a family of autocrine growth factors in mycobacterium...

Molecular Microbiology (2002)

46

(3) 623ndash635

copy 2002 Blackwell Publishing Ltd

Blackwell Science LtdOxford UKMMIMolecular Microbiology 0950-382X Blackwell Science 200246Original Article

Autocrine growth factors in Mycobacterium tuberculosisMukamolova et al

Accepted 29 July 2002 For correspondence E-mail miyaberacuk Tel (

+

44) 1970 622348 Fax (

+

44) 1970 622354

dagger

Presentaddress Dept Chemistry UMIST PO Box 88 Manchester M60 1QDUK

A family of autocrine growth factors in

Mycobacterium tuberculosis

Galina V Mukamolova

12

Obolbek A Turapov

12

Danielle I Young

1

Arseny S Kaprelyants

2

Douglas B Kell

1dagger

and Michael Young

1

1

Institute of Biological Sciences University of Wales Aberystwyth Ceredigion SY23 3 DD UK

2

Bakh Institute of Biochemistry Russian Academy of Sciences Leninsky pr33 117071 Moscow Russia

Summary


and its close relative

Mycobacterium bovis

(BCG) contain five geneswhose predicted products resemble Rpf from

Micro-coccus luteus

Rpf is a secreted growth factor activeat picomolar concentrations which is required for thegrowth of vegetative cells in minimal media at verylow inoculum densities as well as the resuscitationof dormant cells We show here that the five cognateproteins from

M tuberculosis

have very similar char-acteristics and properties to those of Rpf They toostimulate bacterial growth at picomolar (and in somecases subpicomolar) concentrations Several lines ofevidence indicate that they exert their activity froman extra-cytoplasmic location suggesting that theyare also involved in intercellular signalling The five

M tuberculosis

proteins show cross-species activityagainst

M luteus

Mycobacterium smegmatis

and

Mbovis

(BCG) Actively growing cells of

M bovis

(BCG)do not respond to these proteins whereas bacteriaexposed to a prolonged stationary phase do Affinity-purified antibodies inhibit bacterial growth

in vitro

suggesting that sequestration of these proteins at thecell surface might provide a means to limit or evenprevent bacterial multiplication

in vivo

The Rpf familyof bacterial growth factors may therefore providenovel opportunities for preventing and controllingmycobacterial infections

Introduction

Intercellular communication between bacteria has beenwell documented over the last decade (Kaiser and Losick

1993 Kell

et al

1995 Salmond

et al

1995 Fuqua andGreenberg 1998)

N

-acyl-

L

-homoserine lactones are gen-erally used for cell density-dependent signalling in Gram-negative organisms (Fuqua

et al

1994 1996) Peptidesare more commonly though not exclusively (Horinouchiand Beppu 1994 Ohnishi

et al

1999) used for intercel-lular signalling in Gram-positive organisms (Kleerebezem

et al

1997 Lazazzera and Grossman 1998) Examplesof processes in which peptide-mediated signalling occursinclude conjugation in enterococci (Clewell 1993) anddevelopment of competence for genetic transformationand endospore formation in

Bacillus subtilis

(Kaiser andLosick 1993 Lazazzera and Grossman 1998)

Individual bacteria are normally considered autono-mous because their growth and multiplication does notapparently depend on the presence of any specificexogenous peptidic or proteinaceous growth factors(Kaprelyants

et al

1994a Votyakova

et al

1994Kaprelyants and Kell 1996 Kell and Young 2000) Thisconventional view has been challenged by the recent dis-covery of a protein called Rpf (

r

esuscitation-

p

romoting

f

actor) that is secreted by growing cells of

Micrococcusluteus

(Mukamolova

et al

1998) Rpf was required atpicomolar concentrations for the resuscitation of dormantlsquonon-culturablersquo cells of

M luteus

and for the growth ofsmall inocula in minimal media Moreover extensivewashing of actively growing cells of

M luteus

renderedtheir further growth dependent on exogenously added Rpf(Mukamolova

et al

1998) It has recently been shownthat

rpf

is an essential gene in

M luteus

(Mukamolova

et al

2002) Rpf therefore has the properties of a protein-aceous bacterial growth factor or cytokine (Callard andGearing 1994)

Genes resembling

M luteus rpf

are widespreadthroughout the high G

+

C Gram-positive bacteria whichincludes streptomycetes corynebacteria and mycobacte-ria (Kell and Young 2000) The DNA sequence databasescurrently contain more than 30 members of the

rpf

genefamily and most organisms contain several representa-tives For example


and itsclose relative (Behr

et al

1999)

Mycobacterium bovis

contain five

rpf

-like genesTuberculosis caused by

M tuberculosis

now kills morepeople in the world than any other single bacterial infec-tion and globally one in three people are believed toharbour a persistent (latent) infection (Bloom and Murray

624

G V Mukamolova

et al


Molecular Microbiology

46

623ndash635

1992 Dye

et al

1999) The phenomenon of persistencehas long been recognised (McDermott 1958 Wayne1960 McCune

et al

1966) but it remains poorly under-stood (Young and Duncan 1995 Parrish

et al

1998Wayne and Sohaskey 2001) It is generally agreed thatthe immune system plays an important role in preventingnet bacterial multiplication (Flynn and Chan 2001) butother aspects of the biology of the persisting organismsremain controversial Some evidence suggests that theymay be metabolically active (reviewed by Houmlner zuBentrup and Russell 2001) whereas there is also evi-dence that they have become dormant or have lost cul-turability (Wayne 1960 1994) The presence of

rpf

-likegenes in these mycobacteria raises the possibility that (alack of) their products may be involved in controlling bac-terial growth

in vivo

Persisting organisms in the latentstate may require one or more of these proteins in orderto re-activate To illuminate these suggestions we haveisolated recombinant forms of the five

rpf

-like proteins of

M tuberculosis

and tested their activities using severaldifferent organisms

Results

Comparison of the five

rpf-

like genes of M tuberculosis

The predicted products of the five

rpf

-like genes of

Mtuberculosis

share with Rpf a conserved

~

70-residuesegment (Fig 1A) Rpf is a secreted protein Thereforethe SignalP and TMMHM servers at the Technical Univer-sity of Denmark (httpwwwcbsdtudkservicesSignalPand httpwwwcbsdtudkservicesTMHMM-20) wereused to determine whether the five Rpf-like proteins of

Mtuberculosis

are also likely to be secreted Two of them

RpfA (Rv0867c 407 aa) and RpfD (Rv2389c 154 aa)were predicted to be secreted proteins ndash see also Gomez

et al

(2000) RpfA is a comparatively large protein inwhich the Rpf-like segment is followed by an extensiveseries (residues 146ndash320) of proline

