a mir-29b byproduct sequence exhibits potent tumor … · 29b-1-5p, but not mir-29b-1-5p, possessed...

Small Molecule Therapeutics

A miR-29b Byproduct Sequence Exhibits PotentTumor-Suppressive Activities via Inhibitionof NF-kB Signaling in KRAS-Mutant ColonCancer CellsAkira Inoue1, Tsunekazu Mizushima1, Xin Wu2, Daisuke Okuzaki3, Nanami Kambara2,Sho Ishikawa2, Jiaqi Wang2, Yamin Qian2, Haruka Hirose2, Yuhki Yokoyama2,Ryo Ikeshima1, Masayuki Hiraki1, Norikatsu Miyoshi1, Hidekazu Takahashi1,Naotsugu Haraguchi1, Taishi Hata1, Chu Matsuda1, Yuichiro Doki1, Masaki Mori1, andHirofumi Yamamoto1,2

Abstract

We previously demonstrated that miR-29b-3p is a hopefulmiRNA-based therapy against colorectal cancer. In this study, weaimed to clarify a value of miR-29b-1-5p as a next-generationtreatment, especially for KRAS-mutant colorectal cancer. RT-PCRassay showed that the expression ofmiR-29b-3p was high, and itspartner strand, miR-29b-1-5p, level was only negligible in clinicalcolorectal cancer samples. Mimic-miR-29b-1-5p significantlyinhibited proliferation ofKRAS-mutant colorectal cancer cell linesDLD1 and SW480 and KRAS wild-type HT29 cells. Proliferativeactivity was further examined by eithermiR-29b-1-5p strand or itsopposite complementary sequence because miR-29b-1-5p is apassenger miRNA and may have no physiologic function. Wefound that completely opposite complementary strand to miR-29b-1-5p, but not miR-29b-1-5p, possessed a potent antitumor

effect and named this byproduct miRNA sequence "MIRTX."MIRTX directly targeted the 30-UTR of CXCR2 and PIK3R1mRNAand suppressed the NF-kB signaling pathway in KRAS-mutatedcolorectal cancer cells. MIRTX induced apoptosis in DLD1 withdownregulation of antiapoptotic BCL2, BCL-xL, and MCL1 andupregulation of cleaved caspase-3 and cleaved PARP. In mousexenograft models, systemic administration of MIRTX using asuper carbonate apatite as a delivery vehicle significantly inhibitedtumor growth of DLD1 and HT29 cells without any particulartoxicities. In conclusion, these findings indicate that inhibitionof NF-kB signaling by this novel miRNA-based therapeuticcould be a promising treatment against refractory KRAS-mutant colorectal cancer and KRASwild-type colorectal cancer.Mol Cancer Ther; 17(5); 977–87. �2018 AACR.

IntroductionColorectal cancer is the third leading cause of cancer-related

death in the United States, with an estimated 134,490 new casesand 49,190 deaths in 2016 (1). Although progress has beenmadeby improving treatment approaches, including surgery, chemo-therapy, and irradiation, patientswithmetastatic colorectal cancer(mCRC) still have a very poor prognosis (2). Therefore, a betterunderstanding of the molecular mechanisms of colorectal cancer

and new therapeutic strategies are urgently needed to improve theprognosis of this disease.

Recent advances in our understanding of the specific signalingpathways in cancer cells have offered novel targeted therapies forpatients with colorectal cancer. Indeed, previous studies havedemonstrated that EGFR mAbs significantly improve the prog-nosis of patients with wild-type KRASmetastatic colorectal cancer(3–5). However, 40% of colorectal cancers harbor KRAS muta-tions (6), and treating these patients with mutant KRAS mCRCremains one of the biggest challenges in oncology. One possibleway to overcome this issue is to develop molecular targeted drugsthat could inhibit KRAS downstream effectors, such as MEK1/2.For example, the MEK1/2 inhibitors PD-0325901, BAY 86-9766,and AS703026 have been evaluated in clinical trials (7, 8), butthe trials were discontinued, or an effective dose could not beachieved because of drug toxicity.

Recent evidence indicates that the NF-kB transcription factor isconstitutively activated in KRAS-mutant colorectal cancer (9, 10).Therefore, targeting NF-kB signaling pathway represents a prom-ising strategy against KRAS-mutant colorectal cancer, althoughthis has not been successful so far in colorectal cancer. The NF-kBsignaling pathway is involved in tumor development, such astumor cell growth, antiapoptosis, metastasis, angiogenesis, andresistance against chemotherapeutics (9, 11). Moreover, NF-kB

1Department of Surgery, Gastroenterological Surgery, Graduate School ofMedicine, Osaka University, Osaka, Japan. 2Department of Molecular Pathology,Division of Health Sciences, Graduate School of Medicine, Osaka University,Osaka, Japan. 3Genome Information Research Center, Research Institute forMicrobial Diseases, Osaka University, Osaka, Japan.

Note: Supplementary data for this article are available at Molecular CancerTherapeutics Online (http://mct.aacrjournals.org/).

Corresponding Author: Hirofumi Yamamoto, Department of Molecular Pathol-ogy, Division of Health Sciences, Graduate School of Medicine, Osaka University,Yamadaoka 1-7, Suita City, Osaka 565-0871, Japan. Phone/Fax: 816-6879-2591;E-mail: [email protected]

doi: 10.1158/1535-7163.MCT-17-0850

�2018 American Association for Cancer Research.

MolecularCancerTherapeutics

www.aacrjournals.org 977

on September 22, 2020. © 2018 American Association for Cancer Research. mct.aacrjournals.org Downloaded from

Published OnlineFirst March 15, 2018; DOI: 10.1158/1535-7163.MCT-17-0850

http://crossmark.crossref.org/dialog/?doi=10.1158/1535-7163.MCT-17-0850&domain=pdf&date_stamp=2018-4-10

http://mct.aacrjournals.org/

seems to play a crucial role in inflammation and oncogenesisthrough regulating multiple molecules (9). Several molecules areinvolved in NF-kB signaling pathway. It is reported that PIK3R1,the major downstream signaling molecule of AKT, is an intrinsicactivator ofNF-kB (12, 13) and that expression levels of IL8 and itsreceptor CXCR2 are associated with tumor proliferation andprogression through a signaling network involving NF-kB,besides PI3K/AKT and MAPK (14–17).

Nucleic acid (NA)–based medicine, which includes antisense-,siRNA-, and miRNA-based therapies, shows potential as a next-generation treatment. miRNAs are single-stranded, noncodingRNAs of 20–22 nucleotides, being involved in various biologicalprocesses and act to posttranscriptionally or transcriptionallyregulate the expression of multiple target genes by binding tocomplementary sequences, mainly in the 30-untranslated regions(30-UTR; ref. 18).

