw, et al. (15) and Tsang, et al. (20)) demonstrating that traP mutations have no effect on agr expression or virulence.

MATERIALS AND METHODS

Bacterial strains and culture conditions. Bacterial strains are listed in

Table 1. Several different versions of the common laboratory strains COL and 8325-4 have been used; since both of these strains are known to vary in their agr expression, we considered it necessary to identify their sources, which are

indicated in parentheses. Thus, 8325-4(NB) was kindly provided by Naomi Balaban and 8325-4(BW) by Brian Wilkinson. 8325-4(RN) is our lab version of the same strain and COL(BW) is Brian Wilkinson’s version of COL. “-s” after the

parentheses, indicates that a single colony was isolated from the original plate. Drs. Balaban and Wilkinson also have sent us 4 different isolates, each containing a kanamycin resistance (KmR) cassette (kan) inserted in the traP

coding region, inactivating the gene. Although the traP::kan loci of these 4 strains are apparently identical, we have numbered them sequentially, as they were analyzed separately. 8325-4traP-1(BW) and COLtraP-2(BW) were

provided by Dr. Wilkinson, while 8325-4traP-3(NB) and NB8, which is 8325-4traP-4 harboring pYG14, were provided by Dr. Balaban. We have transduced traP::kan from all 4 strains to different recipients. Transductants were named by

adding an indication of the donor traP::kan insertion, t1, t2, t3 or t4, referring to the above 4 traP isolates, respectively, to the recipient strain designation. Thus, 8325-4(RN)t3 is the traP- derivative of 8325-4(RN) in which the traP mutation

was transduced from 8325-4traP-3(NB), a strain provided by Dr. Balaban. These notations are used throughout the text, Tables and Figures.

Bacterial cultures were stored at –80°C, and were grown on GL agar (13)

supplemented with antibiotics as required for plasmid selection (erythromycin, chloramphenicol or tetracycline, all at 10 µg/ml), on commercial sheep blood agar (SBA, from BBL) or in CY broth (13). Culture density was monitored with a

Molecular Devices microtiter plate reader at 650 nM. Blood agar plates were photographed with an !-Innotech imager after 18 hr growth at 37°C. Phage lysates were prepared and used for transduction as previously described (13)

Determination of hemolytic activities and protease production. Qualitative evaluation of !, ", and # hemolysin production was evaluated on SBA as shown in Fig.1. Protease production was evaluated on casein agar as

described by Karlsson et al. (6).

ACCEPTED

on May 30, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

Determination of exoprotein profiles. Cultures were grown for 6 hr in CY broth without glucose; 1.5 ml aliquots were centrifuged to remove bacteria, then

analyzed on SDS-PAGE by the method of Laemmli (9), stained with Coomassie Brilliant Blue and photographed.

Plasmid screening. Whole-cell lysates for plasmid screening were

prepared and analyzed as previously described (13).

Polymerase chain reactions and sequencing of agrA and traP. Polymerase chain reactions (PCR) used the primer pairs listed in Table 2.

Amplification was carried out using the following parameters: 30 s of denaturation at 94°C, followed by 40 cycles at 94°C, 30 s of annealing at 56°C and 2 min of extension at 72°C, and a final extension of 10 min at 72°C. For traP, the same

set of primer pairs were used for both PCR and sequencing. For agrA, primers agrA F and a14R were used to sequence the PCR product amplified by primers agrA F and R. Sequencing was done by dye terminator DNA sequencing

chemistry (Skirball DNA sequencing Core Facility). DNA sequences were analyzed with the DNAStar sequence analysis suite.

RNA preparation and Northern blot hybridization (New York). Cell pellets

were treated with RNA Protect reagent (Qiagen) and mechanically disrupted by agitation with glass beads using the Bio101 FastPrep Apparatus. RNA was purified using the Qiagen RNeasy kit, and its integrity checked by agarose gel

electrophoresis. RNA samples corresponding to equal numbers of cells were separated by gel electrophoresis through 1% denaturing agarose (MOPS/formaldehyde), vacuum-blotted to Hybond N+ membranes (Amersham),

and UV cross-linked. Blots were hybridized overnight to !32P-dATP-labeled, PCR-generated probes. Washed blots were exposed to phosphorimager screens and were read by a Molecular Dynamics Phosphorimager. Primers

(Integrated DNA Technologies, Coralville, IA) used for synthesizing probes are listed in Table 2. Slightly different methods were used in Stockholm, as described by Tegmark, et al. (17).

Analysis of virulence. Ten week old mice of the hairless strain (HRS/J-hr ES10b/+ES10b) (Charles River Laboratories) were injected subcutaneously in the flank area with 109 colony-forming units of the test strain in 100 µl phosphate-

buffered normal saline plus cytodex beads and observed daily for 5 days, at which time they were photographed and euthanized.