+

alanine-richrepeats with the consensus sequence APADLAPP TheRpfB protein (Rv1009 362 aa) has its Rpf-like domain atthe C-terminus RpfB is probably anchored to the outersurface of the cell membrane by an N-terminal prokaryoticmembrane lipoprotein lipid attachment site (PrositePS00013) Residues 1ndash117 of RpfB share similarity withthe N-terminal Mce domain (PF02470) that is found in allsix predicted products of the multiple

mce

operons of

Mtuberculosis

at least one of which (

mce1

Rv0169) isinvolved in entry into and survival inside macrophages(Arruda

et al

1993) The status of the remaining two Rpf-like gene products is less clear Although RpfC (Rv 1884c176 aa) is not predicted to contain a

trans

-membrane helixnear its N-terminus a secretory signal sequence waspredicted using a neural network (httpwwwcbsdtudkservicesSignalP) trained on Gram-positive signalsequences RpfE (Rv2450c 172 aa) has a weakly pre-dicted

trans

-membrane helix close to its N-terminuswhereas the presence of a signal sequence was quitestrongly predicted Thus some of these five proteins areprobably secreted whereas others may be anchored inthe cytoplasmic membrane In common with Rpf they allprobably have extra-cytoplasmic functions

The various

rpf

-like genes (Fig 1B) are scatteredabout the

M tuberculosis

genome (Cole

et al

1998) The

rpfA

and

rpfE

genes appear to comprise monocistronicoperons the former lying within a cluster of genes con-cerned with molybdopteroate biosynthesis There is a

Fig 1

A Schematic alignment of the five Rpf-like gene products of

M tuberculosis

The predicted (httpwwwcbsdtudkservicesSignalP) signal sequence cleavage sites and the numbers of the first predicted residues of the mature secreted proteins are also indicatedB The chromosomal context of each gene (httpgenolistpasteurfrTubercuList) The approximate co-ordinates (kbp) of each segment are also given

Autocrine growth factors in

Mycobacterium tuberculosis 625



46

623ndash635

Fig 2

The Rpf-like proteins of

M tuberculosis

reduce the apparent lag phase of

M luteus

(A) and

M smegmatis

(B) Protein samples were serially diluted 30-fold (A) or 10-fold (B) The mean apparent lag phase values are shown at each protein concentration tested (

plusmn

SD if this was greater than 3 h) Activity is represented schematically by the filled shapes whose width is maximal at protein concentrations showing maximum activity (reduction of apparent lag phase ie time to measurable turbidity in the Bioscreen C growth analyser) A dotted line indicates that activity is presumed to extend beyond the lowest or highest dilution tested In controls with no added protein the apparent lag phase was 216

plusmn

4 h (

M luteus

) and 74

plusmn

4 h (

M smegmatis

)

25 bp overlap between the 3

cent

end of

rpfB

and

ksgA

whichis predicted to encode a dimethyadenosine transferaseThe

rpfD

gene lies downstream from a gene of unknownfunction in what may be a bicistronic operon It is locatedbetween

hemN

and

nirA

which probably encode proteinsinvolved in coproporphyrinogen III decarboxylation andnitrate reduction respectively Finally

rpfC

is the third genein a seven-gene operon containing a mycolyltransferase(

fbpB

) upstream and a probable dehydrogenase (Rv1882c) lipoprotein (Rv 1881c) and cytochrome P450 (Rv1880c) downstream The widely differing contexts of thefive genes provide no clear evidence for a common bio-logical function

Biological activities of the recombinant proteins

To investigate their biological functions the five Rpf-likeproteins encoded by the

M tuberculosis

genome wereobtained in reagent quantities as polyhistidine-taggedderivatives lacking their predicted signal sequencesmembrane anchors (see Fig 1A) as indicated in the

Experimental procedures

They were assayed by incorpo-rating them into the growth medium of

M luteus

and

Msmegmatis

We have previously shown that when thesefast growing organisms are inoculated at low cell densityinto a minimal medium their apparent lag phase (time todetectable turbidity) is reduced in response to Rpf addition(Mukamolova

et al

1998) All four

M tuberculosis

pro-teins tested also reduced the apparent lag phase of

Mluteus

(Fig 2A) RpfA and RpfC were the most potentThe former showed activity at fM concentrations whereasthe latter caused the greatest reduction in apparent lagphase (from 216 h to 80 h) Similarly all four proteins wereactive in reducing the apparent lag phase of

M smegmatis

(Fig 2B) At optimally active concentrations all four pro-teins reduced the apparent lag phase to the same extentand for RpfA RpfC and RpfE maximal activity wasobserved at subpicomolar concentrations (Fig 2B)

Complete activity profiles were obtained for RpfDagainst both organisms and for RpfA and RpfC against

Mluteus

These profiles indicate that there is an optimalconcentration range for activity above and below whichthere is reduced activity or no activity at all Indeed theonly protein for which there is no evidence of reducedactivity at elevated (

m

M) concentrations was RpfE whentested using

M luteus

The four proteins show different potency profiles when

tested using these two fast-growing organisms RpfA wasactive at subpicomolar concentrations against both

Msmegmatis

and M luteus On the other hand the potencyof RpfE was high when tested against M smegmatis butcomparatively low when tested against M luteus Freshlypurified samples were always used for experimentsbecause these proteins lose biological activity during stor-

age (Experimental procedures) Nevertheless we cannotrule out the possibility that differences in the proportion ofbiologically active molecules in different protein samplescould account at least in part for the different potenciesof the four proteins However this cannot explain the dif-ferent potency of RpfA when tested with the two differentorganisms because the assays were done at the sametime with the same protein preparation

Mycobacterium bovis (BCG) was chosen as a represen-tative of the slow-growing mycobacteria (Wayne 1984)with which to test the biological activities of the Rpf-likeproteins of M tuberculosis Mycobacterium bovis (BCG)is closely related to M tuberculosis (Behr et al 1999) andcontains five rpf homologues that are very similar indeedto those of M tuberculosis (Kell and Young 2000)

The response of M bovis (BCG) to the five proteins

626 G V Mukamolova et al

copy 2002 Blackwell Publishing Ltd Molecular Microbiology 46 623ndash635

depended on the age of the inoculum When activelygrowing cells were used none of the proteins stimulatedbacterial growth (representative data are shown for RpfCin Fig 3F) However in common with cells of both thevirulent and the avirulent strains of M tuberculosis (Sunand Zhang 1999 Zhang et al 2001 Shleeva et al2002) those of M bovis (BCG) lose culturability duringextended stationary phase The activities of the five Rpf-like proteins of M bovis (BCG) were therefore monitoredusing late stationary phase cells As indicated in Fig 3AndashE all five proteins were active growth usually occurredafter an appreciable lag and was dependent on theprovision of pM concentrations of any one of these fiveproteins RpfA only showed activity at the lowest concen-tration tested (16 pM) (Fig 3A) whereas the other pro-teins were active over the entire concentration rangetested The data summarized in Fig 2AndashB and Fig 3AndashEestablish that the rpf-like genes of M tuberculosis encodea family of growth factors with activities similar to that ofM luteus Rpf (Mukamolova et al 1998)