In the miR-29 family, we and other investigators have shownthat miR-29b-3p is a tumor suppressor and a prognostic factor invarious human malignancies, including colorectal cancer, lungcancer, lymphoma, leukemia, and other types of human malig-nancies, as it regulates cell proliferation, differentiation, apoptosis,migration, and invasion (19–22). These findings suggest thatmiR-29b-3p is a promising next-generation treatment forcancers. On the other hand, miR-29b-1-5p, the partner strand ofmiR-29b-3p in the primarymiRNA duplex was formerly known asmiR-29b-1�, and it is believed to be preferentially degraded (23,24); however, it was recently recognized that miRNA� species mayalso access Argonaute (Ago) complexes and regulate targets incertain conditions (25, 26). Indeed, it is recently reported thatmiR-29b-1-5p exerts a function to suppress the aggressive triple-negative breast cancer cells and bladder cancer cell line (27, 28).

In this study, we examined miR-29b-1-5p expression in com-parison with that of miR-29b-3p in colorectal cancer tissues. Wealso investigated the antitumor effect in vitro by the nucleic acidmimics for miR-29b-1-5p, especially in KRAS-mutant colon can-cer cells. As a result, we found thatmiR-29b-1-5p sequence hadnotumor-inhibitory effects, whereas its byproduct, a complementarynucleic acid sequence, exhibited a potent tumor-inhibitory activ-ity in vitro and in xenograft mouse models with no drug toxicity.This artificial miRNA sequence may be a hopeful treatment to thepatients with KRAS-mutant refractory colorectal cancer.

Materials and MethodsCell lines and cell culture

Human colorectal cancer cell lines HT29 and DLD1 wereobtained from the ATCC in 2001. SW480 was obtained fromATCC in 2010. Stocks were prepared after passage 2 and stored inliquid nitrogen. All experiments were performed with cells ofpassage of <8. These cell lines were authenticated bymorphologicinspection, short tandem repeat profiling, and mycoplasma test-ing. Mycoplasma testing was also performed by the authors in2015. Cells were cultured in DMEM containing 10% FBS at 37�Cin a humidified incubator with 5% CO2.

Clinical tissue samplesColorectal cancer samples were collected from 40 patients who

had surgery at Osaka University Hospital (Osaka, Japan) andrelated hospital between 2012 and 2013. These patients included3 stage I, 15 stage II, 11 stage III, and 11 stage IV patients accordingto the AJCC TNM classification (7th edition; ref. 29). The tumor

samples were stored at �80�C in RNAlater until RNA extraction.Written informed consent was obtained from all patients, inaccordance with the guidelines approved by the InstitutionalResearch Board. This study was conducted under the supervisionof the Ethics Board of Osaka University Hospital.

Transient transfection of miRNAMature MIRTX sense (50-UCUAAACCACCAUAUGAAACCA-

GC-30) and antisense (50-GCUGGUUUCAUAUGGUGGUU-UAGA-30), mimic-miR-34a sense (50-UGGCAGUGUCUUAG-CUGGUUGU-30) and antisense (50-ACAACCAGCUAAGACACU-GCCA-30), and mimic-miR-negative control sense (50-AUCC-GCGCGAUAGUACGUA-30) and antisense (50-UACGUACUA-UCGCGCGGAU-30) were obtained from Gene Design Inc. Mod-ification of the one-strand sequence to inactivation was per-formed by Gene Design Inc. or Thermo Fisher Scientific. Cellswere transfected with miRNAs at the concentration of 20 to 40nmol/L by Lipofectamine RNAiMAX (Invitrogen) according to theprotocol provided by the manufacturer.

RNA isolationTotal RNA, includingmiRNA, was isolated from tissue samples

and cell lines using the miRNeasy Kit (Applied Biosystems)according to the manufacturer's protocol. Total RNA concentra-tion and purity were reassessed with a NanoDrop ND-1000spectrophotometer (NanoDrop Technologies).

miRNA expressionWemeasuredmiRNA expression levels in tissues and cells with

the TaqMan miRNA Assays (Applied Biosystems). The reversetranscription reactionwas performedwith the TaqManMicroRNART Kit (Applied Biosystems). Quantitative real-time PCR wasperformedwith the 7900HT SequenceDetection System (AppliedBiosystems). Amplification data were normalized to endogenousRNU6B expression. Relative expression was quantified with the2�DDC

t method.

Cell proliferation assayCells were seeded at a density of 5–7 � 104 cells per well in

24-well dishes and cultured for 24 to 72 hours to determineproliferation. Cell counting was performed with an automatichematology analyzer (Celltac; Nihon Kohden). Cellular prolifer-ationwas also evaluated byWST-8 assay usingCell CountingKit-8(Dojindo Molecular Technologies, Inc.).

Flow cytometry analysisTo examine the apoptosis,flowcytometry analysis of AnnexinV

was performed as described previously (30). Apoptotic cells werestained by using Alexa Fluor 488 Annexin V/Dead Cell ApoptosisKit (Thermo Fisher Scientific) and counted by flow cytometryusing the SH800Z Cell Sorter (Sony Biotechnology Inc.).

TUNEL assayCells were fixed with freshly prepared 10% buffered neutral

formalin overnight at room temperature. Apoptotic DNA frag-mentation within the cells was analyzed with an in situ DeadEndFluorometric TUNEL System Assay Kit (Promega), according tothe manufacturer's instructions. Hoechst was used for nuclearstaining. The green fluorescence of apoptotic cells was observedwith a BZ-X700 fluorescence microscopy (KEYENCE).

Inoue et al.

Mol Cancer Ther; 17(5) May 2018 Molecular Cancer Therapeutics978




Western blot analysisThe protein samples were subject to SDS-PAGE, transferred

onto PVDF (polyvinylidene difluoride) membranes, and incu-bated with mAbs. Antibodies against MCL1, BCL2, BCL-xL, BAX,PIK3R1, phosphorylated AKT, phosphorylated mTOR, NF-kB(p65), and phosphorylated NF-kB (phosphorylated p65) wereobtained from Cell Signaling Technology. Antibody againstCXCR2 (ab14935) was obtained from Abcam. Antibodies againstb-actin (ACTB) were obtained from Sigma-Aldrich. Antibodyagainst survivin was obtained from Novus. After incubation withsecondary antibodies, signals were detected with the ECL Detec-tion System (GE Healthcare).

NF-kB luciferase reporter assayAll cells were seeded onto 96-well plates and transfected with

NF-kB luciferase reporter vector (pGL4.32[luc2P/NF-kB-RE/Hygro]; Promega) using Lipofectamine 2000 (Invitrogen) inOptiMEM-reduced serum medium (GIBCO, Invitrogen). Thetransfection efficiency was evaluated with a Renilla luciferasereporter vector (pRL-CMV, Promega). NF-kB transcriptionalactivities were determined in dual luciferase reporter assays.Forty-eight hours after cotransfection with both reporter vectorsand the target miRNA, cells were collected with the reporterlysis buffer from the Luciferase Assay System (Promega). Theluciferase-mediated luminescence was measured with the Dual-Luciferase Reporter Assay System (Promega) according to themanufacturer's protocol. All transfection experiments wereconducted in triplicate.

