Phytochemistry 73 (2012) 23–33

Contents lists available at SciVerse ScienceDirect

Phytochemistry

journal homepage: www.elsevier .com/locate /phytochem

A folate independent role for cytosolic HPPK/DHPS upon stressin Arabidopsis thaliana

Oscar Navarrete a,1, Jeroen Van Daele b, Christophe Stove b, Willy Lambert b,Dominique Van Der Straeten a,⇑, Sergei Storozhenko a,⇑a Laboratory of Functional Plant Biology, Department of Physiology, Ghent University, K.L. Ledeganckstraat 35, B-9000 Gent, Belgiumb Laboratory of Toxicology, Department of Bioanalysis, Ghent University, Harelbekestraat 72, B-9000 Gent, Belgium

a r t i c l e i n f o

Article history:Received 10 June 2011Received in revised form 17 September2011Available online 11 October 2011

Keywords:Arabidopsis thalianaFolate biosynthesisGene characterizationStress responseFolate and pterin analysisHydroxymethyl dihydropterinPyrophosphokinase/dihydropteroatesynthase

0031-9422/$ - see front matter � 2011 Elsevier Ltd. Adoi:10.1016/j.phytochem.2011.09.008

⇑ Corresponding authors. Tel.: +32 9 264 5185; faxE-mail addresses: oscar.navarrete@ugent.be (O. N

ugent.be (J. Van Daele), christophe.stove@ugent.beugent.be (W. Lambert), dominique.vanderstraeten@ugserguei.storojenko@ugent.be (S. Storozhenko).

1 Present address: Centro de Investigaciones BiotecnSuperior Politécnica del Litoral (ESPOL), Campus GuPerimetral, Apartado 09-01-5863, Guayaquil, Ecuador.

a b s t r a c t

Cytosolic HPPK/DHPS (cytHPPK/DHPS) in Arabidopsis is a functional enzyme with activity similar to itsmitochondrial isoform. Genomic complementation of the cytHPPK/DHPS knockout mutant with the wildtype gene led to a complete rescue of the stress sensitive mutant phenotype in seed germination testsunder abiotic stress conditions. Moreover, over-expression of the gene resulted in higher germinationrate under stress as compared to the wild-type, confirming its role in stress resistance. Analysis of folatesin seedlings, inflorescence and dry seeds showed unchanged levels in the wild-type, mutant and over-expressor line, upon stress and normal conditions, suggesting a role for cytHPPK/DHPS distinct fromfolate biosynthesis and a folate-independent stress resistance mechanism. This apparently folate-inde-pendent mechanism of stress resistance points towards a possible role of pterins, since the product ofHPPK/DHPS is dihydropteroate.

� 2011 Elsevier Ltd. All rights reserved.

1. Introduction

Folates (tetrahydrofolate and its derivatives) play an importantrole as co-factors in the one-carbon transfer metabolism, whichtakes part in the DNA synthesis and the methylation cycle in allorganisms. Tetrahydrofolate is chemically composed of a pterin, ap-aminobenzoate (p-ABA) and a glutamate (or c-linked polyglut-amyl tail) moiety, constituting the main backbone of the differentfolate derivatives (Fig. 1a and b). It is synthesized de novo by plantsand most micro-organisms but not by higher animals (Appling,1991; Hanson and Roje, 2001).

Folate biosynthesis (Fig. 2) is a multi-compartment processthat takes place mainly in the mitochondria; however, pterinand p-ABA moieties are synthesized in the cytosol and plastidsfrom GTP (Basset et al., 2002; Goyer et al., 2004; Klaus et al.,

ll rights reserved.

: +32 9 264 5333.avarrete), jeroen.vandaele@(C. Stove), willy.lambert@

ent.be (D. Van Der Straeten),

ológicas del Ecuador, Escuelastavo Galindo, Km. 30.5 vía

2005) and chorismate (Basset et al., 2004a,b), respectively. Bothpterin and p-ABA must be imported in mitochondria, where the restof the tetrahydrofolate pathway (Lazar et al., 1993; Ravanel et al.,2001) resides, and are then condensed by the hydroxymethyldihy-dropterin pyrophosphokinase/dihydropteroate synthase (mitHPPK/DHPS) (Rébeillé et al., 1997). In a previous study (Storozhenkoet al., 2007b), we reported the characterization of a novel cytosolicisoform of HPPK/DHPS (cytHPPK/DHPS), which is specificallyexpressed in developing seeds and under stress. Furthermore, anal-ysis of a cytHPPK/DHPS loss-of-function mutant revealed an impor-tant role for this HPPK/DHPS isoform in survival of seeds underoxidative stress.

During the life cycle, the establishment of the next generation is acrucial event. In higher plants, this event is essentially correspondingto the phases of seed development and seed germination (Baud et al.,2002; Bewley, 1997). Under normal conditions, low levels of reactiveoxygen species (ROS) are generated in plants. For example, ROS canbe present during ovule formation (Sun et al., 2004), seed develop-ment (Finch-Savage and Leubner-Metzger, 2006; Borisiuk andRolletschek, 2009) and seed germination (Muller et al., 2009). How-ever, under stress conditions (abiotic or biotic) these compoundscan reach supra-physiological levels, which can hamper importantbiological processes (Moller et al., 2007). Plants possess severalmechanisms of defense against ROS (Mittler et al., 2004).

Fig. 1. Chemical structure of folates and pterin. (A) Pterin, p-ABA and glutamate moieties are indicated by a solid bar. Different levels of folate oxidation are represented in thetable and their positions in the molecule are indicated by R and X. (B) Pterin structure in its 7,8-dihydro and oxidized form.

24 O. Navarrete et al. / Phytochemistry 73 (2012) 23–33

In humans, folic acid has been described as potential antiox-idant due to its free radical scavenger activity against hydroxyl(OH��) and superoxide (O��) radicals (Joshi et al., 2001), perox-ynitrites and inhibition of lipid peroxidation (Nakano et al.,2001). Furthermore, this scavenging activity of folates has beencompared with other natural compounds such as vitamin C, E,B1 (thiamine), B6 (pyridoxamine), pyridoxine and pyridoxal(Gliszczynska-Swiglo, 2006, 2007); however, folate antioxidantactivity has been reported to reside in the pterin core (Rezket al., 2003). Pterins (conjugated and unconjugated) are hetero-cyclic structures, which have been described as radical scaveng-ers, reducing agents and/or compounds with radical promotingactivity in biological systems (Oettl and Reibnegger, 2002). Inplants, several studies on pterins have been conducted (Iwaiet al., 1976; Kohashi, 1980; Kohashi et al., 1980) but only re-cently have these compounds been studied more in depth aspart of the folate salvage system (Naponelli et al., 2008; Noirielet al., 2007a,b; Orsomando et al., 2006). At present, little isknown about the antioxidant activity of folates and pterins inplant systems; however, treatment of pea seeds with folic acidleads to an enhancement of seed vigor through the stimulationof a phenolic-linked antioxidant response (Burguieres et al.,2007). This might support future applications of folate bioforti-fied crops (Diaz de la Garza et al., 2007; McIntosh et al., 2008;Naqvi et al., 2009; Nunes et al., 2009; Storozhenko et al., 2007a).

In this study, we report further characterization of the Arabidop-sis cytHPPK/DHPS. The previously observed stress sensitive pheno-type of the cytHPPK/DHPS knockout mutant (Storozhenko et al.,2007b) was rescued by complementation, supporting its impor-tance in stress response. Moreover, over-expression of the genedemonstrates significant increase in the seed germination rate un-der oxidative stress conditions. Furthermore, analyses of folatesfrom different tissues infers that the stress sensitive phenotype ob-served is folate-independent but might be linked to the spectrumand/or levels of pterins in the mutant tissues.