RESULTS AND DISCUSSION

Some of the results described here were obtained in New York, others independently in Stockholm, as noted in the figure legends.

Scoring of S. aureus phenotypes. We routinely score hemolytic activities

of S. aureus strains on commercially available SBA plates (16) (18), using #-

hemolysin and/or !-hemolysin activity as surrogates for agr function. It will be

recalled that S. aureus produces at least 4 hemolytic toxins, !, ", #, and $, of

which the first 3 can be scored directly on SBA and the fourth cannot, as it is inhibited by agar. "-hemolysin, which produces a wide turbid zone, is only

ACCEPTED

on May 30, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

weakly regulated by agr whereas !- and #-hemolysins are strongly up-regulated.

Additionally, #-hemolysin has very weak activity on SBA but is strongly

synergistic with "-hemolysin. Accordingly, we cross-streak strains to be tested

against RN4220, which produces only "-hemolysin (17). Since "-hemolysin

partially inhibits !-hemolysin, production of the latter is more easily detected in

%13 lysogens in which the "-hemolysin gene is insertionally inactivated. RN6734

is a %13 lysogen whereas 8325-4 is not. These features of hemolysin scoring are

illustrated diagrammatically in Fig.1. We routinely score protease activity on casein agar plates (6). Protease positive strains produce a white precipitate against a turbid background.

To begin a study of upstream genes required for agr activation, we sought to investigate the mechanism by which traP activates agr, as revealed by hemolytic activity on SBA and protease activity on casein agar. Gov et al. (5) analyzed a traP mutation in which the gene was inactivated by the insertion of a kanamycin resistance (KmR) cassette (5). During the course of these studies, we obtained 3 pairs of strains, each consisting of a parental traP+ strain and a traP- derivative with the KmR cassette inserted in the unique EcoR1 site of the traP gene (5). Dr. Brian Wilkinson provided us with two pairs of strains; 8325-4(BW) and its traP-

derivative, 8325-4traP-1(BW) and COL(BW) and its traP- derivative, COLtraP-2(BW). Dr. Naomi Balaban provided us with parental traP+ strain 8325-4(NB) and its traP- derivative, 8325-4traP-3(NB). All three strain pairs were scored on SBA for !- and #-hemolysins. None of the traP- strains made !- or #-hemolysin suggesting that agr was inactive, as reported (5). The 8325-4traP-3(NB) parent (8325-4(NB) appeared normally hemolytic but the 8325-4traP-1(BW) parent, 8325-4(BW), was only weakly hemolytic, and the COLtraP-2(BW) parent (COL(BW)) totally non-hemolytic (which was not surprising since most available COL derivatives are non-hemolytic (unpublished observations)). The 8325-4traP-3(NB) strain and its parent were also scored on casein agar for protease activity. The mutant was protease negative and the parent positive, consistent with published reports. These observations are summarized in Table 3.

To confirm the role of traP in these strains, we transferred the traP-inactivating KmR cassette from each of the traP::kan derivatives to RN6734, our standard agr+ strain, and were surprised to find that in each case all of 10 transductants had the same fully hemolytic phenotype as the recipient strain (Table 3). Typical results with traP-3 are shown in Fig. 2A, lanes 3 and 4.

Confirmation of genotypes and phenotypes. At this point, it was clearly necessary to confirm the genotypes of these various strains and to test their phenotypes by more definitive means than simply scoring for hemolysis on SBA or proteolysis on casein agar. A PCR performed on each of the traP::kan mutants, the RN6734 transductants, and the corresponding traP+ parental strains, with primers as listed in Table 2, all gave the expected products: a 0.3 Kb product corresponding to traP for the traP+ strains and a 1.8 Kb product

corresponding to the inserted KmR cassette, for the traP- strains. Typical results

are shown in Fig. 2B. The traP locus for representative examples of these various parental and transductant strains was sequenced, confirming either the native traP sequence or the inserted KmR cassette as expected (not shown).

ACCEPTED

on May 30, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

Since the above transductions were to RN6734, we sought to rule out the possibility that strain variation could be responsible for the observed results, by backcrossing the traP-3 mutation to its 8325-4 parent (8325-4(NB)). For this backcross, 8325-4traP-3(NB) and the parental strain 8325-4(NB) were restreaked on SBA from the confluent growth areas of the original agar plates kindly provided by Dr. Balaban. As reported (5), the 8325-4traP-3(NB) strain did not produce !- and #-hemolysins or protease and 8325-4(NB) produced both.