Prediction of MIRTX target genesFirst, to predict MIRTX-dependent repressed gene sets via

complementary base-pairing between the 7-mer seed (MIRTX;50-CUAAACC-30) and the last exon containing the 30-UTRsequence, the last exons containing the 30-UTRs of human tran-scripts were obtained as fasta files from the Ensembl FTP Server(version hg19). A total of 1,043 ensembl transcripts were found tohave a perfectly MIRTX-targeted sequence (50-GGTTTAG-30), atleast in the 30-UTR, by using standard linux tools such as grep.

pmirGLO reporter plasmid construction and luciferase reporterassay

The 30-UTR of human PIK3R1 mRNA, including the MIRTX-binding site, was amplified by RT-PCR. The primer sequenceswere forward-GCTCGCTAGCCTCGAAACAGCGCTCACCTTTG-TTT and reverse-ATGCCTGCAGGTCGACTGAACATACCAGCT-TTTGCAT. The amplified product (431 bp) was subcloned andligated into the Xho I and Sal I sites in the pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega) using theIn-Fusion HD Cloning Kit (Clontech). The 30-UTR of humanCXCR2 mRNA, including the MIRTX-binding site, was amplifiedby RT-PCR. The primer sequences were forward-GCTCGCTAG-CCTCGACCCATTGTGGTCACAGGAA and reverse-ATGCCTG-CAGGTCGACACAATCTCGGCTCACTGC. As before, the ampli-fied product (431 bp) was subcloned and ligated into the Xho Iand Sal I sites in the pmirGLO Dual-Luciferase miRNA TargetExpression Vector (Promega) using the In-Fusion HDCloning Kit(Clontech).

Luciferase assays were conducted with 1 � 104 DLD1 andSW480 cells per well in 96-well plates. Transfections were per-formed with Lipofectamine 2000 (Invitrogen) in OptiMEM-reduced serum medium (GIBCO, Invitrogen). Cells were trans-

fected with 100 ng of a pmirGLO construct, which containedeither the 30-UTR of PIK3R1 or CXCR2, 10 ng of Renilla luciferasereporter vector (pRL-CMV, Promega), and 5 pmol of either miR-NC or MIRTX. Forty-eight hours after cotransfection, cells wereassayed for both firefly and Renilla luciferase with the Dual-Luciferase Reporter Assay System (Promega), according to themanufacturer's protocol. All transfection experiments were con-ducted in triplicate.

In vivo tumor growth assayCells were mixed with Matrigel (BD Biosciences) and medium

at a 1:10 ratio (v:v). Cells (2� 106) in 200 mL ofmedium/Matrigelsolutionwere injected subcutaneously intoboth sides of the lowerback region of female nude mice (NIHON CLEA). Using supercarbonate apatite (sCA) as a vehicle (31, 32), formulated miRNA(40% conjugation) was administered intravenously (40 mg/injec-tion); all injections were delivered via the tail vein, after tumorvolumes reached 50 mm3. Mice were treated eight times withformulatedMIRTX ormiR-NC, three times a week. MatureMIRTXand miR-negative control for in vivo use grade were obtainedfrom Gene Design Inc. Tumor volumes were determined asdescribed earlier (33, 34). All animal experiments were per-formed in accordance with currently prescribed guidelines, andexperimental protocols (ID; DOUI 25-062) were approved byan Institutional Animal Care and Use Committee in OsakaUniversity (Osaka, Japan).

IHCFormalin-fixed, paraffin-embedded tissues were prepared and

sectioned for 4 mm. These were deparaffinized with xylene, andthen rehydrated in graded alcohols. Immunostaining was per-formed using antibody with VECTASTAIN Elite ABC Kit (VectorLaboratories), according to the manufacturer's protocol. Anti-CXCR2 antibody (ab14935) and anti-PI3 kinase p85a antibody[M253] (ab86714), and anti-BCL2 antibody [E17] (ab32124)were obtained from Abcam. Anti–NF-kB (p65) antibody andantiphosphorylated NF-kB (phosphorylated p65) antibody wereobtained from Cell Signaling Technology.

Statistical analysisStatistical analyses were performed with the JMP10 program

(SAS Institute) and GraphPad Prism ver. 6.00 for Windows(GraphPad Software). Each experiment was performed at leastthree times. Data are expressed as mean � SD. Mean values werecompared using the Student t test or one-way ANOVA analysis.Expression levels of miRNAs in colorectal cancer tissue sampleswere analyzed with the Wilcoxon signed rank test. Sequential cellproliferation assays and tumor growth assays were analyzed withtwo-way ANOVAs for repeated measures. P values <0.05 wereconsidered statistically significant.

ResultsEffect of mimic-miR-29b-1-5p on cell proliferation

In vitro proliferation assays were performed with the mimic-miR-29b-1-5p, which was synthesized as the double-strand RNAwith miR-29b-1-5p and its complementary byproduct sequence(Fig. 1). The results indicated that mimic-miR-29b-1-5p signifi-cantly suppressed cell proliferation of KRAS-mutated DLD1 andSW480 cells, andKRASwild-typeHT29 colorectal cancer cell linescompared with parent or negative control miRNA (Fig. 2A;Supplementary Fig. S1A and S1B).Notably, the growth-inhibitory

A Novel Small RNA against KRAS-Mutant Colon Cancer

www.aacrjournals.org Mol Cancer Ther; 17(5) May 2018 979




effect bymimic-miR-29b-1-5pwas equivalent to ormore effectivethanmiRNA-34a (Fig. 2A), which is well known for its antitumoreffects (35).

Expression of miR-29b-1-5p and miR-29-3p in clinicalcolorectal cancer samples

Despite the outstanding growth-inhibitory activity,miR-29b-1-5p, formerly described as miR-29b�, is generally considered as adegradable passenger miRNA in many cell types (23, 24). There-fore, we examined miR-29b-1-5p expression in comparison withthat of the guide strand, miR-29-3p. RT-PCR assay showed a

variety of miR-29b-3p expression in clinical colorectal cancersamples, whereas the expression of miR-29b-1-5p was only neg-ligible in all samples tested (P < 0.01; Fig. 2B). This findingindicates that miR-29b-1-5p is unstable in colorectal cancertissues, and it is uncertain that the degradable passenger sequencecan inhibit cell growth. To examine whether the miR-29b-1-5pstrand is definitely functional or not, we used a modified miRNAmimic from Gene Design Inc. in which activity of the comple-mentary sequence is chemically impaired; thus, the functionderived from single strand of miR-29b-1-5p can be evaluated.We also prepared another miRNAmimic, in whichmiR-29b-1-5p

miR-29b-1-5p

CGACCAAAGUAUACCACCAAAUCUComplementary sequence(MIRTX)

GCUGGUUUCAUAUGGUGGUUUAGA5 -

3 -

- 3

- 5

Mimic-miR-29b-1-5p

miR-29b-1-5p

h�p://www.mirbase.org/

miR-29b-3p

5 -

3 -

GCUGGUUUCAUAUGGUGGUUUAGAUUGUGACUAAAGUUUACCACGAU

- 3- 5

Pri-miR-29b

Figure 1.