Rpf expression in M smegmatis stimulates bacterial growth

To circumvent potential problems arising from the factthat the recombinant proteins are unstable and the pro-portion of biologically active molecules in different prepa-

rations of recombinant proteins is not known (see above)we examined the effect of Rpf expression in vivo PlasmidpAGM0 (Mukamolova et al 2002) expressing rpf underthe control of the M smegmatis amidase promoter (Pami)(Parish et al 1997) was introduced into M smegmatisUsing reverse transcriptase-polymerase chain reaction(RT-PCR) we verified that rpf is expressed soon afterinoculation of the pAGM0-containing strain into freshgrowth medium (data not shown) The appearance of Rpfin the culture supernatant was also demonstrable byWestern blotting of samples taken when the cultureswere in exponential phase (OD600 = 06) Using an inocu-lum grown to stationary phase overnight in NBE bacteriawere subjected to nutritional shift-down by inoculation atthree different densities into Sautonrsquos medium At lowinoculum densities (103 and 104 colony-forming units(cfu) ml-1) the apparent lag phase was substantiallyreduced in the Rpf-expressing strain compared with thatof the control containing the pAGH vector (Fig 4A) Thiseffect was observed in the presence of either kanamycinor hygromycin used to select for plasmid maintenanceand also in the absence of either antibiotic (data notshown) It was also observed in the absence of aceta-mide consonant with the report that this promoter ispartially active in the absence of inducer (Parish et al1997) Growth stimulation was not apparent at ahigher inoculum density (105 cfu ml-1) nor was it ob-

Fig 3 The Rpf-like proteins of M tuberculosis stimulate the growth of M bovis (BCG) The responses of aged M bovis (BCG) (5 month-old culture) to recombinant versions of RpfA (A) RpfB (B) RpfC (C) RpfD (D) and RpfE (E) are shown The response of actively growing M bovis (BCG) (inoculum was 100 cells ml-1 from late-logarithmic phase) to recombinant RpfC (F) is also shown The OD600 of each culture was monitored with time

Autocrine growth factors in Mycobacterium tuberculosis 627


Fig 4 Comparative growth kinetics (A) of M smegmatis strains containing plasmids pAGH (vector) and pAGM0 (rpf expressed from Pami) using Sautons medium containing 005 Tween-80 and 5 mg kanamycin ml-1 The number of cfu in the overnight cultures (adjusted to OD600 = 10 and used as inocula for this experiment) were 123 (plusmn011) yen 108 for the control containing pAGH and 103 (plusmn011) yen 108 for the strain containing pAGM0 The remainder of the Figure shows colonies obtained from bacteria containing pAGH (B and D) or pAGM0 (C and E) 72 h post inoculation on Sautonrsquos medium containing ADC and either 50 mg hygromycin ml-1 (B and C) or 10 mg kanamycin ml-1 (D and E)



served in a strain harbouring pAGM1 in which Pami gen-erates a counter-transcript of rpf The growth-stimulatoryeffect of rpf expression in M smegmatis was also evidentwhen comparing the sizes of colonies of strains harbour-ing pAGM0 (expressing rpf) and pAGH (vector control)obtained on agar-solidified Sautonrsquos medium both in thepresence and absence of selective antibiotics (Fig 4BndashEand data not shown)

Expression of the five rpf-like genes of M tuberculosis and M bovis (BCG)

Messenger RNA corresponding to all five rpf-like geneswas detected by RT-PCR using RNA isolated from cellsof M tuberculosis H37Rv and M bovis (BCG) growingactively in vitro (Fig 5A and B) Although only weaksignals were obtained for RpfD (Rv2389c) in M bovis(BCG) and RpfE (Rv2450c) in both organisms expressionof both genes has been detected by others in microarrayexperiments (Manganelli et al 2001 Sherman et al2001) In contrast we were unable to detect mRNA cor-responding to any of these genes in RNA extracted fromM bovis (BCG) during stationary phase nor from cellsthat had been starved for 5 months (data not shown) Allfive rpf-like genes are expressed in actively growing cellswhereas non-growing cells express them either at levelsthat are below the limit of detection or not at all

To monitor protein production antibodies were raisedagainst a histidine-tagged truncated form of Rpf compris-ing residues A42-L118 ie the conserved lsquoRpf domainrsquo thatis shared by all family members (Kell and Young 2000)and purified by affinity chromatography (Experimental pro-cedures) These antibodies reacted with recombinant ver-sions of all five of the Rpf-like proteins of M tuberculosis(Fig 6C) They detected two bands in concentrated sam-

ples of supernatant obtained from exponentially growingcultures of M bovis (BCG) (Fig 6A) and M tuberculosis(data not shown) Several bands were also detected inconcentrated samples of supernatant obtained from expo-nentially growing cultures of M smegmatis (Fig 6B) Onlythe uppermost band was seen (and its apparent size wasslightly reduced) if protease inhibitors were not presentduring isolation (see Experimental procedures) Accord-ing to the available genome sequence information (httpwwwncbinlmnihgovcgi-binEntrezgenom_table_cgi)this organism potentially produces four Rpf-like proteinsThese experiments confirm that Rpf-like proteins aredetectable in the supernatant of actively growing culturesof M bovis (BCG) M tuberculosis and M smegmatis

Using confocal microscopy of M bovis BCG that hadbeen incubated with anti-truncated Rpf antibodies anda secondary FITC-labelled antibody Rpf-like protein(s)were detected on the bacterial cell surface About 30 ofthe M bovis (BCG) cells in early logarithmic phase cul-tures (8 days post inoculation) showed detectable fluores-cence and some of them were much more stronglyfluorescent than others (Fig 6D and E) Fluorescencewas abolished if recombinant Rpf was added to the bac-teria at the same time as the primary anti-Rpf antibodyNone of the cells in stationary phase cultures (6 weekspost inoculation) showed visible fluorescence (data notshown)

Anti-Rpf antibodies inhibit bacterial growth

Given the accumulated evidence that members of the Rpfprotein family stimulate bacterial growth from an extra-cytoplasmic location we determined the effect of addinganti-Rpf antibodies to the culture medium Immunoglobu-lins purified from immune serum partially inhibited thegrowth of the avirulent Academia strain of M tuberculosiswhereas immunoglobulins purified from preimmuneserum were without effect (Fig 7A) Moreover the inhibi-tory effect of immunoglobulins in the immune serum wasovercome by the addition of Rpf Similar growth inhibitionof M bovis (BCG) was observed using affinity-purifiedanti-Rpf antibodies Inhibition was transient resulting indelayed bacterial growth when using a large inoculum oflate logarithmic cells (Fig 7B) This was probably not aresult of antibody degradation during the long incubationperiod as anti-Rpf antibodies were detectable in the cul-ture medium by Western blotting throughout the experi-ment (data not shown) There was more pronouncedgrowth inhibition using a small inoculum of aged cells ofM bovis (BCG) (Fig 7C) In all of these experiments theaddition of Rpf overcame the growth-inhibitory effect ofthe anti-Rpf antibodies Indeed in Fig 7C the provision ofRpf abolished the short lag phase seen in the control