However, as shown in Fig. 2C, the 8325-4(NB) culture was mixed, generating mostly strongly hemolytic colonies (+), some producing "-hemolysin only (n)

(~20%) and probably an intermediate type (i) with reduced hemolytic activity (~5%). Such mixtures are typical of 8325-4 stock cultures, owing to the well-known propensity of agr+ strains to throw agr-defective mutants; indeed, our own 8325-4 stock culture has recently been found to contain such a mixture (18). Nevertheless, we considered it necessary to guard against the possibility that these variants represented contaminants introduced by ourselves. Therefore, to begin work with this strain, three different members of the laboratory independently prepared similar SBA subcultures from the original plate. One of these is illustrated in Fig. 2C, the others were all similar (not shown). We note also that single-colony isolates of all 8325-4 substrains tested, including a strongly hemolytic single colony isolate from the original 8325-4(NB) culture (see Fig. 2C), designated 8325-4(NB)-s, breed true during daily handling but that agr- mutants accumulate during storage (unpublished data). Accordingly, we used 8325-4(NB)-s, which produces all 3 hemolysins, for further study, routinely testing it on SBA before any experiment, and have not worked further with the other variants seen in Fig. 2C.

Transfer of the traP-3 mutation. Transduction of traP-3 to this single-colony hemolytic isolate was performed as above, with selection for KmR. All of the KmR transductants were fully hemolytic and fully proteolytic, indistinguishable from the recipient strain (8325-4(NB)-s) on SBA or on casein agar, ruling out the possibility that the effects of traP are strain-specific. We note that in-frame traP deletions have recently been constructed in several clinical strains as well as in 8325-4(RN) by Tsang, et al. (20), and that none of these had any effect on agr activity. Typical results are shown in Fig. 2A, lanes 5 & 6 and in Fig. 3B. These results suggested strongly that traP does not, in fact control agr-regulated hemolysins or proteases, and led to a series of experiments to test this possibility further. To be absolutely certain that our traP-3 strains had the correct chromosomal configuration, we performed PCRs, as described above for traP-1 and -2, using primers specific for the traP-chromosomal junctions (Table 2). These results, also shown in Figs. 2B and 3A, fully confirmed the expected genotypes. The traP+ strain had the predicted 0.3 Kb product derived from within the traP gene (Fig. 2B, lane 1 and Fig. 3A, lane 5), and all of 3 traP-3 transductants tested had the predicted 1.8 Kb product generated by the insertion of the KmR cassette into traP (Fig. 2B, lane 6; Fig. 3A, lanes 1-3). These findings were also confirmed by sequencing (not shown).

ACCEPTED

on May 30, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

Gene expression analysis. If TraP controls agr activation, since it does not control the production of agr-regulated hemolysins, perhaps it might affect the synthesis of other agr-regulated proteins. If so, one would expect clear differences in exoprotein profiles and in gene expression between traP+ and traP- strains. Accordingly, we determined exoprotein profiles for several of the above strains and performed a Northern blot for RNAIII, the regulatory RNA that is the effector of the agr response (14). In Fig. 4A are shown the exoprotein profiles and in Fig. 4C the RNAIII blot, with PCR confirmation in Fig. 4B, as above. Again, with one exception, both the exoprotein profiles and the RNAIII blot are consistent with full agr expression in the absence as well as in the presence of an intact traP gene. Further confirmation was obtained in an experiment in which culture samples taken at 4 and 6 hr time points were also Northern blotted with an RNAIII probe (Fig. 4C, Lanes 7-10). The exception was the non-hemolytic traP strain (8325-4traP-3(NB)) provided by Dr. Balaban (lane 2), which had an exoprotein profile typical of agr-null strains (14) and did not produce detectable RNAIII. The apparent lack of any effect of traP-3 in the other strains tested, raises the question of the basis of the profound deficiency in hemolytic activity and exoprotein production seen with this strain.

The simplest explanation would be that there is an adventitious agr mutation in the traP-3 derivative of 8325-4. Since such mutations are common and often affect agrA, we introduced pRN6662, an agrA-expressing plasmid that we have previously used to complement agrA mutations (14), by transduction to the non-hemolytic traP-3 derivative of 8325-4, 8325-4traP-3(NB), selecting for the chloramphenicol resistance (CmR) marker of the plasmid. All of the transductants contained the agrA-expressing plasmid and were fully hemolytic, despite the continued presence of the traP-3 mutation, suggesting that a mutation in agrA was responsible for the agr-defective phenotype of this strain, rather than the traP-3 mutation. Hemolytic patterns and confirmation of these genotypes by PCR and Northern blotting are shown in Fig. 5. To confirm the presence of an agrA mutation, we sequenced agrA from chromosomal DNA prepared directly from the non-hemolytic 8325-4traP-3(NB) bacteria on the agar plate provided by Dr. Balaban and found a stop codon at amino acid position 124 (Fig. 6). This has been confirmed with several other strains derived from this one. These results provide unequivocal evidence that traP has no detectable role in agr regulation and, with one exception, the recently reported results for traP (5) (7) can all be accounted for by an adventitious mutation in agrA. The exception is the hemolytic strain NB8, kindly provided by Dr. Balaban, described as a traP derivative of 8325-4(NB) containing pYG14, a traP–expressing plasmid. This plasmid was reported to complement the non-hemolytic and avirulent phenotype of the 8325-4traP-3(NB) strain (5).