Sequence of hsa-miR-29b. The hsa-miR-29b precursor is a small RNAmolecule in the shape of a stem loop orhairpin. Each arm of the hairpin isprocessed into mature miR-29b-3p(guide strand) and miR-29b-1-5p(passenger strand). MIRTX is a novelsmall RNA sequence that is acompletely opposite complementarysequence to miR-29b-1-5p.

Figure 2.

Effects of mimic-miR-29b-1-5p on cell proliferation and expression level of hsa-miR-29b in clinical colorectal cancer (CRC) samples. A, Overexpression of mimic-miR-29b-1-5p significantly suppressed cell proliferation inDLD1, SW480, andHT29cells comparedwith parent or negative controlmimic-miR-NCandwasequivalent toor more effective than mimic-miR-34a, which is well known for its antitumor effects. B, Expression level of miR-29b-3p and miR-29b-1-5p in clinical colorectalcancer tumor samples (n ¼ 40). C, Inhibitory effects on proliferation of KRAS-mutant colorectal cancer cell lines. A complementary strand, but not miR-29b-1-5p,significantly inhibited cell proliferation. Modification of the one-strand sequence to inactivation was performed by Gene Design Inc. All data, mean � SD. � , P < 0.01.

Inoue et al.





sequence is in turn modified to inactivation. As a result, wefound that miR-29b-1-5p sequence had no growth-inhibitoryeffect in DLD1 and SW480 and that an opposite complemen-tary strand to miR-29b-1-5p exhibited an obvious growthinhibition (Fig. 2C). An alternative system of mirVana miRNAmimic from Thermo Fisher Scientific further confirmed theresult (Supplementary Fig. S1C). Therefore, we hereafter des-ignate this antitumor byproduct sequence "MIRTX" meaning atherapeutic miRNA (Fig. 1) and explored the underlying mech-anism for its potent antitumor effect.

MIRTX induces apoptosisA drastic decrease in KRAS-mutated DLD1 cells with treatment

of MIRTX may be attributable to apoptosis. Terminal deoxynu-cleotidyl transferase–mediated dUTP nick end labeling (TUNEL)assay showed that a number of TUNEL-positive fluorescence cellsappeared with treatment of MIRTX compared with control cul-tures (Fig. 3A). Flow cytometry analysis of Annexin V showed thattreatment of MIRTX significantly increased apoptotic fraction at24 and 48 hours (P < 0.01, Fig. 3B).Western blot analyses showed

that MIRTX suppressed the protein expression of antiapoptoticproteins MCL1, BCL2, and BCL-xL, whereas MIRTX increased theexpression of cleaved PARP and cleaved caspase-3 compared withnegative control miRNA treatment (Fig. 3C).

The target genes of MIRTXThe seed sequence (2–8 position from 50-end) is thought to

play a pivotal role in regulating gene expression by binding the 30-UTRof the targetmRNA. In silicowhole-genome sequence analysisdemonstrated that 1,043 genes possessed a binding site to theMIRTX seed sequence (CCAAAUC, Supplementary Fig. S2A).cDNA microarray data (GEO accession number; GSE83634)revealed that 74 of the 1,043 genes were downregulated at<0.66-fold in MIRTX- transfected KRAS-mutated DLD1 cellscompared with negative control miRNA-transfected cells (Sup-plementary Fig. S2B; Supplementary Table S1). Of them, wefocused on CXCR2 encoding a G-protein–coupled transmem-brane chemokine receptor, and PIK3R1 [PI3K, regulatory subunit1 (alpha)] as the targets ofMIRTX because they regulate apoptosisand cell survival via NF-kB/survivin and AKT/mTOR signaling

A DLD1 KRASG13D

C

CleavedPARP

Cleavedcaspase-3

ACTB

B Parent miR-NC

AF-488

PI

MIRTX

0

5

10

15

20

1

NCMIRTX

*

0

20

40

60

80

100

1

NCMIRTX

*

Anne

xin-

posi

�ve

cells

(%)

Anne

xin-

posi

�ve

cells

(%)

48 h24 h *P < 0.01

Figure 3.

Proapoptotic effects of MIRTX in KRAS-mutant colorectal cancer model. A, TUNEL assay showed that the number of apoptotic cells was higher in MIRTX-treatedcells than in parent ormiR-NC–treated cells.B,Flowcytometry analysis ofAnnexinVwasperformed inparentalDLD1 cells,miR-NC–treatedcells, andMIRTX-treated cells.The number of apoptotic cells was quantified in triplicate. C, Western blot results showed the protein expression of MCL1, BCL2, BCL-xL, BAX, cleaved PARP, andcleaved caspase-3 in either negative control miR or MIRTX-treated DLD1 cells in 24, 48, and 72 hours. MIRTX significantly suppressed the expression of theantiapoptotic proteins MCL1, BCL2, and BCL-xL compared with negative control miRNA. b-Actin (ACTB) was the loading control. All data, mean � SD. � , P < 0.01.






pathway, respectively (Supplementary Fig. S3A). MIRTX overex-pression inhibited the luciferase reporter activity of a plasmid thatincluded the 30-UTR region of CXCR2 (Fig. 4A and B) and PIK3R1(Fig. 4C and D) in KRAS-mutated DLD1 and SW480, indicatingthat MIRTX directly binds to the 30-UTR of CXCR2 mRNA andPIK3R1 mRNA in these KRAS-mutated colorectal cancer cells.

MIRTX inhibits CXCR2/NF-kB/survivin pathway but not PI3K/AKT/mTOR pathway

MIRTX suppressed CXCR2 protein expression, leading to inhi-bition of downstreammolecules such as phosphorylation of p65subunit of NF-kB that is thought to be important for transcrip-tional activity ofNF-kB (16, 36, 37), and antiapoptotic survivin inKRAS-mutated DLD1 and SW480 (Fig. 5A). On the other hand,decrease in expression of the CXCR2 protein and phosphorylatedp65was not evident in KRASwild-type HT29 cells. Concordantly,

the luciferase reporter assays showed MIRTX significantly sup-pressed NF-kB transcriptional activities in DLD1 and SW480cells, but not in HT29 cells (Fig. 5B). MIRTX suppressed PIK3R1protein expression; however, the PI3K downstream signalingmolecule, phosphorylated AKT, was rather upregulated possi-bly by a compensatory mechanism and phosphorylated mTORwas not substantially changed (Fig. 5C). In addition, MIRTXdid not suppress SRE or AP1 transcriptional activities, whichincrease in response to activation of the MAPK/ERK or MAPK/JNK signaling pathway in colorectal cancer cell lines (Supple-mentary Fig. S4).