Fig 5 The rpf-like genes of M tuberculosis (A) and M bovis (BCG) (B) are expressed in vivo RT-PCR products obtained from M tuber-culosis H37Rv (A) and M bovis (BCG) (B) RNA using primer pairs specific for 1 RpfA (209 bp) 2 RpfB (288 bp) 3 RpfC (180 bp) 4 RpfD (238 bp) 5 RpfE (357 bp) ndash sizes of expected products in parentheses Markers of 200 300 and 400 bp derived from a 100 bp ladder (Promega) are also shown



Fig 6 Detection of Rpf-like proteins in culture supernatant from M bovis BCG (A) and M smegmatis (B) and on the surface of cells of M bovis BCG (D and E) In A and B samples of crude cell extract (CE) culture supernatant (SN) and proteins concentrated from culture supernatant using DEAE cellulose chromatography (cSN) are shown C shows the recombinant Rpf-like proteins of M tuberculosis in crude extracts of E coli HMS174 following IPTG-induced expression (lanes AndashE correspond to strains expressing RpfA-E lanes labelled pET contain the pET-19b vector) In AndashC the left-hand panels show proteins detected by the rabbit anti-Rpf antibody and the right-hand panels show the corresponding Coomassie blue-stained gel The size markers in AndashC (98 66 45 30 22 17 kDa) were from BioRad The arrows in A indicate the positions of proteins detected on the immunoblot and those in C indicate the positions of recombinant RpfA B and E in the Coomassie blue-stained gel C shows evidence of both aggregation and degradation of RpfA RpfB and RpfE D and E show confocal microscope images of fixed cells of M bovis BCG from an exponential phase culture (8 days post inoculation) following incubation with anti-truncated Rpf antibodies and a secondary FITC-labelled antibody E is a view of the pole of a fluorescent cell



Discussion

Information from the published genome sequence (Coleet al 1998) suggested that the rpf-like genes of M tuber-culosis encode a family of surface-located or secretedproteins This was confirmed by the results reported hereOne or more of these proteins was detected on thesurface of actively growing bacteria and in concentratedsamples of supernatants obtained from cultures of M

tuberculosis the closely related organism M bovis(BCG) and M smegmatis (Fig 6A and B) Moreovergrowth of M bovis BCG was stimulated by recombinantversions of these Rpf-like proteins (Figs 2 and 3) andinhibited when anti-Rpf antibodies were incorporated intothe culture medium (Fig 7)

The Rpf-like proteins of M tuberculosis stimulated bac-terial growth in laboratory culture at very low (pM) con-centrations which effectively excludes the possibility thatthey were simply being used as nutrients The most potentproteins were active at concentrations equivalent to just afew molecules per cell (Fig 2) consistent with the viewthat they act as growth factors As was previously notedwhen M luteus Rpf was tested against a panel of differentorganisms the Rpf-like proteins of M tuberculosis showcross-species activity They stimulated the growth of theclosely related slow-growing organism M bovis (BCG)(Fig 3) as well as that of two fast-growing organisms Msmegmatis and M luteus (Fig 2) Moreover expressionof rpf in M smegmatis also stimulated the growth of thisorganism in a minimal medium (Fig 7) confirming theresults obtained with exogenously added recombinantproteins It is noteworthy that this represents the first dem-onstration of Rpf-mediated growth stimulation on a solidmedium when recombinant proteins are incorporated intomolten agar or spread on the surface of agar plates theyare not active (Kaprelyants et al 1994 Mukamolovaet al 2002)

Reverse transcriptasendashpolymerase chain reactionshowed that actively growing cells of both M tuberculosisH37Rv and M bovis (BCG) express all five of their rpf-likegenes (Fig 5) and Western blotting indicated that Rpf-likeproteins are detectable in the culture medium (Fig 6A)Continued cellular multiplication is assured by endoge-nous protein production hence the provision of extramolecules in the culture medium has little effect on bac-terial growth (Fig 3F and unpublished data) Moreoversome organisms appear to produce sufficient amounts ofthese growth factors to render them relatively insensitiveto the growth-inhibitory effect of anti-Rpf antibodies(Fig 7B) and to permit their detection on the cell surface(Fig 6DndashE) Non-growing bacteria do not produce thesegrowth factors As they remain in stationary phase previ-ously synthesized molecules gradually decay and thebacteria become increasingly dependent on an exoge-nous supply in order to resume growth (Fig 3AndashE) Agrowth factor requirement is also detectable in cells of theavirulent Academia strain of M tuberculosis that havepersisted for several days within murine macrophages(Biketov et al 2000) Mycobacteria inoculated from latestationary phase or even older cultures either fail to growor grow only very slowly after an extended lag phase(Dubos and Davis 1946 Aldovini et al 1993 Yuan et al1996 Lim et al 1999 Sun and Zhang 1999) The addi-

Fig 7 Influence of anti-Rpf antibodies on bacterial growth Cultures were inoculated with 105 cfu from a 2-month-old culture of M tuber-culosis (A) 106 cfu from a 2-week-old culture of M bovis (BCG) (B) and 102 cfu from a 6-week-old culture of M bovis BCG (C) The IgG fraction purified from immune and preimmune sera (A) and affinity-purified rabbit anti-Rpf antibodies (B and C) were used and Rpf (450 pM) was added as indicated Growth was monitored by measur-ing the OD600 (A and B) or by plating (C)



tion of Rpf-like growth factors to such cultures should aidthe resumption of normal growth which could potentiallyimprove the diagnosis and quantification of mycobacterialinfections

To obtain lsquonon-culturablersquo Rpf-responsive cells of Mbovis (BCG) (see Fig 3) bacteria were incubated in Sau-tons medium in prolonged stationary phase withoutexposure to the laboratory atmosphere These conditions(except for oxygen depletion) were similar to those usedpreviously to elicit dormancy in M luteus (Mukamolovaet al 1995) The avirulent H37Ra strain of M tuberculosiscan also enter a lsquonon-culturablersquo state after prolongedstationary phase from which it can be resuscitated usingculture supernatants (Sun and Zhang 1999) Using anindirect fluorescence-based assay that correlated withresuscitation the authors initially reported that the activeagent was a small MW heat-stable compound that accu-mulated in early stationary phase Subsequently (Zhanget al 2001) activity in early stationary phase superna-tants was associated with phospholipids and an 8 kDaprotein (Rv1174c) Three synthetic peptides representingdifferent segments of this protein were active when addedto bacteria at micromolar concentrations In our experi-ments in which minute (picomolar) concentrations of Rpf-like proteins permitted the growth of organisms that wereotherwise non-culturable (Fig 3AndashE) we can effectivelyexclude any non-specific growth stimulation potentiallyarising from utilization of these molecules as nutrients