Complementation. How may we account for the hemolytic activity and virulence of strain NB8? Although we could detect no phenotype for the traP knockout, it was possible that the presence of traP on a high copy plasmid might be responsible. We began by confirming the presence of both the traP mutation and the traP-expressing plasmid, pYG14 in NB8. As shown in Fig. 5B (lane 5) PCR products corresponding to both the intact and insertionally inactivated traP

ACCEPTED

on May 30, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

were present and the expected plasmid was readily detectable in screening gels (not shown).. Moreover, a KmR transductant of 8325-4(RN) with NB8 as donor showed the traP-specific 1.8 kb PCR product. But like all other transductants, this transductant 8325-4(RN)t4 was fully hemolytic and produced normal amounts of

RNAIII Fig. 5C (lane 6). We next determined the sequence of agrA in NB8, in comparison to that in the non-hemolytic 8325-4traP-3(NB) strain, and found, again to our surprise, that the NB8 agrA sequence was the same as that previously determined for wild type agrA (GenBank SAOUHSC_02265); i.e., it did not contain the above-mentioned stop codon present in the non-hemolytic traP strain 8325-4traP-3(NB) (Fig. 6). Additionally, we transduced the traP-containing plasmid from the hemolytic traP strain, NB8, to the non-hemolytic traP derivative of 8325-4, 8325-4traP-3(NB), selecting for the erythromycin-resistance (EmR) marker of the plasmid. All of 10 EmR transductants tested were non-hemolytic and contained the plasmid (not shown). They were phenotypically indistinguishable from the recipient strain, indicating that the cloned traP does not restore hemolysin production to this strain. PCR analysis confirmed that both intact and inactivated traP genes were present in the plasmid-containing strains (Fig. 5B, lane 3). Finally, we also transduced the traP-4 mutation from NB8, to the agr+ 8325-4(NB)-s and, again, all of 10 KmR transductants were fully hemolytic and indistinguishable from the recipient strain. As noted above, in-frame traP deletion mutations also had no detectable effect on agr expression (20), ruling out the possibility that a polar effect of the inserted kan cassette may have been responsible for the traP mutant phenotype. The reported complementation, therefore, is explainable by the lack of any agr defect in strain NB8.

Virulence. The above results suggest that all of the in vitro properties of the traP mutations containing the kanamycin resistance cassette are attributable to the agrA mutation, and predict that this mutation also accounts for the reported avirulence of the 8325-4traP-3(NB) strain. This prediction was tested with 10-week-old hairless immunocompetent mice. We used 6 strains: RN6734, RN6734t3 (our traP-3 derivative), RN7206 (an agr-null derivative of RN6734)

and RN7206t3 (a double traP-3 agr-null derivative of RN6734) plus the hemolytic

8325-4(NB)-s, and 8325-4(NB)-s-t3 (our traP-3 transductant of this strain). Mice

were injected subcutaneously with 109 cfu plus cytodex beads in a total vol of 100 µl of normal saline and the resulting lesions were measured after 5 days.

Several of the mice died in this experiment, because the dose of bacteria that we used, in conformity with the dose used by Gov, et al. (5), was considerably higher than the 3x108 that we normally use in this model. In this test, both of the agr+

traP-3 strains tested were highly virulent. Although, as listed in Table 4, the

lesions may have been slightly smaller than those with the traP+, there was considerable variation and the differences are clearly not significant. Typical lesions are shown in Fig.7. Neither the agr- nor the agr--traP-3 double mutant caused any measurable lesion at this dosage.

Conclusion. A possible explanation for the presence of an adventitious agrA mutation in the traP strain 8325-4traP-3(NB) is that a transductant with this

ACCEPTED

on May 30, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

mutation was chosen accidentally when traP was initially transferred to 8325-4(NB), which we have observed to contain non-hemolytic variants (Fig. 2C). This same traP, agrA-defective strain was apparently used for the testing of the plasmid-carried phosphorylation-defective traP mutants (5), as well as for the reported transcriptional profiling (7), so that these results would also be due to the agrA mutation.