Systemic administration of formulated MIRTX inhibits tumorgrowth in vivo

Because MIRTX is an artificial byproduct sequence and it isnot present in the mouse body, we evaluated the toxicity of

Figure 4.

MIRTX directly binds and targets CXCR2and PIK3R1 mRNA in KRAS-mutantcolorectal cancer cell lines. A and C,Schematic illustration shows that CXCR2and PIK3R1 possess a putative bindingsite on the 30-UTR of its mRNA for theseed sequence of MIRTX. B and D, Theluciferase activity of a plasmid thatincluded the 30-UTR region of CXCR2and PIK3R1 in DLD1 and SW480 cellstreated with miR-NC or MIRTX. All data,mean � SD. � , P < 0.01.

Inoue et al.





formulated MIRTX side effects. We observed no differences inmortality or bodyweight loss between the groups throughoutthe experiment (Fig. 6A). Blood chemistry tests showed noabnormalities except for a modest increase in phosphorus(Supplementary Fig. S5A), and hematoxylin and eosin(H&E)–stained sections of each organ tissue (brain, heart,lung, liver, spleen, kidney, colon) revealed no particular his-tologic damage in formulated MIRTX-treated mice (Supple-mentary Fig. S5B). We then investigated the in vivo tumor-inhibitory effect of MIRTX by systemic administration in atumor xenograft mouse model. We used a super carbonateapatite as the delivery vehicle via tail vein injections. Theresults showed that the systemic administration of this for-mulated MIRTX significantly inhibited tumor growth of DLD1and HT29 in the mice (Fig. 6B, Supplementary Fig. S5C andS5D). We then focused on KRAS-mutated DLD1 cells in whichMIRTX downregulated CXCR2 and PIK3R1, resulting in inhi-bition of NF-kB cascade in vitro. With RT-PCR analyses, weconfirmed that DLD1 tumor xenografts that were administeredsystemic formulated MIRTX exhibited a significantly higherconcentration of MIRTX compared with negative controlmiRNA (Fig. 6C). Western blot analyses of DLD1 xenograftsdemonstrated that expression of CXCR2, PIK3R1, phosphor-ylated p65, BCL2, and survivin decreased. In contrast, cleavedcaspase-3 increased with treatment of MIRTX (Fig. 6D). IHCanalyses showed concordant results that expression of CXCR2,PIK3R1, phosphorylated NF-kB (p-p65), and BCL2 decreasedin MIRTX-treated tumors compared with the control tumors,while intense expression of the whole NF-kB (p65) protein wasmaintained (Fig. 6E).

DiscussionIn this study, we identified a novel small RNA sequence

that could significantly inhibit KRAS-mutant colorectal cancercell growth and designated this potentially therapeutic RNAsequence "MIRTX." Our results show that MIRTX exhibits apotent growth-inhibitory and proapoptotic effect in vitro andin vivo. Moreover, we also showed that MIRTX could directlytarget PIK3R1 and CXCR2, suppressing NF-kB signaling path-ways. These results suggest a potential therapeutic strategy inKRAS-mutant colorectal cancer. To our knowledge, this reportis the first to describe the antitumor function of this artificialsmall RNA sequence.

It is generally thought that hsa-miR-29b precursor (primarymiRNA: pri-miRNA) is a small RNA molecule in the shape of astem loop or hairpin. After being captured by RISC, each arm ofthe hairpin is processed into the two single RNA strands. One-strand RNA (guide RNA, mature miRNA) is stable and function-ally binds to the target mRNA and the other (passenger RNA),initially discriminated with a star mark, is unstable and destinedto undergo degradation (23, 24, 38, 39). For example,miR-29b-1-5p is described as miR-29b� on 3D-Gene Human miRNA Oligochips (Toray Industries), which means it is degraded and has noapparent human physiologic function (38). Indeed, a number ofstudies >500 on PubMed database focused on miR-29b-3p,whereas there are only 6 reports on miR-29b-1-5p (27, 28, 40–43). We also confirmed that expression levels of miR-29b-1-5pwere very low in clinical colorectal cancer tumor samples, whichcontrasts to high expression of miR-29b-3p using the samecolorectal cancer samples.

Figure 5.

MIRTX suppresses NF-kB signalingactivity in KRAS-mutant colorectalcancer cell lines. A, Western blotanalyses of CXCR2, NF-kB (p65),phosphorylated NF-kB (p-p65), andsurvivin in DLD1, SW480, and HT29 cellstreated with miR-NC or MIRTX. b-Actin(ACTB) was the loading control. B, Theluciferase activities of a plasmid thatcontained the pGL4.32[luc2P/NF-kB-RE/Hygro] in DLD1, SW480, and HT29cells treated with miR-NC or MIRTX. Thedata show that MIRTX significantlysuppressed NF-kB transcriptionalactivities in DLD1 and SW480 cells. Alldata, mean � SD. � , P < 0.01. C,Westernblot analyses of PIK3R1, phospho-AKT,and phospho-mTOR in DLD1, SW480,and HT29 cells treated with miR-NC orMIRTX. b-Actin (ACTB) was the loadingcontrol.






Figure 6.

Systemic administration of formulated sCA-MIRTX inhibited tumor growth in vivo. Tumor xenograft mouse models received intravenous administrationsof MIRTX or miR-NC using sCA as a vehicle on days 0, 2, 4, 7, 9, 12, 14, and 16 via a tail vein injection (arrows, days of injections). Each injectioncontained 40 mg of formulated oligo with a 40% conjugation rate. A, Body weight loss was evaluated for the parent (n ¼ 8), treated with sCA-control-miR(n ¼ 8), and treated with sCA-MIRTX (n ¼ 8). B, DLD1 and HT29 tumor xenograft mouse models received intravenous administration of MIRTX orcontrol-miRNA using sCA. Tumor volumes were evaluated for the parent (n ¼ 8), treated with miR-NC (n ¼ 8), treated with MIRTX (n ¼ 8) on days 0,2, 4, 7, 9, 12, 14, and 16. Tumors were resected on day 18. All data, mean � SD. (� , P < 0.01, two-way ANOVA). C, RT-PCR analyses showing the highexpression level of MIRTX in tumor xenografts administered formulated sCA-MIRTX, compared with parent or sCA-control-miR–administered tumors.D, Western blot analyses showing the expression of CXCR2, PIK3R1, NF-kB (p65), phosphorylated NF-kB (p-p65), BCL2, survivin, and cleaved caspase-3(C-caspase-3) in resected xenograft tumors from parent, control-miRNA, and MIRTX-treated mice. b-Actin (ACTB) was the loading control. All data,mean � SD. � , P < 0.01. E, The representative images of H&E staining and IHC staining for CXCR2, PI3 kinase p85a, NF-kB (p65), phosphorylated NF-kB(phosphorylated p65), and BCL2. Each scale bar, 50 mm.

Inoue et al.