2. Results

2.1. CytHPPK/DHPS plays a role in seed stress response in Arabidopsis

In a previous study (Storozhenko et al., 2007b), it has beenshown that seeds of the cytHPPK/DHPS loss of function mutant(LOF) had lower germination rates under abiotic stress. The muta-tion was linked to the kanamycin resistance marker on the insertedT-DNA as evidenced by 3:1 segregation after self-pollination(Fig. 4b). To further prove this linkage, two consecutive back-crosses were performed, in which the homozygous LOF plantswere crossed with wild type Col-0 plants. As expected, 3:1 segrega-tion of the kanamycin resistance marker was observed for each

Fig. 2. Simplified folate biosynthesis pathway in Arabidopsis thaliana. Intermediate compounds: GTP, guanosine 50-triphosphate; DHNTP, dihydroneopterin triphosphate;DHN, dihydroneopterin; HMDHP, hydroxymethyldihydropterin; ADC, aminodeoxychorismate; p-ABA, para-aminobenzoic acid; p-ABA-Glc, p-ABA glucose ester; HMDHP-PP,hydroxymethyldihydropterin pyrophosphate; DHP, dihydropteroate; DHF, dihydrofolate; THF, tetrahydrofolate and THF-Glun, tetrahydrofolate polyglutamate. Enzymes:GTPCHI, GTP cyclohydrolase I; NUDIX1, DHNTP pyrophosphatase; DHNA, Dihydroneopterin aldolase; ADCS, Aminodeoxychorismate synthase; ADCL, Aminodeoxychorismatelyase; pAGT, p-ABA acyl-glucosyltransferase; HPPK, 6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase; DHPS, 7,8-dihydropteroate synthase; DHFS, dihydrofolatesynthase; DHFR, dihydrofolate reductase and FPGS, folylpolyglutamate synthase.

O. Navarrete et al. / Phytochemistry 73 (2012) 23–33 25

backcross in its F2 seed population. Several homozygous kanamy-cin resistant LOF plants (MBC2) were picked up after the secondbackcross and analyzed in comparison with wild type plants(WBC2) segregating in the cross. Since a previous study(Storozhenko, et al., 2007a,b) demonstrated that the most pro-nounced effect on the germination rate of LOF was observed uponH2O2 treatment, the same type of treatment was used for furthertesting of the backcross progeny. A germination rate test on H2O2

(Fig. 3) showed that all MBC2 individuals had reduced germinationrates as compared to the WBC2 lines under abiotic stress conditions.These results demonstrate that the observed phenotype of LOF islinked to the insertion and most likely the result of a cytHPPK/DHPS knock-out by the inserted T-DNA.

To further support this link in a direct way, phenotypic comple-mentation of LOF plants was obtained by transformation with afragment of Arabidopsis genomic DNA containing the cytHPPK/DHPS gene with its promoter (1.2 kb 50 upstream region). Homozy-gous transgenic lines (gC1-6) demonstrated complete mutant phe-notype rescue in the seed germination tests on a mediumsupplemented with 10 mM H2O2 (data not shown). Thus, highersensitivity of the cytHPPK/DHPS LOF mutant to stress imposed byH2O2 is a consequence of loss of function of the correspondinggene.

In order to gain further insight into the function of cytHPPK/DHPS, Arabidopsis transgenic lines over-expressing cytHPPK/DHPSwere created. To that end, both WT and LOF mutant plants weretransformed with a construct containing cytHPPK/DHPS cDNAunder the control of the 35S CaMV promoter and homozygous T3

transgenic plants were selected using selectable marker segrega-tion analysis (designated OEW and OEM as over-expression inwild-type and in LOF mutant background, respectively). Resultsfor one over-expressor line are shown (OEW4); similar results

were obtained with the other OEW lines. PCR amplification ofgenomic DNA from the transformed lines using T-DNA specificprimers confirmed the transgene integration (Fig. 4b and c).

Expression analysis (Fig. 4a) of the transformed lines demon-strated that the RT-PCR amplification signal of the cytHPPK mRNAwas of considerably higher intensity than that of the endogenouscytHPPK/DHPS amplification confirming the over-expression inall transformed lines. As expected, the over-expression of the cDNAfully rescued the LOF mutant in the seed germination tests on amedium supplemented with 10 mM H2O2. Furthermore, besidesthe rescue of the mutant phenotype, a higher germination rate ofseeds of the cytHPPK/DHPS over-expressing lines both in the mu-tant and wild type backgrounds was observed as compared tothe wild type seeds (Fig. 5). Thus, cytHPPK/DHPS over-expressionrenders seeds more tolerant to oxidative stress imposed by H2O2,confirming a role of the gene in stress resistance.

Previously, induction of cytHPPK/DHPS gene by salt stress wasobserved in seedlings (Storozhenko et al., 2007b). To investigatewhether the cytHPPK/DHPS gene expression is also induced byH2O2 in germinating seeds, expression analysis was carried outon seeds germinating under stress conditions at different timepoints. Expression (Fig. 6) of the cytHPPK/DHPS was induced dur-ing imbibition and after 30 h of germination on a medium with10 mM H2O2 in the wild-type seeds as compared with theuntreated control. On the other hand, expression of its mitochon-drial counterpart remained unchanged in the treated anduntreated samples confirming that the role in stress response isspecific to the cytosolic isoform.

To test whether cytHPPK/DHPS can also enhance resistance ofseedlings to other types of oxidative stress, the reaction to saltstress was investigated (Fig. 7). Survival of Arabidopsis LOF seed-lings after 4 days of 150 mM NaCl application was similar to the

Fig. 3. Backcross analysis of Col-0 � LOF seeds on media supplemented with10 mM H2O2. Homozygous mutant (MBC2) and Col-0 (WBC2) seeds from the secondbackcross segregation were germinated in the presence of 10 mM H2O2. Seedgermination was scored by the radicle emergence at different time points. Valuesare means of measurements of 11 different LOF homozygous mutant individuals(MBC2) and two different controls Col-0 (WBC2) from the backcross segregation.Error bars represent standard deviations.

26 O. Navarrete et al. / Phytochemistry 73 (2012) 23–33

wild type. However, the OEW seedlings demonstrated a slight butsignificant increase in survival rate as compared to the wild typeand LOF. Therefore, over-expression of cytHPPK/DHPS, besidesenhancing germination under oxidative stress imposed by H2O2,also contributes to the survival of seedlings under salt stress.

Sulfanilamide (SNL) is a known folate inhibitor, which inhibitsDHPS in a competitive manner with p-ABA (Huovinen, 2001).Over-expression of DHFR (Coderre et al., 1983) enhances insensi-tivity to DHFR inhibitors such as trimethoprim or methotrexate;likewise, insensitivity to SNL has been reported by over-expressinggenes for p-ABA synthesis in yeast (Edman et al., 1993). Thus, over-expression of cytHPPK/DHPS in Arabidopsis might also result ininsensitivity to SNL. We investigated whether over-expression ofcytHPPK/DHPS could enhance resistance against sulfanilamideduring germination or/and seedling development for up to2-weeks after germination. All lines analyzed germinated and pro-duced primary leaves (Fig. S1) on SNL concentrations of up to100 lM. Interestingly, after two weeks on 60 lM SNL, the OEWshowed growth arrest at the cotyledon stage with a slight reduc-tion in size; on the other hand, Col-0 and LOF did produce primaryleaves without significant differences in size. At concentrationsbeyond 100 lM, none of the genotypes produced primary leaves,and there were no significant differences in germination or cotyle-don size (data not shown). We conclude that over-expression ofcytHPPK/DHPS did not promote resistance to SNL; however,over-expression of cytHPPK/DHPS in combination with SNL treat-ment resulted in an inhibitory effect on seedling development, sug-gesting an increased sensitivity to the antifolate.