However, given the results presented above, we are unable to envision any explanation either for the wild type agrA sequence in strain NB8 or for the retention of hemolytic activity and virulence by the same host strain with a traP plasmid containing a mutation in a non-phosphorylatable histidine (see Gov, et al., (5), Figs. 6 & 7).

The results reported here unfortunately call into question the initial report (2), in which the properties of traP were described. In that report, a traP-inactivating mutation was constructed and tested in the !- and #-hemolysin–negative strain

RN4220, in which we have recently demonstrated a partially inactivating mutation in agrA (18). The reported effects of traP on RNAIII synthesis may also have resulted from an additional and adventitious agr-defective mutation, which would not have been noticed since RN4220 produces neither !- nor #-hemolysin, owing

to its agrA defect. Although it was reported that the primary traP mutation was outcrossed to 8325-4, and its properties were conserved (2), no data were presented. Unfortunately, neither OU20, the traP mutant derivative of RN4220 used in that study, nor the traP 8325-4 transductant are presently available.

ACKNOWLEDGMENTS

This work was supported by NIH research grant R01-AI30138 to RPN. We thank Brian Wilkinson and Naomi Balaban for providing many of the strains used in the study.

REFERENCES 1. Arvidson, S., and K. Tegmark. 2001. Regulation of virulence

determinants in Staphylococcus aureus. Int J Med Microbiol 291:159-70. 2. Balaban, N., T. Goldkorn, Y. Gov, M. Hirshberg, N. Koyfman, H. R.

Matthews, R. T. Nhan, B. Singh, and O. Uziel. 2001. Regulation of Staphylococcus aureus pathogenesis via target of RNAIII-activating Protein (TRAP). J Biol Chem 276:2658-67.

3. Cheung, A. L., and G. Zhang. 2002. Global Regulation of Virulence Determinants in Staphylococcus Aureus by the SarA Protein Family. Front. Biosci., vol. 7.p. d1825-42,

4. Gill, S. R., D. E. Fouts, G. L. Archer, E. F. Mongodin, R. T. Deboy, J. Ravel, I. T. Paulsen, J. F. Kolonay, L. Brinkac, M. Beanan, R. J. Dodson, S. C. Daugherty, R. Madupu, S. V. Angiuoli, A. S. Durkin, D. H. Haft, J. Vamathevan, H. Khouri, T. Utterback, C. Lee, G. Dimitrov, L. Jiang, H. Qin, J. Weidman, K. Tran, K. Kang, I. R. Hance, K. E. Nelson, and C. M. Fraser. 2005. Insights on evolution of virulence and resistance from the complete genome analysis of an early methicillin-

ACCEPTED

on May 30, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

resistant Staphylococcus aureus strain and a biofilm-producing methicillin-resistant Staphylococcus epidermidis strain. J Bacteriol 187:2426-38.

5. Gov, Y., I. Borovok, M. Korem, V. K. Singh, R. K. Jayaswal, B. J. Wilkinson, S. M. Rich, and N. Balaban. 2004. Quorum sensing in Staphylococci is regulated via phosphorylation of three conserved histidine residues. J Biol Chem 279:14665-72.

6. Karlsson, A., P. Saravia-Otten, K. Tegmark, E. Morfeldt, and S. Arvidson. 2001. Decreased amounts of cell wall-associated protein A and fibronectin-binding proteins in Staphylococcus aureus sarA mutants due to up- regulation of extracellular proteases. Infect Immun 69:4742-8.

7. Korem, M., Y. Gov, M. D. Kiran, and N. Balaban. 2005. Transcriptional profiling of target of RNAIII-activating protein, a master regulator of staphylococcal virulence. Infect Immun 73:6220-8.

8. Korem, M., A. S. Sheoran, Y. Gov, S. Tzipori, I. Borovok, and N. Balaban. 2003. Characterization of RAP, a quorum sensing activator of Staphylococcus aureus. FEMS Microbiol Lett 223:167-75.

9. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriaphage T4. Nature 227:680-685.

10. Lazazzera, B. A., J. M. Solomon, and A. D. Grossman. 1997. An exported peptide functions intracellularly to contribute to cell density signaling in B. subtilis. Cell 89:917-25.

11. Novick, R. P. 1967. Properties of a cryptic high-frequency transducing phage in Staphylococcus aureus. Virology 33:155-166.

12. Novick, R. P., S. J. Projan, J. Kornblum, H. F. Ross, G. Ji, B. Kreiswirth, F. Vandenesch, and S. Moghazeh. 1995. The agr P2 operon: an autocatalytic sensory transduction system in Staphylococcus aureus. Mol Gen Genet 248:446-58.