A growth factor requirement can be artificially inducedin growing cells of M luteus by repeatedly washing themand inoculating them at low cell density (Mukamolovaet al 1998 1999) Rpf has a LysM lysin domain at its C-terminus which is probably a peptidoglycan-binding mod-ule (Bateman and Bycroft 2000) Washing presumablyremoves secreted Rpf molecules associated with the cellenvelope Attempts to induce a similar growth factorrequirement in M tuberculosis and M bovis (BCG) bywashing have proved unsuccessful (unpublished data)This is consistent with the observation that one or moreof the Rpf-like proteins elaborated by these organismswhich tend to form extensive clumps cords and pelliclesis probably membrane-bound (eg RpfB)

We suspect that the five different Rpf-like proteins of Mtuberculosis and M bovis (BCG) fulfil subtly differentoverlapping biological functions They may all act asautocrine signalling molecules effectively stimulating thegrowth and multiplication of the cells that produce themFree-living (planktonic) cells may use secreted proteins(eg RpfA) for paracrine density dependent signalling(quorum sensing) (Fuqua et al 1996) whereas cellsgrowing in close proximity may use envelope-associatedproteins for juxtacrine signalling (Kaprelyants et al 1999)Dormant or injured cells (defined in Kell et al 1998)require an exogenous source of these proteins for their

resuscitation (Mukamolova et al 1998 Biketov et al2000) Further insights into their precise biological roleswill require the construction and analysis of mutants har-bouring null mutations

The growth-promoting effects of these proteins appearto result from their specific interaction with a componentof the bacterial cell envelope Two lines of evidence sug-gest that they bind to specific receptors One is theirextreme potency The other is that they have an optimumconcentration for biological activity above which they areeither inactive or even inhibitory (Mukamolova et al 19982002) Evidence of this nature has previously beenadduced in studies of hormonendashreceptor and ligandndashreceptor interactions (Franklin 1980 Gero 1983)

When mycobacteria experience an extended stationaryphase in vitro they often lose culturability (Sun and Zhang1999 Zhang et al 2001 Shleeva et al 2002) They maypossibly enter a state of Rpf-responsive dormancy akinto that observed when M luteus experiences prolongedstationary phase (Kaprelyants and Kell 1993 Kaprelyantset al 1993) Cells that have been starved in vitro may bephysiologically similar to bacteria that persist in vivo inpatients harbouring a latent M tuberculosis infection(Parrish et al 1998) Persisting organisms are detectable(de Wit et al 1995 Hernandez-Pando et al 2000 Paiet al 2000) but cannot be cultured using conventionalmethods (plating or inoculation into liquid media) (Wayne1960 1994McCune et al 1966 de Wit et al 1995) It isconsequently possible that (a lack of) Rpf-like growth fac-tors contributes a microbiological component to the phe-nomenon of mycobacterial persistence in latent infectionsThe results reported here indicate that the Rpf family ofgrowth factors may provide interesting opportunities forpreventing and treating mycobacterial infections


Organisms and media

Micrococcus luteus NCIMB 13267 (lsquoFleming strain 2665cent)was grown in LMM (Kaprelyants and Kell 1993) at 30infinC inconical flasks on an orbital shaker Mycobacterium bovis(BCG) was obtained from the Central Institute for ScientificResearch on Tuberculosis Moscow Russia Cultures (3 ml)were grown at 37infinC in 10 ml tubes with tightly fitting screwcaps without shaking in Sautonrsquos medium supplemented withADC (Connell 1994) and 005 Tween 80 Mycobacteriumsmegmatis mc2155 was grown aerobically at 37infinC inSautonrsquos medium

Cell viability by plating

Dilutions in LMM (M luteus) and Sautons medium (M smeg-matis) were plated in triplicate on agar-solidified plates con-taining nutrient broth E (NBE ndash LabM) and incubated for3 days at 30infinC for M luteus or 37infinC for M smegmatis



Dilutions of M bovis (BCG) were made in Sautonrsquos mediumsupplemented with 005 Tween 80 spread on agar-solidified Sautonrsquos medium supplemented with ADC(Connell 1994) and incubated at 37infinC for 3ndash4 weeks Sus-pensions of all organisms were passed 10 times through a23-gauge needle to break up loose cell aggregates beforedilution

Bacterial growth kinetics

For the experiment shown in Fig 4A M smegmatis strainscontaining pAGH or pAGM0 were grown overnight to station-ary phase in NBE containing 20 mg hygromycin ml-1 Underthese conditions clumping is minimized The cultures whichreached a final OD600 of 21 (pAGH) and 24 (pAGM0) werediluted with Sautonrsquos medium to an OD600 of 10 and a furtherreduction in clumping was obtained by passing them tentimes through a 23-gauge syringe needle A sample wastaken for cfu determination Bacteria were then seriallydiluted and inoculated at three different densities intoSautonrsquos medium (nutritional shift-down) supplemented with005 Tween-80 in Bioscreen plates (five replicates foreach strain at each density) Growth was at 37infinC with con-stant shaking in a Bioscreen C optical growth analyser(Laboratory-systems Finland) The data shown are the aver-ages of readings from the five replicate cultures The stan-dard deviations on these measurements are smaller than thedata points on the Figure Similarly treated bacteria wereused to inoculate the plates shown in Fig 4BndashE

Production of recombinant proteins

Recombinant Rpf was obtained as previously described(Mukamolova et al 1998) The five rpf-like genes from Mtuberculosis were amplified from H37Rv DNA using the fol-lowing primer pairs (EcoRI NcoI NdeI and BamHI restrictionsites introduced for cloning purposes are in italics) Rv0867F(CCAGAATTCATATGGCTCAGGCGACCGCGGCCACC) +Rv0867R (TGGCGGATCCTATCAGCCGATGACGTACGCTG) Rv1009F (5cent-GTGGCCATGGGCATATGGCAAGCAAAACGGTGACGTTGA3cent) + Rv1009R (5centCAGCCGGATCCTCAGCGCGCACCCGCT-3cent) Rv1884F (5cent-TCCTGAATTCATATGGGTCCCAGCCCGAACTGG-3cent) + Rv1884R (5cent-CATGGGATCCGTCAGCGCGGAATACTTG-3cent) Rv2389F (5cent-ATCAGAATTCATATGGACGACATCGATTGGGACGC-3cent) + Rv2389R (5cent-CGCAGGATCCCCTCAATCGTCCCTGCTCC-3cent) Rv2450F(5cent-TGGAGAATTCATATGGACGACGCGGGCTTGGA-3cent) +Rv2450R (5cent-TCTTGGATCCTATCAGCCGCGGCGGCCGCA-3cent) Amplification produced derivatives of each gene lack-ing their 5cent ends predicted to encode signal sequencesor N-terminal trans-membrane helicesanchors (httpwwwcbsdtudkservicesSignalPand httpwwwcbsdtudkservicesTMHMM-10) In the case of RpfB (Rv1009) anadditional C24S substitution was introduced The truncatedform of rpf was amplified from a previously cloned(Mukamolova et al 1998) 1375 bp segment of M luteusDNA using primers TR1 (5cent-GTCAGAATTCATATGGCCACCGTGGACACCTG-3cent) + TR2 (5cent-TGACGGATCCTATTACAGCTTCTGCGAGCACAG-3cent) Polymerase chain reaction prod-ucts were first established in E coli XL-2 blue as EcoRI-