2.2. CytHPPK/DHPS-mediated stress resistance is folate independent

A previous report (Burguieres et al., 2007) has described the in-crease in pea seed vigor after treatment with folic acid. To investi-gate whether the observed alteration in tolerance to oxidativestress is folate-dependent and whether over-expression or knockout of cytHPPK/DHPS leads to changes in folate levels, determina-tion of folate content in different tissues of the WT, OE and LOFmutant lines was performed. Analysis of total folates (Fig. S8) inwhole seedlings, young siliques and dry seeds of plants grown un-der normal conditions did not show any significant difference,implying that changes in cytHPPK/DHPS expression did not leadto changes in folate levels under normal growth conditions. There-fore, further analysis was focused on folate level determinations ingerminating seeds under oxidative stress conditions, a situation

wherein the phenotypic changes has been observed. As expected,folate levels (Fig. 8) were the same at 0 h time point in WT, OEWand LOF mutant lines. After 30 h of germination folate content in-creased in all three samples due to activation of the folate biosyn-thesis pathway. However, increase of folate content in seedstreated with H2O2 was pronouncedly lower as compared to thenon-treated seeds. Further incubation (48 h) led to a further in-crease in folate content in the WT and LOF seeds but, not incytHPPK/DHPS over-expressing seeds. These results demonstratethe absence of a correlation between the folate levels and toleranceto oxidative stress. Moreover, the results also imply that, underthese conditions, cytHPPK/DHPS over-expression leads to a de-crease in folate levels. This phenomenon might be explained bythe fact that the enzyme is localized in the cytosol and, thus,may not participate in folate biosynthesis directly. Rather mightthe cytosolic enzyme compete with its mitochondrial counterpartfor the substrate hydroxymethyldihydropterin, and the productdihydropteroate or putative pterin derivatives thereof might beused for a purpose distinct from folate biosynthesis, leading tohigher tolerance against oxidative stress. The analysis of total p-ABA (free and esterified) in germinating seeds after 48 h did notshow significant differences in the lines analyzed (data not shown).However, free p-ABA levels were below the level of detection, sug-gesting that the pool of free p-ABA is relatively low in germinatingseeds and nearly all free p-ABA is immediately used. To checkwhether pterins could be involved in the observed altered stressresponse, analysis of pterins in seedlings under salt stress of theWT, LOF and OEW plants has been carried out. Seedlings from allthe lines analyzed contained similar levels of pterins at the controlpoint (0 h); however, after 4 h of salt stress all the lines show a sig-nificant decrease in pterin content (Table 1). Interestingly, themain difference in pterin pools after 4 h of stress treatment wasobserved in xanthopterin, which was reduced in all samples ana-lyzed, except from line OEW4 where the pterin variation was highin some pterins. In conclusion, no differences in free pterin poolwere observed between any of the genotypes.

3. Discussion

Until now, the biological function of the Arabidopsis cytHPPK/DHPS remains enigmatic and a unique feature in land plants. Itlikely comes from an early duplication event approximately65–100 Mys (million-years) ago (Bowers et al., 2003). A similarevolutionary event is found for the Arabidopsis xanthine dehydro-genase (XDH) gene (Hesberg et al., 2004). Previous findings(Storozhenko et al., 2007b) show a low overlap in expression pat-tern between the mitochondrial and cytosolic HPPK/DHPS iso-forms, which is consistent with the neofunctionalization model(He and Zhang, 2005; Johnson and Thomas, 2007). In spite of highsimilarity of both isoforms (87%), the cytHPPK/DHPS cannot beviewed as a functional compensator of the mitochondrial enzyme(Hanada et al., 2009). Analysis of the Arabidopsis thaliana predeces-sor Arabidopsis lyrata with around 5 Mys of divergence (Koch et al.,2000), demonstrates that both genes are conserved with high sim-ilarity; 90.9% and 90.6% for the mitHPPK/DHPS and cytHPPK/DHPS,respectively. Furthermore, the cytosolic isoform is also expressedin other ecotypes as in Columbia. Thus, we propose that an asym-metric divergence between duplicates led to a neofunctionaliza-tion event by functional divergence of the isoforms and furtherspecialization of the cytHPPK/DHPS as evolution progressed.

Several lines of evidence confirm the idea that cytHPPK/DHPSdoes not participate in folate biosynthesis but is involved inanother function. Firstly, cytHPPK/DHPS has a different intracellu-lar localization, which in case of involvement in folate biosynthe-sis, would require transport of its product, dihydropteroate, into

Fig. 4. Analysis of transgenic lines over-expressing cytHPPK/DHPS generated in this study. (a) Semi-quantitative RT-PCR analysis of homozygous transgenic lines over-expressing cytHPPK/DHPS in Col-0 and in LOF background. Two-week old seedlings were used for RT-PCR amplification of the cytHPPK/DHPS mRNA and the Ubiquitin-5(UBI5) gene to control whether equal amounts of cDNA were used for amplification. (b) Schematic representation of the cytHPPK/DHPS gene on chromosome 1. Arrowsindicate gene orientation and triangle depicts the T-DNA insertion in the LOF mutant. (c) Constructs used for the genomic complementation (gC) and over-expression (OE) ofcytHPPK/DHPS. PCR amplification using specific primers for each construct was done using DNA from two week-old seedlings to confirm the T-DNA integration. LB: T-DNAleft border; RB: T-DNA right border; hyg: hygromycin resistance gene; prom: cytHPPK promoter region; 35S: cauliflower mosaic virus promoter. Dotted-arrows: primerslocation in the vector.

O. Navarrete et al. / Phytochemistry 73 (2012) 23–33 27

mitochondria. While condensation of the p-ABA moiety with pterincan take place in the cytosol, its availability as free moiety (Orso-mando et al., 2006) under normal physiological conditions is likelyto be regulated, suggesting a poor dihydropteroate formation inthe cytosol, if any, before the pterin moiety is oxidized (Eudeset al., 2008; Orsomando et al., 2006).

Secondly, the inability to isolate LOF mutants of the mitochon-drial enzyme from the SALK collection and the fact that the inhibi-tion of the DHPS activity by sulfanilamide could not be rescued inthe cytHPPK/DHPS over-expressing lines indirectly support thisidea. Indeed, enhanced expression of the DHPS gene has beenreported to hinder the inhibitory effects of SNL in the presence ofhigh p-ABA levels (7.3 lM) in yeast (Iliades et al., 2003; Perretenand Boerlin, 2003). In plants, low concentrations of cytosolic freep-ABA (<45 lM), though still higher than in yeast, have beenreported in vivo (Eudes et al., 2008). Conjugation of p-ABA limitsits free state in plants which is not the case in yeast or E. coli

(Quinlivan et al., 2003). On the other hand, in yeast, it has beenreported that over-expression of DHPS in the presence of SNL andlow levels of p-ABA results in growth arrest. A similar situationoccurs in cytHPPK/DHPS OEW plants, where the increasing supple-mentation of SNL results in a developmental arrest phenotype(Fig. S1). This might be related to the condensation of SNL and dihy-dropteroate, forming an adduct (SNL–DHP) that could compete withdihydrofolate, thus enhancing the folate starvation effect asreported in yeast (Iliades et al., 2003; Patel et al., 2003).

Thirdly, in silico analysis of the expression profiles of microarraydata (Zimmermann et al., 2004) confirms expression differencesbetween the mitochondrial and the cytosolic isoform (Fig. S2), lim-iting the latter to the early seed development stages, whereas themitochondrial enzyme is ubiquitously expressed. Prevalence ofthe cytosolic isoform during early seed development reinforcesthe idea of functional divergence (Fig. S3). Similarly, a number ofabiotic stress conditions (light intensity, temperature, mineral

Fig. 5. Seed germination of cytHPPK/DHPS over-expressor lines on media supplemented with 10 mM H2O2. Homozygous cytHPPK/DHPS over-expressor lines in Col-0 (OEW)and LOF (OEM) background were germinated on media supplemented with 10 mM H2O2. Germination rate was scored by radical emergence at different time points. Threeindependent biological repeats were performed and a representative experiment is shown. Asterisks mark the datasets showing statistical significance (p < 0.05) in aStudent’s T-test between the OE and the WT.

Fig. 6. Semi quantitative RT-PCR analysis of germinating seeds from Col-0, cytHPPK LOF and cytHPPK over-expressor (OEW) lines on control medium supplemented with10 mM H2O2. Seeds were collected at different time points during imbibition (1, 2 and 3 days) and germination (30 and 48 h after radicle emergence). Total RNA isolated fromthe samples was used for RT-PCR amplification of cytHPPK/DHPS, mitHPPK/DHPS and Actin-7 to control whether equal amounts of cDNA were used for amplification. Threeindependent biological repeats were performed and a representative gel is shown. Mock: control treatment medium without H2O2, IMB: Imbibition and GER: germination.