13. Novick, R. P. 1991. Genetic systems in staphylococci, p. 587-636. In J. Miller (ed.), Methods in Enzymology (Bacterial Genetics), vol. 204. Academic Press (In press), Orlando, Florida.

14. Novick, R. P., H. F. Ross, S. J. Projan, J. Kornblum, B. Kreiswirth, and S. Moghazeh. 1993. Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule. EMBO J. 12:3967-3975.

15. Shaw, L. N., I. M. Jonnson, V. K. Singh, A. Tarkowski, and G. C. Stewart. 2007. Inactivation of traP has no effect on the Agr quorum sensing system or virulence of Staphylococcus aureus. Infect Immun (Epub June 4).

16. Subedi, A., C. Ubeda, J. R. Penades, and R. P. Novick. 2007. Sequence analysis reveals genetic rearrangements and intraspecific spread of SaPI2, a pathogenicity island involved in menstrual toxic shock. Microbiology (In Press).

17. Tegmark, K., A. Karlsson, and S. Arvidson. 2000. Identification and characterization of SarH1, a new global regulator of virulence gene expression in Staphylococcus aureus. Mol Microbiol 37:398-409.

18. Traber, K., and R. Novick. 2006. A slipped-mispairing mutation in AgrA of laboratory strains and clinical isolates results in delayed activation of agr and failure to translate delta- and alpha-haemolysins. Mol Microbiol 59:1519-30.

19. Traber, K. T., and R. P. Novick. 2007. Agr functionality in clinical Staphylococcus aureus isolates. Microbiology (In Press).

20. Tsang, L. H., S. T. Daily, E. C. Weiss, and M. S. Smeltzer. 2007. Mutation of traP in Staphylococcus aureus has no impact on expression of agr or biofilm formation. Infect Immun (Epub June 4).

ACCEPTED

on May 30, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

Table 1. Bacterial strains and plasmids

Strain Description Source or

Reference

COL Genome-sequenced MRSA (4)

COL(BW) COL B. Wilkinson

COLtraP-2(BW) COL with kanamycin resistance cassette in traP (traP-2) B. Wilkinson

8325-4 NCTC8325 cured of 3 prophages (11)

8325-4(RN) 8325-4 R. Novick

8325-4(BW) 8325-4 B. Wilkinson

8325-4(NB) 8325-4 N. Balaban

8325-4traP-1(BW)

8325-4 with kanamycin resistance cassette in traP (traP-1(BW))

B. Wilkinson

8325-4traP-3(NB) 8325-4 with kanamycin resistance cassette in traP (traP-3) (5)

N. Balaban

NB8 8325-4 with kanamycin resistance cassette in traP (traP-4)

and plasmid pYG14

(5)

N. Balaban

8325-4(NB)-s-t3 8325-4(NB)-s with traP-3 (80! transductant from 8325-

4traP-3(NB))

This work

8325-4(NB)-s-t4 8325-4(NB)-s with traP-4 (80! transductant from NB8) This work

8325-4(RN)t2 8325-4(RN) with traP-2 (80! transductant from COLtraP-

2(BW))

This work

8325-4(RN)t1 8325-4(RN) with traP-1(80! transductant from 8325-4traP-1(BW))

This work

8325-4(RN)t3 8325-4(RN) with traP-3 (80! transductant from 8325-4traP-3(NB))

This work

8325-4(RN)t4 8325-4(RN) with traP-4 (80! transductant from NB8) This work

RN6734 8325-4 (%13 Tn554-ermA1) (14)

ACCEPTED

on May 30, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

R. Novick

RN6734t2 RN6734 with traP-2 (80! transductant from COLtraP-

2(BW)))

This work

RN6734t1 RN6734 with traP-1 (80! transductant from 8325-4traP-1(BW))

This work

RN6734t3 RN6734 with traP-3 (80! transductant from 8325-4traP-3(NB))

This work

RN6734t4 RN6734 with traP-4 (80! transductant from NB8) This work

RN7206 RN6734-!agr::tetM (14) R. Novick

RN7206t3 RN7206 with traP-3 (80! transductant from 8325-4traP-3(NB))

This work

RN6911 RN6390-!agr::tetM (14)

pRN6662 pSK267 with cloned agrA (12)

pYG14 pAUL-A::traP (5)

Table 2. List of primers.

a. Northern blot probes

Primer Sequence (5'-3')

16S F

16S R

ggtgagtaacacgtggataa

atgtcaagatttggtaaggtt

RNAIII F

RNAIII R

ctgagtcctaggaaactaactc

atgatcacagagatgtga

b. PCR and sequencing primers

Primer Sequence (5'-3')

agrA F

agrA R

a14 R

attaacaactagccataagg

tgatcctaatgtaagattgc

gttcgaattcacgcgtcatatttaa

traP F

traP R

caataacccgacccatcaac

gtcttcgtatgcatgtcg

ACCEPTED

on May 30, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

Table 3. Phenotypes of donor and transductant strains.