Asmentioned in the Introduction, a recent report demonstrateda tumor-suppressive effect by miR-29b-1-5p in triple-negativebreast cancer (28). Therefore, it is of course worth investigatinga role of miR-29b-1-5p in colon cancer; however, the actualmotivation to start this project emerged from our unpublisheddata related to a previous study (32), in whichmimic-miR-29b-1-5p exhibited a considerably potent growth-inhibitory effect com-pared with other miRNAs tested (Supplementary Fig. S6).

To guarantee the activity of guide miRNA strand alone andto exclude off-target effect from the opposite complementarysequence, companies supply optimally conditionedmiRNAmim-ic. These include mirVana miRNA Mimics (Thermo Fisher Scien-tific), miRCURY LNA microRNA Mimic (Exiqon), and the onefromGeneDesign Inc. As anticipated, we found that a completelyopposite complementary strand to miR-29b-1-5p named MIRTXpossessed a potent growth-inhibitory effect, whereas a maturemiR-29b-1-5p strand did not, using the conditioned miRNAmimics obtained from the two different suppliers.

AlthoughmiR-29b-3p andMIRTX are both the partners ofmiR-29b-1-5p, their sequences are rather different. This is because eacharm in the pri-miR-29b is processedwith 3 base-shift in RISC (Fig.1), which caused totally different seed sequences between miR-29b-3p and MIRTX, ACCACGA and CCAAAUC, respectively.Although miR-29b-3p is a putative anti-oncomiRNA (19–21),MIRTX showed much stronger antiproliferative activity in DLD1(Supplementary Fig. S7). Also as shown in Fig. 2A, MIRTXexhibited an equivalent to or more effective than the putativeanti-onco miR-34a (35) in colorectal cancer cells. Moreover,MIRTX displayed a very strong inhibition of growth and invasionin a series of KRAS-mutated pancreatic cancer cells (H. Yama-moto; unpublished observations).

On the basis of in silico computational analysis and cDNAmicroarray analysis, we focused on PIK3R1 and CXCR2 becausethese molecules are involved in NF-kB signaling pathway (Sup-plementary Fig. S3, refs. 9, 13, 44). As mentioned in Introduction,NF-kB is activated in KRAS-mutated colorectal cancer (9, 10). Weindeeddemonstrated thatMIRTX could directly bind to the 30-UTRregion ofCXCR2 and PIK3R1mRNAs and suppress protein expres-sion of both genes in KRAS-mutated colorectal cancer cells, DLD1and SW480. Earlier studies demonstrated that IL8 and its receptorCXCR2 are significantly upregulated in the tumor and its micro-environment in colorectal cancer (16, 45). CXCR2 is known asa cell receptor that directly regulates NF-kB signaling pathway(14, 44). On the other hand, PIK3R1 is reportedly shown to be anintrinsic activator of NF-kB (10, 13). As a result, we found thattargeting the multiple molecules by MIRTX led to effective inhi-bitionof theNF-kB signalingpathway, exerting anantitumor effectand triggering apoptosis in KRAS-mutated colon cancer cells.

It is of interest that AKT was unexpectedly activated (phos-phorylated) or compensatedwhenPIK3R1was downregulated byMIRTX (Fig. 5C). Studies have reported that these signaling path-ways are complex and can result in pathway activation by feed-back loops or cross-talk signal activations (46). These pathwayactivations are also considered to be among the causes of drugresistance, which suggests possible limitations from targeting asinglemolecule. In this regard, it is assumed thatMIRTXwould bemore effective if it is used in combination with the AKT inhibitoror miR-4689 that inhibits KRAS and AKT1 simultaneously (32).

We should emphasize thatMIRTX is effective not only toKRAS-mutated colorectal cancer, but also to KRAS wild-type colorectalcancer (e.g., HT29, Colo201: see Supplementary Fig. S6), but

when we examined protein expression of PIK3R1 and CXCR2 inHT29 cells, they were not changed (Fig. 5A–C), suggesting that analternative mechanism exists.

The use of siRNA or miRNA as therapeutics or prognosticbiomarkers has shown promise in the treatment of cancer, andseveral anticancer small RNA–based drugs have entered clinicaltrials (19, 47, 48). However, many obstacles that hinder thefunctional efficacy and safety of miRNAs in the clinic remain tobe resolved. Effective delivery is themost challenging hurdle in thedevelopment of miRNAs as a broad therapeutic platform (48). Inthis study, we applied an in vivo pH-sensitive delivery system fornucleic acids using sCA nanoparticles. Our previous studies dem-onstrated that sCA nanoparticles had high affinity with nucleicacids and efficiently delivered miRNA and siRNA into varioustumors in mouse models compared with other types of in vivosystemic delivery vehicles, such as liposome or atelocollagen (12,31, 33, 49). Accumulating evidence provides a strong rationale fortherapeutically targeting the NF-kB pathway in many types ofcancers (9, 11,44).However, despite the pharmaceutical industry'saggressive effort to develop specific NF-kB inhibitors for indica-tions in oncology, no such inhibitor has been clinically approvedbecause of the toxicities associated with the global suppression ofNF-kB (50). We showed that intravenously administered sCA–MIRTX conjugates abundantly accumulated in the xenografttumors in nude mice. After treatment, xenograft tumors exhibitedsignificant downregulation of PIK3R1, CXCR2, and phosphory-lated p65, and antiapoptotic protein expression, as observed in invitro experiments. Moreover, systemic administration of sCA–MIRTX conjugates in colorectal cancer mouse models showed nospecific toxicities. These results suggest that targeting the NF-kBpathway by MIRTX could offer a potentially great therapeuticefficacy and less dose-limiting toxicities in colorectal cancer.

In conclusion, we identified a novel small RNA sequence,MIRTX, that significantly inhibited KRAS-mutant colorectalcancer cell growth in vitro and in vivo. We also demonstratedthat MIRTX could suppress NF-kB signaling pathways via directinhibition of CXCR2 and PIK3R1. These results suggest a novelRNA-based therapeutic strategy against refractory KRAS-mutantcolorectal cancer in addition to KRASwild-type colorectal cancer.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: A. Inoue, H. Takahashi, Y. Doki, M. Mori,H. YamamotoDevelopment of methodology: A. Inoue, R. Ikeshima, H. YamamotoAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): A. Inoue, T. Mizushima, X. Wu, N. Kambara,S. Ishikawa, J. Wang, Y. Qian, H. Hirose, M. Hiraki, N. Miyoshi, H. YamamotoAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): A. Inoue, D. Okuzaki, H. Takahashi, M. Mori,H. YamamotoWriting, review, and/or revision of the manuscript: A. Inoue, T. Mizushima,Y. Yokoyama, H. Takahashi, N. Haraguchi, H. YamamotoAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): A. Inoue, T. Mizushima, C. Matsuda, M. MoriStudy supervision: A. Inoue, T. Mizushima, N. Haraguchi, T. Hata, Y. Doki,M. Mori, H. Yamamoto

AcknowledgmentsWe thank the Yamamoto's laboratory members, especially Yui Kubota,

Kazuki Oishi, and Mayu Ito, for experimental assistance in this work. We






express our respect to Emeritus Prof. Toshihiro Akaike (FAIS, Ibaraki, Japan) fordeveloping the original carbonate apatite gene delivery system. This work wassupported by Grants-in-Aid for Scientific Research (KAKENHI, no. 21390360,no. 30322184, no. 24390315; to H. Yamamoto). H. Yamamoto has beenawarded grant support from Project MEET (Osaka University Graduate Schoolof Medicine) and Mitsubishi Tanabe Pharma Corporation.