28 O. Navarrete et al. / Phytochemistry 73 (2012) 23–33

deficiency, drought stress, oxygen deficiency, etc.) induce cytHPPK/DHPS but not the mitochondrial enzyme (Fig. S4). Interestingly,none of the folate biosynthesis genes was induced by any of thestress conditions covered by the microarray experiments (notshown), strengthening the idea of certain specialized functions ofthe cytosolic enzyme during seed development and under stressconditions. The special seed-related function is further emphasizedby up-regulation of the gene in Arabidopsis seed or flower develop-ment mutants, particularly in lec1 and agl29, respectively (Fig. S4).In silico analysis of the 50 upstream sequence of cytHPPK/DHPSgene has revealed the presence of potential transcription factorsbinding sites (TFBS) (Steffens et al., 2004) related to seed develop-ment, such as homeobox DNA-binding (ZmHOX2) and agamous-like (AGL15) recognition sites (Fig. S5); which are not found inthe mitochondrial isoform gene sequence. Instead, the mitHPPK/

DHPS promoter contains potential TFBS for AGL1 and AGL2, whichare specific for floral tissue development and AGL3, operating invegetative organs, making this isoform more ubiquitous.

Seed-specific expression and induction by abiotic stress, as wellas improved stress tolerance of seeds upon over-expression ofcytHPPK/DHPS, suggests its role in stress protection during earlystages of seed development. It is known that levels of oxygen varyconsiderably during seed development (Borisjuk and Rolletschek,2009; Kuang et al., 1998). Moreover, oxygen deprivation (hypoxia)causes oxidative stress due to the formation of reactive oxygenspecies (ROS) (Bailly et al., 2008; Borisjuk and Rolletschek, 2009).During seed development, the oxygen status varies depending onthe light supply in green embryos, and reaches its lowest levelsat night, generating a hypoxic environment inside the developingseed (Borisjuk and Rolletschek, 2009; Rolletschek et al., 2002).

Fig. 7. Survival of Arabidopsis seedlings upon salt stress treatment in Col-0, LOF and OEW lines. Two-week old seedlings were transferred to ½ MS plates supplemented with150 mM NaCl. Seedling survival was scored after a 5-day treatment based on the appearance of the apical shoot meristem. Green meristem was considered as ‘‘surviving’’,necrotic as ‘‘stressed’’ and chlorotic as ‘‘dead’’ seedling. Three independent biological repeats were carried out, representative results are shown. Asterisk marks in the datasetindicate a significant difference (p < 0.05) in a Student’s T-test between the OEW and the WT.

Fig. 8. Total folate analysis of Col-0, LOF and OEW in germinating seeds on media supplemented with 10 mM H2O2. Germinating seeds were collected at different time points(0, 30 and 48 h), frozen and ground for folate determination. Values are means of three technical repeats. Error bars represent standard deviations. Three independentbiological repeats were performed and a representative graph is shown. Asterisk marks in the dataset indicate that a significant difference (p < 0.05) in Student’s T-testbetween the Col-0 and the over-expressor line is present.

O. Navarrete et al. / Phytochemistry 73 (2012) 23–33 29

Oxygen diffusion takes place at the funiculus scar, micropylar andchalazal areas, and its concentration reaches the lowest levels inthe endospermal liquid and the embryo (Borisjuk and Rolletschek,2009). Specific expression of the cytHPPK/DHPS during seed devel-opment suggests a relationship between ROS production during

hypoxia and singlet oxygen scavenger activity of the HPPK/DHPSproduct (dihydropteroate). Indeed, the absence of the glutamicmoiety attached to the p-ABA residue, which is present in conju-gated pterins such as folic acid, negatively affects quenching effi-ciency of singlet oxygen (Darmanyan et al., 1998). Moreover,

Table 1Analysis of pterins in Arabidopsis Col-0, LOF and over-expressor seedlings upon salt stress treatment.a

Pterinsb Col-0 LOF OEW1 OEW4 OEW6

0 hNPT 5.57 ± 0.46 5.63 ± 0.14 5.97 ± 0.72 5.82 ± 0.96 6.51 ± 0.49HMP 1.59 ± 0.43 2.10 ± 0.64 1.39 ± 0.33 1.84 ± 0.21 1.79 ± 0.22XP 16.81 ± 2.76 19.66 ± 2.28 13.99 ± 6.07 16.56 ± 6.66 16.63 ± 2.856-Cap 7.17 ± 0.98 7.74 ± 1.39 8.06 ± 1.29 13.55 ± 2.35 10.70 ± 1.70Total 31.15 ± 1.62 35.13 ± 1.37 29.43 ± 7.92 37.78 ± 9.86 35.65 ± 2.56

4 hNPT 5.97 ± 1.16 5.72 ± 1.08 7.24 ± 0.51 3.58 ± 3.26 5.73 ± 0.50HMP 1.75 ± 0.36 1.49 ± 0.19 2.08 ± 0.23 1.04 ± 0.92 2.45 ± 0.57XP 21.59 ± 6.14 16.07 ± 7.75 17.97 ± 1.14 20.04 ± 11.26 10.92 ± 5.206-Cap 8.36 ± 1.38 6.75 ± 1.99 8.28 ± 1.09 8.11 ± 4.08 6.78 ± 1.08Total 37.68 ± 6.55 30.05 ± 9.12 35.58 ± 0.22 32.79 ± 8.37 25.89 ± 4.66

4h + NaNPT 4.95 ± 0.53 5.41 ± 0.34 4.77 ± 1.05 6.44 ± 0.84 4.99 ± 0.30HMP 1.42 ± 0.18 1.22 ± 0.24 1.37 ± 0.14 1.90 ± 0.33 1.44 ± 0.00XP 5.76 ± 3.86 6.82 ± 0.70 8.44 ± 1.18 21.57 ± 2.02 7.01 ± 0.006-Cap 5.43 ± 1.88 7.79 ± 0.53 6.97 ± 1.25 17.85 ± 1.51 7.35 ± 0.73Total 17.59 ± 6.16 21.25 ± 0.13 21.56 ± 1.36 47.78 ± 4.66 20.80 ± 1.02

a Results from two independent biological repeats. Standard deviation values (±) of three technical repeats are indicated and bold values represent significant differences(p < 0.05).

b Pterins: NPT, neopterin; HMP, hydroxymethylpterin; XPT, xanthopterin and 6-cap, 6-carboxylpterin.

30 O. Navarrete et al. / Phytochemistry 73 (2012) 23–33

unconjugated pterins such as hydroxymethylpterin show even lessquenching activity due to the absence of the p-ABA moiety (Cabrer-izo et al., 2007).Thus, the idea of cytHPPK/DHPS involvement inhypoxia-oxidative stress related protection is corroborated by thefact that its expression is abolished (Day et al., 2008; Spenceret al., 2007) upon greening of the embryo after the transition stage(late globular stage, 4-5 DAP), when photosynthesis starts to takeplace (de Folter et al., 2004). Moreover, microarray data confirminduction of cytHPPK/DHPS during dark and hypoxia treatments,physiological conditions which are met during early seed develop-ment (Zimmermann et al., 2004). Based on these observations, alikely relationship between hypoxia, ROS and the scavengingaction of cytHPPK/DHPS products during early seed developmentcan be suggested.

Research in humans has classified pterins as ROS scavengingagents (Oettl and Reibnegger, 2002). Analysis of pterins in Arabid-opsis seedlings under stress conditions revealed a significantdecrease in total pterin amount, especially in xanthopterin (Table1). Little is known about the role of pterins in plants besides beingintermediates of the folate biosynthesis and recycling (Noirielet al., 2007a,b; Orsomando et al., 2006). Studies in other organismshave pointed out the role of pterins as potential radical scavengersand stress markers (Murr et al., 2002). Our data suggest that duringearly seed development and seed germination under oxidativestress the product (dihydropteroate) of cytHPPK/DHPS might bemainly used as scavenger agent and not for folate biosynthesis.This idea can be reinforced by in vitro studies demonstrating a highquenching activity of pteroic acid as a singlet oxygen scavenger(Cabrerizo et al., 2007). Others reported efficient superoxide radi-cal and singlet oxygen scavenging activity for pterin-6-aldehyde(6-FPT, 6-formylpterin), pterin-6-carboxylic acid (6-carboxylpter-in) and neopterin (Mori et al., 2010; Watanabe et al., 1997). Thus,cytosolic dihydropteroate in Arabidopsis might have two functionsin a specific window during seed development and/or upon stress(Fig. S7a): first, as a singlet oxygen scavenger and second, as a pre-cursor of 6-FPT (Cabrerizo et al., 2007), which also has a scavengercapacity. However, gaining a full insight in dihydropteroate func-tion is extremely challenging: like other pterins it is a very unsta-ble compound, which has practically not been studied in plants. Inanimals, where the HPPK/DHPS enzyme is absent and DHP is pro-duced as a result of folic acid oxidation, limited studies are avail-able (Temple, et al., 1981; Bartels and Bock, 1994). Thus, to fullyunderstand its role and metabolism, a reliable DHP detection in