Strain Hemolysins Protease

! # "

COL(BW)* - - +

COLtraP-2(BW) - - +

8325-4(BW)* ± ± +

8325-4traP-1(BW) - - +

8325-4(NB)* ± ± +

+

8325-4traP-3(NB) - - +

-

8325-4(NB)-s +

+

+

8325-4(NB)-s-t3** +

+

+

8325-4(RN)* +

+

+

+

8325-4(RN)t1** +

+

+

8325-4(RN)t2** +

+

+

8325-4(RN)t3** +

+

+

+

8325-4(RN)t4** +

+

+

RN6734(RN)* +

+

-

RN6734(RN)t1** +

+

-

RN6734(RN)t2** +

+

-

RN6734(RN)t3** +

+

-

*parental strain; **All of 10 KmR transductants

Table 4. Effect of traP-3 on abscess formation.

Strain RNAIII Hemolytic activity*

# of surviving mice/total

Size of lesions, cm2, mean±SD,

Mouse # (Fig. 7)

8325-4(RN) + + 5/5 1.8±1.2 1

8325-4(RN)t3 + + 4/5 1.6±1.4 2

RN6734 + + 3/5 2.7±0.4 3

RN6734t3 + + 2/5 2.1±0.03 4

RN7206 - - 5/5 <0.1 5

RN7206t3 - - 5/5 <0.1 6

*Production of !& and #&hemolysins (see Figs. 1 & 2.).

FIGURE LEGENDS

Fig. 1. Schematic illustration of hemolytic activities on SBA. Bacteria to be tested (horizontal black bars) are streaked at a right angle to RN4220 (vertical

ACCEPTED

on May 30, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

black bar) and the plate incubated overnight. "-hemolysin forms a turbid zone of

hemolysis surrounding the vertical streak of RN4220. #-hemolysin and "-

hemolysin are synergistic, producing a zone of clear hemolysis where they intersect. Three such zones are shown, as indicated. At upper right is a strain producing only #-hemolysin. Below that is a strain producing all 3 hemolysins.

The !-hemolysin zone is more turbid than seen with !-hemolysin alone because

of inhibition by "-hemolysin. In this case, #-hemolysin produces a narrow clear

zone surrounding the streak owing to its interaction with "-hemolysin. At upper

left is a non-hemolytic strain; next is a strain producing !-hemolysin and #-

hemolysin. The V-shaped zone is characteristic of the intersection of !-

hemolysin and "-hemolysin zones, as !-hemolysin and "-hemolysins are

mutually inhibitory. Within the region of intersection, "-hemolysin and #-

hemolysin interact to give a region of greater clearing than that seen with !-

hemolysin alone. At lower left is a strain producing only "-hemolysin;

Fig. 2. Effects of traP-3 on hemolytic activity of S. aureus (New York). A. Hemolytic patterns on SBA with RN4220 (black streak at top). B. PCR products obtained with primers that would amplify either traP (0.3 Kb band) or traP with the KmR insert (1.8 Kb band). Lane 1, 8325-4(NB) from N. Balaban; 2, 8325-4traP-3(NB) also from N. Balaban (note the faint turbid "-hemolysin zone

surrounding this streak); 3, RN6734 (standard agr+, traP+ %13 lysogen); 4,

RN6734t3 (KmR-traP-3 transductant of RN6734); 5, 8325-4(RN); 6, 8325-4(RN)t3 (KmR-traP-3 transductant of 8325-4(RN)). C. Single colony hemolytic patterns on SBA. 8325-4(NB), culture provided by N. Balaban, containing at least 3 types of colonies: “+” showing zones for "-hemolysin and #-hemolysin one

of these was isolated and used in further studies, and was designated 8325-4(NB)-s (!-hemolysin is produced but is difficult to identify in such single

colonies); “n”, producing only "-hemolysin; “i", posible intermediate type.

Fig. 3. Effect of traP-3 on protease production by S. aureus (Stockholm). A. PCR analysis of traP with (lanes 1-4) and without (lane 5) the kan insertion. In lane 4 is 8325-4traP-3(NB) (Dr. Balaban's traP mutant), lanes 1-

3 represent KmR transductants of 8325-4(RN) with 8325-4traP-3(NB) as donor. M is a size marker and C is a negative control without bacterial DNA. B. Protease indicator plate (casein agar) with stabs of the strains shown in panel A.