BamHI or NcoI-BamHI fragments in pMTL20 (Chamberset al 1988) and their sequences verified They were thencloned as NdeI-BamHI fragments in pET19b (Novagen) andre-established in E coli XL-2 blue The polyhistidine-taggedproteins were expressed in E coli HMS174 (DE3) and puri-fied essentially as described (Mukamolova et al 1998) tosingle band purity by SDS-PAGE The appearance of cellextracts is shown in Fig 6C from which it is clear that theseproteins are subject to both aggregation and degradationwhen expressed as recombinant derivatives in E coli Anti-His tag antibodies (data not shown) also detect the variousbands detected by the anti-Rpf antibodies (Fig 6C) Exceptin the case of RpfB additional purification was by Mono Qchromatography RpfC (Rv1884c) and RpfD (Rv2389c)eluted as single peaks whereas RpfA (Rv0867c) and RpfE(Rv2450c) and M luteus Rpf (full length and truncated form)were present in several fractions (revealed by immunoblot-ting) one of which only was biologically active The activefraction was used for experiments Freshly isolated proteins(usually same day or next day) were used in all experimentsas activity is substantially reduced (1 log) during storage for1 week at 20infinC in 50 glycerol

Activity assay

Growth of M luteus and M smegmatis was monitored in aBioscreen C growth analyser (Labsystems Finland) using a600 nm filter Freshly prepared recombinant proteins diluted1 100 in the appropriate growth medium were sterilisedby filtration (022 mm Gelman) and then serially diluted ingrowth medium either 30- or 10-fold for assays with M luteusand M smegmatis respectively After breaking up aggregates(see above) late log cultures (OD600 = 35ndash40 for M luteusOD600 = 30ndash35 for M smegmatis) were serially diluted usinggrowth medium Samples (5 ml) of each dilution (five to tenreplicates) were added to wells containing medium (200 ml)together with serially diluted protein Incubation was at 30infinC(M luteus) or 37infinC (M smegmatis) with continuous shakingon the high setting Measurements were taken hourly for240 h Mycobacterium bovis (BCG) bioassays were in tubes(see above) inoculated with cells (102-106 cells per ml) fromcultures of different ages (10 days-5 month) Incubation wasat 37infinC without shaking and growth was monitored by directmeasurement (OD600) of the tube cultures or by plating

Antibody purification and Western blotting

Rabbits were immunized three times at 3-week intervals bysubcutaneous injection with 1 ml of a 50 (vv) mixture ofRpf (1 mg ml-1 in water) and incomplete Freunds adjuvant(Sigma) Serum was collected 10 days after the last immuni-zation and antibodies were purified by affinity chromatogra-phy [Rpf conjugated to CNBr-activated Sepharose 4B(Sigma)] Sheep antibodies to the truncated form of Rpf wereobtained commercially (Micropharm Newcastle Emlyn UK)and purified as above Both types of antibodies also detectedrecombinant versions of all five Rpf-like proteins of M tuber-culosis as well as various aggregated forms and degradationproducts (see Fig 6C for reactions to rabbit anti-Rpf anti-body) The rabbit antibodies were used for the experiments



shown in Fig 7 except the experiment in Fig 7A for whichimmunoglobulins purified from preimmune and immuneserum using G-protein Sepharose (Pharmacia) were used

For Western blotting 1 ml of a 3-week-old culture of Mbovis (BCG) Russian strain grown in Sautonrsquos mediumsupplemented with ADC and 005 Tween-80 was washedtwice with Sautonrsquos medium to remove traces of ADC andinoculated into 100 ml Sautonrsquos medium in a 500 ml flaskGrowth was for 3 weeks at 37infinC without shaking For Msmegmatis growth was for 16 h (overnight) with shaking inSautonrsquos medium (lacking ADC and Tween-80) A proteaseinhibitor cocktail was added to the cultures 30 min beforeharvesting and incorporated into all buffer solutions accord-ing to the manufacturerrsquos instructions (Roche) After centrif-ugation culture supernatants were filtered (022mm) andproteins present were concentrated using DEAE-Sepharose6B and CM cellulose column chromatography The DEAE-Sepharose 6B fast flow column equilibrated with buffer A(20 mM TrisHCl pH 75 20 mM KCl 1 mM EDTA 1 mMDTT) bound all detectable Rpf-like proteins The column waswashed with 5 yen vol buffer A and eluted with 3 yen vol buffer B(buffer A containing 1 M NaCl) Samples (1 ml) of the eluatewere precipitated with 10 TCA washed twice with acetonedried reconstituted in 20 ml loading buffer and used for SDSgel electrophoresisblotting Pre-stained size standards werefrom BioRad (cat no 161ndash0305) For the experiments shownin Fig 6 rabbit anti-Rpf antibodies were used similar datawere obtained with the sheep anti-truncated Rpf antibodies

Confocal microscopy

Cells from early logarithmic phase (OD600 = 025) grown inSautonrsquos medium supplemented with ADC and 005Tween-80 were centrifuged washed with PBS and fixed in01 glutaraldehyde in PBS for 30 min at 37infinC After wash-ing with PBS cells were incubated in PBS containing 5BSA for 30 min at 37infinC with shaking before treatment withsheep anti-truncated Rpf antibodies at 1 1000 dilution inPBS containing 2 BSA After incubation for 1 h at 37infinC withshaking cells were washed three times with PBS containing02 Tween-80 The bacteria were then incubated in PBScontaining 2 BSA and FITC-conjugated donkey anti-sheepIgG antibodies at a 1 500 dilution (Sigma cat no F7634)After washing (as described above) cells were examinedusing a BioRad MRC1024ES confocal microscope with exci-tation at 488 nm (100 mW argon laser)

Effect of anti-Rpf antibodies on bacterial growth

Mycobacterium bovis (BCG) (102 cfu from a 2-week-old cul-ture or 106 cfu from a 6-week-old culture) and M tuberculosisAcademia strain (105 cfu from a 2-month-old culture) wereinoculated into 3 ml Sautons medium supplemented withADC and 005 Tween-80 Rabbit anti-Rpf antibodies wereadded and growth was monitored by measuring the OD600For the experiment shown in Fig 7C a 20 ml culture wasestablished in a 100 ml conical flask without shaking andgrowth was monitored by plating on agar-solidified Sautonsmedium supplemented with ADC

Expression of rpf in M smegmatis

The rpf gene was introduced into M smegmatis under thecontrol of the Pami promoter (Parish et al 1997) in plasmidpAGM0 The construction of this plasmid and the vectorpAGH from which it is derived was described by (Muka-molova et al (2002) Plasmid pAGM1 is similar to pAGM0except that Pami generates a counter-transcript of rpf