plants will have to be developed. Furthermore, most of these stressevents occur during developmental stages when photosynthesishas not started yet. This suggests that pterins are better scavengersin non-green tissues where photo-oxidation is negligible, as com-pared with photosynthetic tissues (Stakhov et al., 2002, 2005).On the other hand, 6-FPT has been reported to generate ROS; nev-ertheless, this mechanism does not operate in the dark (Nonogawaet al., 2008, 2007). Furthermore, accumulation of pterins appar-ently does not affect normal development in plants as has beenshown in engineered plants with high folate content (Storozhenkoet al., 2007a). Treatment of pea seeds with folic acid has beenshown to improve germination rate (Burguieres et al., 2007). Anal-ysis of folate levels from all the lines used in this study showed nocorrelation between folate levels or composition and stress resis-tance. Moreover, no significant differences in folate levels in differ-ent tissues of all analyzed lines were observed, except for reducedfolate levels in germinating seeds of the OE lines. Lowering folatelevels in germinating OE seeds might be explained by a potentialcompetition of the cytHPPK/DHPS with its mitochondrial counter-part for the pterin and p-ABA substrates during the transition fromthe non-photosynthetic embryonic state to the vegetative (photo-synthetically active) state upon germination (Jabrin et al., 2003).However, analysis of total p-ABA levels (free and esterified) didnot reveal significant differences between germinating seeds ofthe WT, and LOF or OE lines. Moreover, free p-ABA was undetect-able under our conditions. Previous studies have shown that thepool of free p-ABA is conjugated as a glucose ester and sequesteredfrom the cytosol to the vacuoles (Quinlivan et al., 2003; Eudeset al., 2008), leaving a small pool of functional p-ABA moietiesreadily used for folate biosynthesis. Thus, it can be assumed thatin the OE lines, the cytosolic free p-ABA pool might be depletedand that the vacuolar p-ABA pool cannot compensate for the deficitof cytosolic p-ABA. On the other hand, dihydroneopterin can be thelimiting substrate, lowering the folate levels in the OE line. A majorproblem of pterin analysis in plants is the lack of technical sensitiv-ity and extreme instability of pterins due to oxidation, which ham-pers detection of the complete pterin spectrum and quantificationof their physiological fluxes (Fig. S6).

The likely link between pterins and stress resistance in plantsdiscovered in this work opens the door to further research on thefunctions of pterins in plants. Xanthine dehydrogenase (XDH) hasbeen reported in plants to produce superoxide anions, involvedin stress as ROS generator (Blokhina and Fagerstedt, 2010; Hesberg

O. Navarrete et al. / Phytochemistry 73 (2012) 23–33 31

et al., 2004; Zarepour et al., 2010), while in animals it can utilizexanthopterin for the production of leucopterin (Blau et al., 1996),which has been described as a good scavenger (Martínez andBarbosa, 2010; Rezk et al., 2003) (Fig. S7b). However, there areno reports of leucopterin in plants, yet. Recently, it has been re-ported that the interaction of pterins with metal ions (e.g. Zn andCu) can increase pterin scavenger capacity, with the metal ionsserving as an electron acceptor (Martinez and Vargas, 2010). Accu-mulation of Zn and Cu have been reported to occur in the funicularregion, where radicle emergence takes place (Young et al., 2007).

4. Concluding remarks

In this study, the exact function of cytHPPK/DHPS remainsunclear, however, there are strong indications that this HPPK/DHPSenzyme isoform has acquired a new function in course of the evo-lution, which is distinct from folate biosynthesis. This functionmight be specific to the female gametophyte and early stages ofseed development in response to oxidative stress, with a possiblescavenger activity modulating the action of ROS species at thisdevelopmental stage in Arabidopsis. This leaves the door open forfuture research on pterins in the role of stress response, especially,dihydropteroate.

5. Experimental

5.1. Plant material and bacterial strains

For all molecular cloning experiments E. coli DH-5a strain wasused. Agrobacterium tumefaciens strain LBA4404 was used fordelivery of T-DNA into plant cells. CytHPPK/DHPS loss-of-function(LOF) mutant (SALK_093782) (Storozhenko et al., 2007b) and alltransgenic Arabidopsis plants were in A. thaliana cv. Columbia-0(Col-0) background. Plants were grown on jiffy pellets (Jiffy prod-ucts international; Moerdijk, Netherland) under long-day condi-tions (16-h light/8-h dark) at 20 �C.

5.2. Molecular cloning

Gateway™ technology (Invitrogen) was used to generate all theconstructs. For over-expression of cytHPPK-DHPS in Arabidopsis,first, the corresponding full length cDNA was amplified using Plati-num Pfx DNA polymerase (Invitrogen) with specific primers STOSER54 (50AAAAAGCAGGCTCTAAAAATGGATTTCACATCTTTGGAA30) –STOSER 55 (50AGAAAGCTGGGTACTAATCAACATTTTTGAACCTTTT-CG30) and then re-amplified with attB adaptor primers (Invitrogen).This fragment was recombined with pDONR201 vector (Invitrogen)by BP reaction to produce an entry clone, which was, in turn,recombined by LR reaction with the pH7WG2 (Karimi et al.,2002) binary plant transformation vector containing thecauliflower mosaic virus 35S promoter to drive cDNA expression.For rescue of the LOF mutant, the cytHPPK/DHPS gene together withits own promoter was amplified using genomic DNA as templatewith specific primers STOSER 77 (50AAAAAGCAGGCTGCAAAGGGA-CCTGGGGAATG30) – STOSER 106 (50AGAAAGCTGGGTCTCATGTTTG-TTTTGTGTAG30). As above, the fragment was re-amplified with attBadaptor primers, recombined with pDONR201 and further insertedinto a promoter-less pHGW (Karimi et al., 2002) binary vector.

5.3. Plant transformation

Arabidopsis transformation was carried out using the ‘‘floral dip’’method (Clough and Bent, 1998). Vectors were introduced byelectroporation (Gene Pulser Xcell, Bio-Rad) into A. tumefaciensfollowing the manufacturer’s protocol which was used for the

T-DNA delivery into plant cells. Transgenic plants were selected onMurashige and Skoog (MS) solid media containing 50 mg L�1 hygro-mycin (Hyg) and later transferred to soil for seed production. Singlecopy transformation events were selected in T2 generation by 3:1segregation of the resistance marker and corresponding homozy-gous plants were selected in T3. Homozygous T3 seeds were usedthroughout this study. Transgene integration into the Arabidopsisgenome was confirmed by PCR amplification of different T-DNA seg-ments with REDTaq� DNA polymerase (Sigma-Aldrich), using geno-mic DNA isolated from homozygous seedlings and specific primers.Forward primers were located in the hygromycin resistance gene(Hyg-F: 50CAAAGTGCCGATAAACATAACGATCTTTGT30), and in theHPPK/DHPS promoter region (pHPPKR: 50TCACTAGCTTTAAAGAAG-AAAAATGAGCCG30), respectively. The reversed primer used withboth forward primers was located in the HPPK/DHPS coding region(STOSER 18: 50 TGGGAAGCAATGTTGGAAACAGA30).

5.4. Backcross analysis

Backcross (BC) lines were generated by crossing Col-0 andcytHPPK LOF. Segregation of the kanamycin (Km) resistance markerwas used to score 3:1 events in the F2 seed population. Resistantplants were selfed for seed production and selection of homozygousindividuals was done in medium supplemented with 50 mg L�1 kana-mycin. A second backcross (BC2) round was generated using homozy-gous LOF (MBC) and wild-type (WBC) plants from the first backcrosssegregation. The generation of homozygous LOF (MBC2) and wild type(WBC2) individuals was performed as described above. Phenotypicanalysis was performed using second backcross individuals MBC2

and WBC2 by germination on ½ MS agar medium with 10 mMH2O2 as described in a previous study (Storozhenko et al., 2007b).