RN6911 is an agr-null strain; note that strain 4, 8325-4traP-3(NB) (Dr. Balaban's traP-3 mutant), like RN6911, shows no protease activity, whereas the transductants, 1-3, are fully active as is the 8325-4(RN) recipient, strain 5.

Fig. 4. Effect of traP-3 on exoprotein profiles and agr-RNAIII production. A. 6-hr culture supernatants were analyzed on SDS-PAGE by the method of Laemmli (9), stained with Coomassie Brilliant Blue, and photographed. B. PCR analysis of chromosomal DNA as in Fig. 3. Lane 1, 8325-4(NB); 2, 8325-4traP-3(NB); 3, 8325-4(RN); 4, 8325-4(RN)t3 (KmR transductant of 8325-4(RN); 5, RN6734; 6, RN6734t3 (KmR transductant of RN6734). C. Northern blot

ACCEPTED

on May 30, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

hybridization analysis of RNAIII. Lanes 7 & 8 represent 4 hr culture samples; lanes 9 & 10, 6 hr samples. Samples in lanes 7 & 9 are from an 8325-4(RN) culture; 8 &10 from an 8325-4(RN)t3 culture. Results shown in lanes 1-6 are from experiments performed in New York; 7-10, in Stockholm.

Fig. 5. Complementation of 8325-4traP-3(NB) by cloned agrA, but not by cloned traP. A. Hemolytic patterns and B. PCR analysis as in Fig. 2. C. Northern blot hybridization patterns using 16S RNA and agr-RNAIII probes as indicated. The same 6h culture samples used for PCR were also used for whole-cell RNA extraction. RNA samples were separated on agarose and Northern blotted with 32P-labeled oligonucleotides specific for 16S RNA and agr-RNAIII, respectively. Blots were developed with a phosphorimager. Lane 1, 8325-4traP-3(NB); 2, 8325-4traP-3(NB) containing cloned agrA; 3, 8325-4traP-3(NB) containing cloned traP; 4. 8325-4(RN); 5, NB8; 6, 8325-4(RN)t4 (KmR transductant of 8325-4(RN) with NB8 as donor).

Fig. 6. Sequencing of agrA. The electropherogram of the sequencing reaction for agrA in strain 8325-4traP-3(NB) is shown at bottom with the deduced nucleotide and amino acid sequences below. At top is the agrA sequence for strain NB8, in comparison to the 8325-4(RN) agrA sequence from GenBank.

Fig. 7. Effects of traP on mouse virulence in the subcutaneous abscess model. See text for details. Odd-numbered mice were infected with traP+ bacteria, even with traP-3. 1 & 2, 8325-4(NB)-s; 3 & 4, RN6734; 5 & 6, RN7206.

ACCEPTED

on May 30, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

!-hemolysin

+!-hemolysins

"-hemolysin

-hemolysin

!-hemolysin

Fig. 1

ACCEPTED on M

ay 30, 2018 by guesthttp://iai.asm

.org/D

ownloaded from

M 1 2 3 4 5 61.8 Kb

0.3 Kb

A

B

nn

+

i

C

Fig. 2

ACCEPTED on M

ay 30, 2018 by guesthttp://iai.asm

.org/D

ownloaded from

1 2 3 4 5 M C

1.8 Kb

0.3 Kb

RN6911

A

B

Fig. 3

ACCEPTED on M

ay 30, 2018 by guesthttp://iai.asm

.org/D

ownloaded from

M 1 2 3 4 M 5 6

A

B 1.8 Kb

0.3 Kb

C 16S

RNAIII

Fig. 4

7 8 9 10

ACCEPTED on M

ay 30, 2018 by guesthttp://iai.asm

.org/D

ownloaded from

2

4

16S

RNAIII

1.8 Kb

0.3 Kb

1

3

A

B

C

1 2 3 4 5 6

Fig. 5

ACCEPTED on M

ay 30, 2018 by guesthttp://iai.asm

.org/D

ownloaded from

GAATTAAGAACTCGAATTATAGACTGTTTAGAAACTGCACATACACGCTTACAA

E L R T R I I D C L E T A H T R L Q

E L R T R I I D C * E T A H T R L Q

NB8

8325-4

traP-3

Fig. 6

ACCEPTED on M

ay 30, 2018 by guesthttp://iai.asm

.org/D

ownloaded from

1 2 3 4 5 6

Fig. 7

ACCEPTED on M

ay 30, 2018 by guesthttp://iai.asm

.org/D

ownloaded from