Reverse transcriptase-PCR

Specific primer pairs were designed for each of the five rpf-like genes of M tuberculosis (the corresponding regions ofthe cognate genes in M bovis are identical) RT0867F (5centndashTATGAGTGGACGCCACCGTAA-3cent) + RT0867R(5centndashACTGCAAGCCACCGAGGTAAC3cent) RT1009F (5centAGGACCCGGAGATGAACATGA3cent) + RT1009R (5centGCACACCACCGTAATACCCGT-3cent) RT1884F (5cent-GCTTCTCGGGAACAACAAATC-3cent) + RT1884R (5cent-CGGAATACTTGCCTGAATGCC-3cent) RT2389F (5centndashGCTATGACACCGGGTTTGCTT-3cent) + RT2389R(5centndashGCAGACCACCGTATAACCCGT-3cent) RT2450F (5cent-GTTGAAGAACGCCCGTACGAC-3cent) + RT2450R (5cent-TTACCGGTGTTGATCGACCAG-3cent) RNA was prepared from 1 mlculture samples of M bovis (BCG) (OD600 = 03) using theRNeasy Mini Kit (Qiagen) and treated twice or three timeswith 10 U of RNAase-free DNAase I (Roche) for 30 min TheRNA from exponentially growing cells of M tuberculosisH37Rv was generously provided by P Butcher and J Man-gan Reverse transcription (25 ml) reactions contained 2 mgRNA 1 mg of the relevant reverse primer 40 U RNAsinribonuclease inhibitor (Promega) and 30 U AMV reversetranscriptase (Promega) Reactions (1 h) were performed at60infinC in the presence of 10 DMSO for templates containing71ndash74 G + C (RpfA RpfC and RpfD) and 1 M betaine fortemplates containing 83ndash85 G + C (RpfB and RpfE) Reac-tions were terminated by incubation at 75infinC for 5 min Controlreactions lacking AMV reverse transcriptase were performedsimultaneously For PCR reactions 2 ml samples of the RTreaction products were used as template in the presence ofboth primers Samples were denatured for 5 min at 94infinCfollowed by a single cycle of 30 s at 94infinC 30 s at 52infinC 60 sat 72infinC and then 29 cycles of 30 s at 94infinC 60 s at 72infinC NoPCR product was produced in any of the control reactions inwhich reverse transcriptase had been omitted from the pre-vious step nor when a treatment with RNAase preceded theinitial reverse transcription step

Acknowledgements

We thank R McAdam for providing M smegmatis strainmc2155 and DNA from M tuberculosis H37Rv P Butcherand J Mangan for M tuberculosis RNA S Biketov for rabbitanti-Rpf serum A Apt for M tuberculosis H37Rv culturesupernatant and S Taylor for assistance with the confocalmicroscopy We thank Sarah Hardy who constructed theplasmid expressing recombinant RpfB We are also mostgrateful to Mike Barer and an anonymous referee for theirconstructive comments on the manuscript This work wassupported by grants from the UK BBSRC the RussianFoundation for Basic Research (grant 00-04-48691) the



WHO Global Programme for Vaccines and Immunizationand the Wellcome Trust Some of the experiments were car-ried out when OAT was in receipt of a Royal SocietyNATOFellowship

References

Aldovini A Husson RN and Young RA (1993) The uraAlocus and homologous recombination in Mycobacteriumbovis BCG J Bacteriol 175 7282ndash7289

Arruda S Bomfim G Knights R Huimabyron T andRiley LW (1993) Cloning of a Mycobacterium tuberculo-sis DNA fragment associated with entry and survival insidecells Science 261 1454ndash1457

Bateman A and Bycroft M (2000) The structure of a LysMdomain from E coli membrane-bound lytic murein transg-lycosylase D (MltD) J Mol Biol 299 1113ndash1119

Behr MA Wilson MA Gill WP Salamon H SchoolnikGK Rane S and Small PM (1999) Comparativegenomics of BCG vaccines by whole-genome DNAmicroarray Science 284 1520ndash1523

Biketov S Mukamolova GV Potapov V Gilenkov EVostroknutova G Kell DB Young M and KaprelyantsAS (2000) Culturability of Mycobacterium tuberculosiscells isolated from murine macrophages a bacterial growthfactor promotes recovery FEMS Immunol Med Microbiol29 233ndash240

Bloom BR and Murray CJL (1992) Tuberculosis ndash com-mentary on a reemergent killer Science 257 1055ndash1064

Callard R and Gearing A (1994) The Cytokine Facts BookLondon Academic Press

Chambers SP Prior SE Barstow DA and Minton NP(1988) The pMTL nic- cloning vectors 1 Improved pUCpolylinker regions to facilitate the use of sonicated DNA fornucleotide sequencing Gene 68 139ndash149

Clewell DB (1993) Bacterial sex pheromone-induced plas-mid transfer Cell 73 9ndash12

Cole ST Brosch R Parkhill J Garnier T Churcher CHarris D et al (1998) Deciphering the biology of Myco-bacterium tuberculosis from the complete genomesequence Nature 393 537ndash544

Connell ND (1994) Mycobacterium isolation maintenancetransformation and mutant selection Methods Cell Biol45 107ndash125

Dubos RJ and Davis BD (1946) Factors affecting thegrowth of tubercle bacilli in liquid media J Exp Med 83409ndash423

Dye C Scheele S Dolin P Pathania V and RaviglioneRC (1999) Consensus statement Global burden of tuber-culosis ndash estimated incidence prevalence and mortality bycountry WHO Global Surveillance Monitoring ProjectJAMA 282 677ndash686

Flynn JL and Chan J (2001) Tuberculosis latency andreactivation Infect Immun 69 4195ndash4201

Franklin TJ (1980) Binding energy and the activation ofhormone receptors Biochem Pharmacol 29 853ndash856

Fuqua C and Greenberg EP (1998) Self perception inbacteria quorum sensing with acylated homoserine lac-tones Curr Opin Microbiol 1 183ndash189

Fuqua WC Winans SC and Greenberg EP (1994)

Quorum sensing in bacteria the LuxR-LuxI family of celldensity-responsive transcriptional regulators J Bacteriol176 269ndash275

Fuqua C Winans SC and Greenberg EP (1996) Cen-sus and consensus in bacterial ecosystems the LuxR-LuxIfamily of quorum-sensing transcriptional regulators AnnuRev Microbiol 50 727ndash751

Gero A (1983) Desensitization two-state receptors andpharmacological parameters J Theoret Biol 103 137ndash161

Gomez L Johnson S and Gennaro ML (2000) Identifi-cation of secreted proteins of Mycobacterium tuberculosisby a bioinformatic approach Infect Immun 68 2323ndash2327

Hernandez-Pando R Jeyanathan M Mengistu GAguilar D Orozco H Harboe M Rook GAW andBjune G (2000) Persistence of DNA from Mycobacteriumtuberculosis in superficially normal lung tissue during latentinfection Lancet 356 2133ndash2138