5.5. LC-MS/MS determination of folates, p-ABA and pterins

Determination of folates and pterins was essentially performedas described before (De Brouwer et al., 2010; De Brouwer et al.,2008; De Brouwer et al., 2007; Storozhenko et al., 2007a), with somemodifications. Briefly, extraction of 50 mg of plant material for folateanalysis, including deconjugation, 50 mg of plant material for p-ABAanalysis (including acid hydrolysis) and 150 mg of plant material forpterin analysis, the resulting extracts were subjected to separationusing UPLC™ (for folates and pterins) or HPLC (for p-ABA), followedby tandem mass spectrometric detection on an Applied BiosystemsAPI4000 (Foster City, CA, USA), using electrospray ionization. For fo-lates, the final quantitative data reflect the sum of six differentfolate monoglutamates: 5-Methyltetrahydrofolate (5-MTHF), 10-formylfolic acid (10-CHOFA) and 5,10-methenyltetrahydrofolate(5,10-CH+THF), folic acid (FA), tetrahydrofolate (THF) and 5-formyltetrahydrofolate (5-CHOTHF). A detailed description of theanalytical procedures can be found in the supplementary Data.

5.6. Stress treatments

Arabidopsis seeds of Col-0, LOF and OE lines were sterilized withchlorine gas (50 ml commercial bleach + 1.5 ml HCl) in a desiccatorfor 3 h. For germination, seeds were plated on ½ MS agar mediumand stratified at 4 �C for 3 days. Then, the seeds were transferred toa growth chamber for germination and growth at 20 �C and 16 hlight/8 h darkness regime. For the germination rate assay, 100seeds were scored for radicle emergence at different time intervals.Abiotic stress (oxidative stress) treatment was done by adding10 mM H2O2 to the plates with the germinating seeds. For the geneexpression analysis and determination of folate content, seedswere germinated on miracloth tissue placed on top of the agar.Samples were collected with a spatula, frozen in liquid nitrogenand stored at �80 �C until the analysis.

32 O. Navarrete et al. / Phytochemistry 73 (2012) 23–33

Salt stress treatments were done on 2-week old seedlings aspreviously described (Storozhenko et al., 2007b). Samples were ta-ken at 0 and at 4 h, then frozen in liquid nitrogen and stored at�80 �C until analysis. For the survival test, 2-week old seedlingswere transferred to plates with 150 mM NaCl and scored after5 days. Seedlings were scored as survivors or non-survivors bythe appearance of their shoot apical meristem, green or necrotic,respectively.

5.7. Sulfanilamide survival test

Sulfanilamide survival test was done by germinating seeds on ½MS agar medium with several concentrations of sulfanilamide (20,40, 60, 80, 100, 120 and 140 lM). Seedlings were scored after2 weeks by measuring length of cotyledons and first leaves. Mea-surements were performed using ImageJ software (Abramoffet al., 2004).

5.8. Expression analysis

For the gene expression analysis, reverse transcription PCR (RT-PCR) method was used. Initially, samples were frozen in liquidnitrogen, ground in a ball mill (Retsch GmbH) for 30 s at 30 Hzand total RNA was isolated using the RNeasy plant mini kit(Qiagen). First strand cDNA was synthesized with the VersoTMcDNA kit (Thermo scientific) and used as a template for RT-PCR.Gene amplification was carried out with JumpStart� REDTaq�

DNA polymerase (Sigma–Aldrich) using specific primers for the fol-lowing genes: cytHPPK/DHPS (STOSER18: 50TGGGAAGCAAT-GTTGGAAACAGA30 – STOSER19: 50CTGGAATCCCAGAGAGTTCTTGCT30),mitHPPK/DHPS (STOSER20: 50ATTTCAGAGAGGCTTTGCGATTG30 –STOSER21: 50GGATCTCCTCTCATGTGCATGGC30) and the house-keeping genes Ubiquitin5 (UBI5F: 50AGGGCGGATACTGAGGAAAT30

– UBI5R: 50GTTTACCGGCGATTGCAACA30) and Actin7 (ACT7-F:50GTCTGTGACAATGGAACTGGAATGGTGA30 – ACT7-R: 50CAAGACGAAG-GATAGCATGAGGAAGAGC30).

Acknowledgments

This work was supported by Ghent University – BijzonderOnderzoeksfonds (projects BOF2004/GOA/012 and BOF2009/G0A/004 granted to DVDS and WL).

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.phytochem.2011.09.008.

References

Abramoff, M.D., Magelhaes, P.J., Ram, S.J., 2004. Image Processing with ImageJ.Biophotonics Int. 11, 36–42.

Appling, D., 1991. Compartmentation of folate-mediated one-carbon metabolism ineukaryotes. FASEB J. 5, 2645–2651.

Bailly, C., El-Maarouf-Bouteau, H., Corbineau, F., 2008. From intracellular signalingnetworks to cell death: the dual role of reactive oxygen species in seedphysiology. C.R. Biol. 331, 806–814.

Bartels, R., Bock, L., 1994. Determination of pteroic acid by high-performance thin-layer chromatography: Contribution to the investigation of 7,8-dihydropteroatesynthase. J. Chromatogr. A. 659, 185–189.

Basset, G., Quinlivan, E.P., Ziemak, M.J., Diaz de la Garza, R., Fischer, M., Schiffmann,S., Bacher, A., Gregory III, J.F., Hanson, A.D., 2002. Folate synthesis in plants: Thefirst step of the pterin branch is mediated by a unique bimodular GTPcyclohydrolase I. Proc. Nat. Acad. Sci. USA 99, 12489–12494.

Basset, G., Quinlivan, E.P., Ravanel, S., Rebeille, F., Nichols, B.P., Shinozaki, K., Seki,M., Adams-Phillips, L.C., Giovannoni, J.J., Gregory III, J.F., Hanson, A.D., 2004a.Folate synthesis in plants: The p-aminobenzoate branch is initiated by abifunctional PabA-PabB protein that is targeted to plastids. Proc. Nat. Acad. Sci.USA 101, 1496–1501.

Basset, G., Ravanel, S., Quinlivan, E.P., White, R., Giovannoni, J.J., Rebeille, F., Nichols,B.P., Shinozaki, K., Seki, M., Gregory, J.F., Hanson, A.D., 2004b. Folate synthesis inplants: the last step of the p-aminobenzoate branch is catalyzed by a plastidialaminodeoxychorismate lyase. Plant J 40, 453–461.

Baud, S., Boutin, J.-P., Miquel, M., Lepiniec, L., Rochat, C., 2002. An integratedoverview of seed development in Arabidopsis thaliana ecotype WS. PlantPhysiol. Biochem. 40, 151–160.

Bewley, J.D., 1997. Seed Germination and Dormancy. Plant Cell 9, 1055–1066.Blau, N., de Klerk, J.B.C., Thöny, B., Heizmann, C.W., Kierat, L., Smeitink, J.A.M.,

Duran, M., 1996. Tetrahydrobiopterin loading test in xanthine dehydrogenaseand molybdenum cofactor deficiencies. Biochem. Mol. Med. 58, 199–203.

Blokhina, O., Fagerstedt, K.V., 2010. Oxidative metabolism, ROS and NO underoxygen deprivation. Plant Physiol. Biochem. 48, 359–373.

Borisjuk, L., Rolletschek, H., 2009. The oxygen status of the developing seed. NewPhytol. 182, 17–30.

Bowers, J.E., Chapman, B.A., Rong, J., Paterson, A.H., 2003. Unravelling angiospermgenome evolution by phylogenetic analysis of chromosomal duplication events.Nature 422, 433–438.

Burguieres, E., McCue, P., Kwon, Y.I., Shetty, K., 2007. Effect of vitamin C and folicacid on seed vigour response and phenolic-linked antioxidant activity.Bioresour. Technol. 98, 1393–1404.

Cabrerizo, F.M., Dantola, M.L., Petroselli, G., Capparelli, A.L., Thomas, A.H., Braun,A.M., Lorente, C., Oliveros, E., 2007. Reactivity of conjugated and unconjugatedpterins with singlet oxygen ðO2ð1DeltagÞÞ: Physical quenching and chemicalreaction. Photochem. Photobiol. 83, 526–534.

Clough, S.J., Bent, A.F., 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735–743.

Coderre, J.A., Beverley, S.M., Schimke, R.T., Santi, D.V., 1983. Overproduction of abifunctional thymidylate synthetase-dihydrofolate reductase and DNAamplification in methotrexate-resistant Leishmania tropica. Proc. Nat. Acad.Sci. USA 80, 2132–2136.