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received September 1, 2017; revised January 6, 2018; accepted February 21,2018; published first March 15, 2018.

References1. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2016. CA Cancer J Clin

2016;66:7–30.2. Colvin H, Mizushima T, Eguchi H, Takiguchi S, Doki Y, Mori M. Gastro-

enterological surgery in Japan: the past, the present and the future. AnnGastroenterol Surg 2017;1:5–10.

3. Van Cutsem E, Lenz HJ, Kohne CH, Heinemann V, Tejpar S, Melezinek I,et al. Fluorouracil, leucovorin, and irinotecan plus cetuximab treatmentand RAS mutations in colorectal cancer. J Clin Oncol 2015;33:692–700.

4. Tabernero J, VanCutsemE,Diaz-Rubio E,Cervantes A,Humblet Y, Andre T,et al. Phase II trial of cetuximab in combination with fluorouracil, leu-covorin, and oxaliplatin in the first-line treatment of metastatic colorectalcancer. J Clin Oncol 2007;25:5225–32.

5. Saeki H, Emi Y, Kumashiro R, Otsu H, Kawano H, Ando K, et al. Impact ofsecond-line and later cetuximab-containing therapy and KRAS genotypesin patients with metastatic colorectal cancer: a multicenter study in Japan.Surg Today 2014;44:1457–64.

6. De Roock W, Claes B, Bernasconi D, De Schutter J, Biesmans B, FountzilasG, et al. Effects of KRAS, BRAF,NRAS, andPIK3CAmutations on the efficacyof cetuximab plus chemotherapy in chemotherapy-refractory metastaticcolorectal cancer: a retrospective consortium analysis. Lancet Oncol 2010;11:753–62.

7. LoRusso PM, Krishnamurthi SS, Rinehart JJ, Nabell LM, Malburg L, Chap-man PB, et al. Phase I pharmacokinetic and pharmacodynamic study of theoral MAPK/ERK kinase inhibitor PD-0325901 in patients with advancedcancers. Clin Cancer Res 2010;16:1924–37.

8. LimHY,Heo J, ChoiHJ, LinCY, Yoon JH,HsuC, et al. Aphase II studyof theefficacy and safety of the combination therapy of the MEK inhibitorrefametinib (BAY 86–9766) plus sorafenib for Asian patients with unre-sectable hepatocellular carcinoma. Clin Cancer Res 2014;20:5976–85.

9. Karin M, Cao Y, Greten FR, Li ZW. NF-kappaB in cancer: from innocentbystander to major culprit. Nat Rev Cancer 2002;2:301–10.

10. Jana A, Krett NL, Guzman G, Khalid A, Ozden O, Staudacher JJ, et al. NFkBis essential for activin-induced colorectal cancermigration via upregulationof PI3K-MDM2 pathway. Oncotarget 2017;8:37377–93.

11. Viatour P,MervilleMP, Bours V, Chariot A. Phosphorylation of NF-kappaBand IkappaB proteins: implications in cancer and inflammation. TrendsBiochem Sci 2005;30:43–52.

12. Han SS, YunH, SonDJ, Tompkins VS, Peng L, Chung ST, et al. NF-kappaB/STAT3/PI3K signaling crosstalk in iMyc E mu B lymphoma. Mol Cancer2010;9:97.

13. Hutti JE, Pfefferle AD, Russell SC, Sircar M, Perou CM, Baldwin AS.Oncogenic PI3Kmutations lead toNF-kappaB-dependent cytokine expres-sion following growth factor deprivation. Cancer Res 2012;72:3260–9.

14. Ning Y, Labonte MJ, Zhang W, Bohanes PO, Gerger A, Yang D, et al. TheCXCR2 antagonist, SCH–527123, shows antitumor activity and sensitizescells to oxaliplatin in preclinical colon cancer models. Mol Cancer Ther2012;11:1353–64.

15. Ning Y, Manegold PC, Hong YK, Zhang W, Pohl A, Lurje G, et al. Inter-leukin–8 is associated with proliferation, migration, angiogenesis andchemosensitivity in vitro and in vivo in colon cancer cell line models. IntJ Cancer 2011;128:2038–49.

16. Balkwill F. Cancer and the chemokine network. Nat Rev Cancer 2004;4:540–50.

17. Duckworth C, Zhang L, Carroll SL, Ethier SP, Cheung HW. Overexpressionof GAB2 in ovarian cancer cells promotes tumor growth and angiogenesisby upregulating chemokine expression. Oncogene 2016;35:4036–47.

18. He L, Hannon GJ. MicroRNAs: small RNAs with a big role in generegulation. Nat Rev Genet 2004;5:522–31.

19. Inoue A, Yamamoto H, Uemura M, Nishimura J, Hata T, Takemasa I, et al.MicroRNA–29b is a novel prognostic marker in colorectal cancer. Ann SurgOncol 2015;22 Suppl 3:S1410–8.

20. Wu Y, Crawford M, Mao Y, Lee RJ, Davis IC, Elton TS, et al. Therapeuticdelivery ofmicroRNA–29b by cationic lipoplexes for lung cancer. Mol TherNucleic Acids 2013;2:e84.

21. Garzon R, Heaphy CE, Havelange V, Fabbri M, Volinia S, Tsao T, et al.MicroRNA 29b functions in acute myeloid leukemia. Blood 2009;114:5331–41.

22. Qi Y, Huang Y, Pang L, Gu W, Wang N, Hu J, et al. Prognostic value of theMicroRNA–29 family in multiple human cancers: a meta-analysis andsystematic review. Clin Exp Pharmacol Physiol 2017;44:441–54.

23. SchwarzDS,HutvagnerG,DuT, XuZ,AroninN, Zamore PD.Asymmetry inthe assembly of the RNAi enzyme complex. Cell 2003;115:199–208.

24. Khvorova A, Reynolds A, Jayasena SD. Functional siRNAs and miRNAsexhibit strand bias. Cell 2003;115:209–16.

25. Okamura K, Phillips MD, Tyler DM, Duan H, Chou YT, Lai EC.The regulatory activity of microRNA� species has substantial influenceon microRNA and 3' UTR evolution. Nat Struct Mol Biol 2008;15:354–63.

26. Okamura K, ChungWJ, Lai EC. The long and short of inverted repeat genesin animals: microRNAs, mirtrons and hairpin RNAs. Cell Cycle 2008;7:2840–5.