Darmanyan, A.P., Jenks, W.S., Jardon, P., 1998. Charge-transfer quenching of singletoxygen 1O2 by amines and aromatic hydrocarbons. J. Phys. Chem. A 102, 7420–7426.

Day, R.C., Herridge, R.P., Ambrose, B.A., Macknight, R.C., 2008. Transcriptomeanalysis of proliferating arabidopsis endosperm reveals biological implicationsfor the control of syncytial division, cytokinin signaling, and gene expressionregulation. Plant Physiol. 148, 1964–1984.

De Brouwer, V., Zhang, G.-F., Storozhenko, S., Van Der Straeten, D., Lambert, W.E.,2007. PH stability of individual folates during critical sample preparation stepsin prevision of the analysis of plant folates. Phytochem. Anal. 18, 496–508.

De Brouwer, V., Storozhenko, S., Van De Steene, J.C., Wille, S.M.R., Stove, C.P., VanDer Straeten, D., Lambert, W.E., 2008. Optimisation and validation of a liquidchromatography-tandem mass spectrometry method for folates in rice. J.Chromatogr. A 1215, 125–132.

De Brouwer, V., Storozhenko, S., Stove, C.P., Van Daele, J., Van Der Straeten, D.,Lambert, W.E., 2010. Ultra-performance liquid chromatography-tandem massspectrometry (UPLC-MS/MS) for the sensitive determination of folates in rice. J.Chromatogr. B 878, 509–513.

de Folter, S., Busscher, J., Colombo, L., Losa, A., Angenent, G., 2004. Transcriptprofiling of transcription factor genes during silique development inArabidopsis. Plant Mol. Biol. 56, 351–366.

Diaz de la Garza, R.I., Gregory, J.F., Hanson, A.D., 2007. Folate biofortification oftomato fruit. Proc. Nat. Acad. Sci. USA 104, 4218–4222.

Edman, J.C., Goldstein, A.L., Erbe, J.G., 1993. Para-aminobenzoate synthase gene ofSaccharomyces cerevisiae encodes a bifunctional enzyme. Yeast 9, 669–675.

Eudes, A., Bozzo, G.G., Waller, J.C., Naponelli, V., Lim, E.-K., Bowles, D.J., Gregory III,J.F., Hanson, A.D., 2008. Metabolism of the Folate Precursor p-Aminobenzoate inPlants: Glucose ester formation and vacuolar storage. J. Biol. Chem. 283, 15451–15459.

Finch-Savage, W.E., Leubner-Metzger, G., 2006. Seed dormancy and the control ofgermination. New Phytol. 171, 501–523.

Gliszczynska-Swiglo, A., 2006. Antioxidant activity of water soluble vitamins in theTEAC (trolox equivalent antioxidant capacity) and the FRAP (ferric reducingantioxidant power) assays. Food Chem. 96, 131–136.

Gliszczynska-Swiglo, A., 2007. Folates as antioxidants. Food Chem. 101, 1480–1483.Goyer, A., Illarionova, V., Roje, S., Fischer, M., Bacher, A., Hanson, A.D., 2004.

Folate Biosynthesis in Higher Plants CDNA cloning, heterologous expression,and characterization of Dihydroneopterin Aldolases. Plant Physiol. 135,103–111.

Hanada, K., Kuromori, T., Myouga, F., Toyoda, T., Li, W.-H., Shinozaki, K., 2009.Evolutionary Persistence of Functional Compensation by Duplicate Genes inArabidopsis. Genome Biol. Evol. 1, 409–414.

Hanson, A.D., Roje, S., 2001. One-Carbon metabolism in higher plants. Annu. Rev.Plant Physiol. 52, 119–137.

He, X., Zhang, J., 2005. Rapid Subfunctionalization accompanied by prolonged andsubstantial neofunctionalization in duplicate gene evolution. Genetics 169,1157–1164.

Hesberg, C., HÃnsch, R., Mendel, R.R., Bittner, F., 2004. Tandem orientation ofduplicated xanthine dehydrogenase genes from Arabidopsis thaliana. J. Biol.Chem. 279, 13547–13554.

Huovinen, P., 2001. Resistance to trimethoprim-sulfamethoxazole. Clin. Infect. Dis.32, 1608–1614.

Iliades, P., Berglez, J., Meshnick, S., Macreadie, I., 2003. Promoter Strength of FolicAcid Synthesis Genes Affects Sulfa Drug Resistance in Saccharomyces cerevisiae.Microb. Drug Resist. 9, 249–255.

O. Navarrete et al. / Phytochemistry 73 (2012) 23–33 33

Iwai, K., Bunno, M., Kobashi, M., Suzuki, T., 1976. Isolation and characterization of 6-hydroxymethylpterin as the Crithidia growth-promoting factor from spinachchloroplasts. BBA-Gen Subjects 444, 618–622.

Jabrin, S., Ravanel, S., Gambonnet, B., Douce, R., Rebeille, F., 2003. One-carbonmetabolism in plants. Regulation of tetrahydrofolate synthesis duringgermination and seedling Development. Plant Physiol. 131, 1431–1439.

Johnson, D.A., Thomas, M.A., 2007. The monosaccharide transporter gene family inarabidopsis and rice. A history of duplications, adaptive evolution, andfunctional divergence. Mol. Biol. Evol. 24, 2412–2423.

Joshi, R., Adhikari, S., Patro, B.S., Chattopadhyay, S., Mukherjee, T., 2001. Free radicalscavenging behavior of folic acid: evidence for possible antioxidant activity.Free Radical Biol. Med. 30, 1390–1399.

Karimi, M., Inzé, D., Depicker, A., 2002. GATEWAYTM vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci. 7, 193–195.

Klaus, S.M.J., Wegkamp, A., Sybesma, W., Hugenholtz, J., Gregory III, J.F., Hanson,A.D., 2005. A Nudix Enzyme Removes Pyrophosphate from DihydroneopterinTriphosphate in the Folate Synthesis Pathway of Bacteria and Plants. J. Biol.Chem. 280, 5274–5280.

Koch, M.A., Haubold, B., Mitchell-Olds, T., 2000. Comparative evolutionary analysisof chalcone synthase and alcohol dehydrogenase loci in Arabidopsis, Arabis, andrelated genera (Brassicaceae). Mol. Biol. Evol. 17, 1483–1498.

Kohashi, M., 1980. Isolation of six unconjugated Pteridines from soybean (Glycinmax L Tsurunoko) seeds. J. Biochem. 87, 1581–1586.

Kohashi, M., Tomita, K., Iwai, K., 1980. Analysis of unconjugated pterins in foodresources and human urine. Agr. Biol. Chem. 44, 2089–2094.

Kuang, A., Crispi, M., Musgrave, M.E., 1998. Control of seed development inArabidopsis thaliana by atmospheric oxygen. Plant Cell Environ. 21, 71–78.

Lazar, G., Zhang, H., Goodman, H.M., 1993. The origin of the bifunctionaldihydrofolate reductase-thymidylate synthase isogenes of Arabidopsisthaliana. Plant J. 3, 657–668.

Martínez, A., Barbosa, A., 2010. Are pterins able to modulate oxidative stress? Theor.Chem. Acc. 127, 485–492.

Martinez, A., Vargas, R., 2010. Electron donor–acceptor properties of metal atomsinteracting with pterins. New J. Chem. 34, 2988–2995.

McIntosh, S.R., Brushett, D., Henry, R.J., 2008. GTP cyclohydrolase 1 expression andfolate accumulation in the developing wheat seed. J. Cereal Sci. 48, 503–512.

Mittler, R., Vanderauwera, S., Gollery, M., Van Breusegem, F., 2004. Reactive oxygengene network of plants. Trends Plant Sci. 9, 490–498.

Moller, I.M., Jensen, P.E., Hansson, A., 2007. Oxidative modifications to cellularcomponents in plants. Annu. Rev. Plant Physiol. 58, 459–481.

Mori, H., Nishinaka, Y., Nonogawa, M., Sommani, P., Makino, K., Yamashita, K., Arai,T., 2010. Substituent effects of pterin derivatives on singlet oxygen scavengingactivity. Biol. Pharm. Bull. 33, 905–908.

Muller, K., Linkies, A., Vreeburg, R.A.M., Fry, S.C., Krieger-Liszkay, A., Leubner-Metzger, G., 2009. In vivo cell wall loosening by hydroxyl radicals during cressseed germination and elongation growth. Plant Physiol. 150, 1855–1865.

Murr, C., Widner, B., Wirleitner, B., Fuchs, D., 2002. Neopterin as a marker forimmune system activation. Curr. Drug Metab. 3, 175–187.

Nakano, E., Higgins, J.A., Powers, H.J., 2001. Folate protects against oxidativemodification of human LDL. Brit. J. Nutr. 86, 637–639.

Naponelli, V., Noiriel, A., Ziemak, M.J., Beverley, S.M., Lye, L.-F., Plume, A.M., Botella,J.R., Loizeau, K., Ravanel, S., Rebeille, F., de Crecy-Lagard, V., Hanson, A.D., 2008.Phylogenomic and functional analysis of pterin-4a-carbinolamine dehydratasefamily (cog2154) proteins in plants and microorganisms. Plant Physiol. 146,1515–1527.

Naqvi, S., Zhu, C., Farre, G., Ramessar, K., Bassie, L., Breitenbach, J., Perez Conesa, D.,Ros, G., Sandmann, G., Capell, T., Christou, P., 2009. Transgenic multivitamincorn through biofortification of endosperm with three vitamins representingthree distinct metabolic pathways. Proc. Nat. Acad. Sci. USA.

Noiriel, A., Naponelli, V., Bozzo, G.G., Gregory-III, J.F., Hanson, A.D., 2007a. Folatesalvage in plants: pterin aldehyde reduction is mediated by multiple non-specific aldehyde reductases. Plant J. 51, 378–389.

Noiriel, A., Naponelli, V., Gregory III, J.F., Hanson, A.D., 2007b. Pterin and folatesalvage. Plants and Escherichia coli lack capacity to reduce oxidized pterins.Plant Physiol. 143, 1101–1109.

Nonogawa, M., Pack, S.P., Arai, T., Endo, N., Sommani, P., Kodaki, T., Makino, K., 2007.Reactive oxygen species generation through NADH oxidation by 6-formylpterinderivatives in the dark. Biochem. Biophys. Res. Commun. 353, 1105–1110.

Nonogawa, M., Arai, T., Endo, N., Pack, S.P., Kodaki, T., Makino, K., 2008. Reactiveoxygen species generation through NADH oxidation by pterin derivatives.Nucleic Acids Symp. Ser. 52, 567–568.

Nunes, A., Kalkmann, D., Aragão, F., 2009. Folate biofortification of lettuce byexpression of a codon optimized chicken GTP cyclohydrolase I gene. TransgenicRes. 18, 661–667.

Oettl, K., Reibnegger, G., 2002. Pteridine derivatives as modulators of oxidativestress. Curr. Drug Metab. 3, 203–209.

Orsomando, G., Bozzo, G.G., Garza, R.D., Basset, G.J., Quinlivan, E.P., Naponelli, V.,Rébeillé, F., Ravanel, S., Gregory III, J.F., Hanson, A.D., 2006. Evidence for folate-salvage reactions in plants. Plant J. 46, 426–435.

Patel, O., Satchell, J., Baell, J., Fernley, R., Coloe, P., Macreadie, I., 2003. Inhibitionstudies of sulfonamide-containing folate analogs in yeast. Microb. Drug Resist.9, 139–146.

Perreten, V., Boerlin, P., 2003. A new sulfonamide resistance gene (sul3) inEscherichia coli is widespread in the pig population of switzerland.Antimicrob. Agents Chemother. 47, 1169–1172.

Quinlivan, E.P., Roje, S., Basset, G., Shachar-Hill, Y., Gregory III, J.F., Hanson, A.D.,2003. The folate precursor p-Aminobenzoate is reversibly converted to itsglucose ester in the plant cytosol. J. Biol. Chem. 278, 20731–20737.

Ravanel, S., Cherest, H., Jabrin, S., Grunwald, D., Surdin-Kerjan, Y., Douce, R., Rebeille,F., 2001. Tetrahydrofolate biosynthesis in plants: molecular and functionalcharacterization of dihydrofolate synthetase and three isoforms offolylpolyglutamate synthetase in Arabidopsis thaliana. Proc. Nat. Acad. Sci.USA 98, 15360–15365.

Rébeillé, F., Macherel, D., Mouillon, J.M., Garin, J., Douce, R., 1997. Folatebiosynthesis in higher plants: purification and molecular cloning of abifunctional 6-hydroxymethyl-7, 8-dihydropterin pyrophosphokinase 7, 8-dihydropteroate synthase localized in mitochondria. EMBO J. 16, 947–957.

Rezk, B.M., Haenen, G.R.M.M., van der Vijgh, W.J.F., Bast, A., 2003. Tetrahydrofolateand 5-methyltetrahydrofolate are folates with high antioxidant activity.Identification of the antioxidant pharmacophore. FEBS Lett. 555, 601–605.

Rolletschek, H., Borisjuk, L., Koschorreck, M., Wobus, U., Weber, H., 2002. Legumeembryos develop in a hypoxic environment. J. Exp. Bot. 53, 1099–1107.

Spencer, M.W.B., Casson, S.A., Lindsey, K., 2007. Transcriptional Profiling of theArabidopsis Embryo. Plant Physiol. 143, 924–940.

Stakhov, L.F., Ladygin, V.G., Stakhova, L.N., 2002. Effect of ultraviolet C irradiation offolate and free amino acid in leaves contents in leaves of Pisum sativum.Biofizika 47, 878–885.

Stakhov, L.F., Ladygin, V.G., Stakhova, L.N., 2005. Time course of the content offolates and free amino acids in leaves of Pisum sativum L. After irradiation withultraviolet C. Biol. Bull. 32, 121–127.

Steffens, N.O., Galuschka, C., Schindler, M., Bulow, L., Hehl, R., 2004. AthaMap: anonline resource for in silico transcription factor binding sites in the Arabidopsisthaliana genome. Nucl. Acid. Res. 32, D368–D372.

Storozhenko, S., De Brouwer, V., Volckaert, M., Navarrete, O., Blancquaert, D., Zhang,G.-F., Lambert, W., Van Der Straeten, D., 2007a. Folate fortification of rice bymetabolic engineering. Nat. Biotechnol. 25, 1277–1279.

Storozhenko, S., Navarrete, O., Ravanel, S., De Brouwer, V., Chaerle, P., Zhang, G.-F.,Bastien, O., Lambert, W., Rébeillé, F., Van Der Straeten, D., 2007b. CytosolicHydroxymethyldihydropterin Pyrophosphokinase/Dihydropteroate Synthasefrom Arabidopsis thaliana: A specific role in early development and stressresponse. J. Biol. Chem. 282, 10749–10761.

Sun, K., Hunt, K., Hauser, B.A., 2004. Ovule abortion in Arabidopsis triggered bystress. Plant Physiol. 135, 2358–2367.

Temple, C., Rose, J.D., Montgomery, J.A., 1981. Chemical conversion of folic acid topteroic acid. J. Org. Chem. 46, 3666–3667.

Watanabe, K., Arai, T., Mori, H., Nakao, S.-i., Suzuki, T., Tajima, K., Makino, K., Mori,K., 1997. Pterin-6-aldehyde, an inhibitor of xanthine oxidase, has superoxideanion radical scavenging activity. Biochem. Biophys. Res. Commun. 233, 447–450.

Young, L., Westcott, N., Christensen, C., Terry, J., Lydiate, D., Reaney, M., 2007.Inferring the geometry of fourth-period metallic elements in Arabidopsisthaliana seeds using synchrotron-based multi-angle x-ray fluorescencemapping. Ann. Bot. 100, 1357–1365.

Zarepour, M., Kaspari, K., Stagge, S., Rethmeier, R., Mendel, R., Bittner, F., 2010.Xanthine dehydrogenase AtXDH1 from Arabidopsis thaliana; is a potentproducer of superoxide anions via its NADH oxidase activity. Plant Mol. Biol.72, 301–310.

Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L., Gruissem, W., 2004.GENEVESTIGATOR arabidopsis microarray database and analysis toolbox. PlantPhysiol. 136, 2621–2632.