27. Xu F, Zhang Q, Cheng W, Zhang Z, Wang J, Ge J. Effect of miR-29b-1� andmiR-29c knockdownon cell growth of the bladder cancer cell line T24. J IntMed Res 2013;41:1803–10.

28. Drago-Ferrante R, Pentimalli F, Carlisi D, De Blasio A, Saliba C, Baldac-chino S, et al. Suppressive role exerted by microRNA-29b-1-5p in triplenegative breast cancer through SPIN1 regulation. Oncotarget 2017;8:28939–58.

29. Sobin LH, Gospodarowicz MK, Wittekind C. TNM classification of malig-nant tumors. Oxford, United Kingdom: Wiley-Blackwell; 2010.

30. Nakamura M, Nagano H, Sakon M, Yamamoto T, Ota H, Wada H, et al.Role of the Fas/FasL pathway in combination therapy with interferon-alpha and fluorouracil against hepatocellular carcinoma in vitro. J Hepatol2007;46:77–88.

31. Wu X, Yamamoto H, Nakanishi H, Yamamoto Y, Inoue A, Tei M, et al.Innovative delivery of siRNA to solid tumors by super carbonate apatite.PLoS One 2015;10:e0116022.

32. Hiraki M, Nishimura J, Takahashi H, Wu X, Takahashi Y, Miyo M, et al.Concurrent targeting of KRAS and AKT by MiR–4689 is a novel treatmentagainst mutant KRAS colorectal cancer. Mol Ther Nucleic Acids 2015;4:e231.

33. Takeyama H, Yamamoto H, Yamashita S, Wu X, Takahashi H, Nishi-mura J, et al. Decreased miR–340 expression in bone marrow isassociated with liver metastasis of colorectal cancer. Mol Cancer Ther2014;13:976–85.

34. Chowdhury EH, Maruyama A, Kano A, Nagaoka M, Kotaka M, Hirose S,et al. pH-sensing nano-crystals of carbonate apatite: effects on intracellulardelivery and release of DNA for efficient expression into mammalian cells.Gene 2006;376:87–94.

35. Li XJ, Ren ZJ, Tang JH. MicroRNA–34a: a potential therapeutic target inhuman cancer. Cell Death Dis 2014;5:e1327.

36. Pahl HL. Activators and target genes of Rel/NF-kappaB transcriptionfactors. Oncogene 1999;18:6853–66.

37. Yu LL, Yu HG, Yu JP, Luo HS, Xu XM, Li JH. Nuclear factor-kappaB p65(RelA) transcription factor is constitutively activated in human colorectalcarcinoma tissue. World J Gastroenterol 2004;10:3255–60.

38. Guo L, Lu Z. The fate of miRNA� strand through evolutionary analysis:implication for degradation asmerely carrier strand or potential regulatorymolecule? PLoS One 2010;5:e11387.

39. Filipowicz W, Bhattacharyya SN, Sonenberg N. Mechanisms of post-tran-scriptional regulation by microRNAs: are the answers in sight? Nat RevGenet 2008;9:102–14.

Inoue et al.





40. Yamaguchi N, Osaki M, Onuma K, Yumioka T, Iwamoto H, Sejima T, et al.Identification ofmicroRNAs involved in resistance to sunitinib in renal cellcarcinoma cells. Anticancer Res 2017;37:2985–92.

41. Zhou S, Li J, Xu H, Zhang S, Chen X, Chen W, et al. Liposomal curcuminalters chemosensitivity of breast cancer cells to Adriamycin via regulatingmicroRNA expression. Gene 2017;622:1–12.

42. Shi J, Liu H, Wang H, Kong X. MicroRNA expression signature in degen-erative aortic stenosis. Biomed Res Int 2016;2016:4682172.

43. Uematsu Y, Akai S, Tochitani T, Oda S, Yamada T, Yokoi T. MicroRNA-mediated Th2 bias in methimazole-induced acute liver injury in mice.Toxicol Appl Pharmacol 2016;307:1–9.

44. Yang G, Rosen DG, Liu G, Yang F, Guo X, Xiao X, et al. CXCR2 promotesovarian cancer growth through dysregulated cell cycle, diminished apo-ptosis, and enhanced angiogenesis. Clin Cancer Res 2010;16:3875–86.

45. Li A, Varney ML, Singh RK. Expression of interleukin 8 and its receptors inhuman colon carcinoma cells with different metastatic potentials. ClinCancer Res 2001;7:3298–304.

46. Mendoza MC, Er EE, Blenis J. The Ras-ERK and PI3K-mTOR path-ways: cross-talk and compensation. Trends Biochem Sci 2011;36:320–8.

47. Toiyama Y, Tanaka K, Inoue Y, Mohri Y, Kusunoki M. Circulating cell-free microRNAs as biomarkers for colorectal cancer. Surg Today 2016;46:13–24.

48. de Fougerolles A, Vornlocher HP, Maraganore J, Lieberman J. Interferingwith disease: a progress report on siRNA-based therapeutics. Nat Rev DrugDiscov 2007;6:443–53.

49. Ogawa H, Wu X, Kawamoto K, Nishida N, Konno M, Koseki J, et al.MicroRNAs induce epigenetic reprogramming and suppress malignantphenotypes of human colon cancer cells. PLoS One 2015;10:e0127119.

50. Tornatore L, Sandomenico A, Raimondo D, Low C, Rocci A, Tralau-Stewart C, et al. Cancer-selective targeting of the NF-kappaB survivalpathway with GADD45beta/MKK7 inhibitors. Cancer Cell 2014;26:495–508.






2018;17:977-987. Published OnlineFirst March 15, 2018.Mol Cancer Ther Akira Inoue, Tsunekazu Mizushima, Xin Wu, et al.

-Mutant Colon Cancer CellsKRASB Signaling in κTumor-Suppressive Activities via Inhibition of NF-

A miR-29b Byproduct Sequence Exhibits Potent

Updated version

10.1158/1535-7163.MCT-17-0850doi:

Access the most recent version of this article at:

Material

Supplementary

http://mct.aacrjournals.org/content/suppl/2018/03/15/1535-7163.MCT-17-0850.DC1

Access the most recent supplemental material at:

Cited articles

http://mct.aacrjournals.org/content/17/5/977.full#ref-list-1

This article cites 49 articles, 10 of which you can access for free at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mct.aacrjournals.org/content/17/5/977To request permission to re-use all or part of this article, use this link



http://mct.aacrjournals.org/lookup/doi/10.1158/1535-7163.MCT-17-0850

http://mct.aacrjournals.org/content/suppl/2018/03/15/1535-7163.MCT-17-0850.DC1

http://mct.aacrjournals.org/content/17/5/977.full#ref-list-1

http://mct.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mct.aacrjournals.org/content/17/5/977


a mir-29b byproduct sequence exhibits potent tumor … · 29b-1-5p, but not mir-29b-1-5p, possessed...

Documents