Houmlner zu Bentrup K and Russell DG (2001) Mycobacte-rial persistence adaptation to a changing environmentTrends Microbiol 9 597ndash605

Horinouchi S and Beppu T (1994) A-factor as a microbialhormone that controls cellular differentiation and second-ary metabolism in Streptomyces griseus Mol Microbiol 12859ndash864

Kaiser D and Losick R (1993) How and why bacteria talkto each other Cell 73 873ndash885

Kaprelyants AS and Kell DB (1993) Dormancy instationary-phase cultures of Micrococcus luteus flow cyto-metric analysis of starvation and resuscitation Appl Envi-ron Microbiol 59 3187ndash3196

Kaprelyants AS and Kell DB (1996) Do bacteria need tocommunicate with each other for growth Trends Microbiol4 237ndash242

Kaprelyants AS Gottschal JC and Kell DB (1993) Dor-mancy in non-sporulating bacteria FEMS Microbiol Rev104 271ndash286

Kaprelyants AS Mukamolova GV and Kell DB (1994)Estimation of dormant Micrococcus luteus cells by penicil-lin lysis and by resuscitation in cell-free spent medium athigh dilution FEMS Microbiol Lett 115 347ndash352

Kaprelyants AS Mukamolova GV Kormer SSWeichart DH Young M and Kell DB (1999) Intercel-lular signalling and the multiplication of prokaryotes bac-terial cytokines Symp Soc Gen Microbiol 57 33ndash69

Kell DB Kaprelyants AS and Grafen A (1995) Phero-mones social behaviour and the functions of secondarymetabolism in bacteria Trends Ecol Evol 10 126ndash129

Kell DB and Young M (2000) Bacterial dormancy andculturability the role of autocrine growth factors Curr OpinMicrobiol 3 238ndash243

Kell DB Kaprelyants AS Weichart DH Harwood CLand Barer MR (1998) Viability and activity in readily cul-turable bacteria a review and discussion of the practicalissues Antonie Van Leeuwenhoek 73 169ndash187

Kleerebezem M Quadri LEN Kuipers OP and de VosWM (1997) Quorum sensing by peptide pheromones andtwo-component signal-transduction systems in Gram-positive bacteria Mol Microbiol 24 895ndash904

Lazazzera BA and Grossman AD (1998) The ins andouts of peptide signaling Trends Microbiol 6 288ndash294

Lim A Eleuterio M Hutter B Murugasu-Oei B and Dick



T (1999) Oxygen depletion-induced dormancy in Myco-bacterium bovis BCG J Bacteriol 181 2252ndash2256

McCune RM Feldman FM Lambert H and McDermottW (1966) Microbial persistence I The capacity of tuberclebacilli to survive sterilization in mouse tissues J Exp Med123 224ndash268

McDermott W (1958) Microbial persistence Yale J Biol Med30 257

Manganelli R Voskuil MI Schoolnik GK and Smith I(2001) The Mycobacterium tuberculosis ECF sigma factorsE role in global gene expression and survival in macroph-ages Mol Microbiol 41 423ndash437

Mukamolova GV Kormer SS Yanopolskaya ND andKaprelyants AS (1995) Properties of dormant cells instationary-phase cultures of Micrococcus luteus duringprolonged incubation Microbiology 64 284ndash288

Mukamolova GV Kaprelyants AS Young DI Young Mand Kell DB (1998) A bacterial cytokine Proc Natl AcadSci USA 95 8916ndash8921

Mukamolova GV Kormer SS Kell DB andKaprelyants AS (1999) Stimulation of the multiplicationof Micrococcus luteus by an autocrine growth factor ArchMicrobiol 172 9ndash14

Mukamolova GV Turapov OA Kazaryan K Telkov MKaprelyants AS Kell DB and Young M (2002) The rpfgene of Micrococcus luteus encodes an essential secretedgrowth factor Mol Microbiol 46 611ndash621

Ohnishi Y Kameyama S Onaka H and Horinouchi S(1999) The A-factor regulatory cascade leading to strepto-mycin biosynthesis in Streptomyces griseus identificationof a target gene of the A-factor receptor Mol Microbiol 34102ndash111

Pai SR Actor JK Sepulveda E Hunter RL Jr andJagannath C (2000) Identification of viable and non-viableMycobacterium tuberculosis in mouse organs by directedRT-PCR for antigen 85B mRNA Microb Pathog 28 335ndash342

Parish T Mahenthiralingam E Draper P Davis EO andColston MJ (1997) Regulation of the inducible acetami-dase gene of Mycobacterium smegmatis Microbiology143 2267ndash2276

Parrish NM Dick JD and Bishai WR (1998) Mecha-nisms of latency in Mycobacterium tuberculosis TrendsMicrobiol 6 107ndash112

Salmond GPC Bycroft BD Stewart GSAB andWilliams P (1995) The bacterial lsquoenigmarsquo cracking thecode of cell-cell communication Mol Microbiol 16 615ndash624

Sherman DR Voskuil M Schnappinger D Liao RHarrell MI and Schoolnik GK (2001) Regulation of theM tuberculosis hypoxic response gene alpha-crystallinProc Natl Acad Sci USA 98 7534ndash7539

Shleeva MO Bagramyan K Telkov MV MukamolovaGV Young M Kell DB and Kaprelyants AS (2002)Formation and resuscitation of lsquonon-culturablersquo cells ofRhodococcus rhodochrous and Mycobacterium tuberculo-sis in prolonged stationary phase Microbiology 148 1581ndash1591

Sun Z and Zhang Y (1999) Spent culture supernatant ofMycobacterium tuberculosis H37Ra improves viability ofaged cultures of this strain and allows small inocula toinitiate growth J Bacteriol 181 7626ndash7628

Votyakova TV Kaprelyants AS and Kell DB (1994)Influence of viable cells on the resuscitation of dormantcells in Micrococcus luteus cultures held in extended sta-tionary phase The population effect Appl Env Microbiol60 3284ndash3291

Wayne LG (1960) The bacteriology of resected tuberculouspulmonary lesions II Observations on bacilli which arestainable but which cannot be cultured Am Rev Resp Dis82 370ndash377

Wayne LG (1984) Mycobacterial speciation In The Myco-bacteria a Sourcebook Kubica GP and Wayne LG(eds) New York Marcel Dekker pp 25ndash65

Wayne LG (1994) Dormancy of Mycobacterium tuberculo-sis and latency of disease Eur J Clin Microbiol Infect Dis13 908ndash914

Wayne LG and Sohaskey CD (2001) Nonreplicating per-sistence of Mycobacterium tuberculosis Annu Rev Micro-biol 55 139ndash163

de Wit D Wootton M Dhillon J and Mitchison DA(1995) The bacterial DNA content of mouse organs in theCornell model of dormant tuberculosis Tuber Lung Dis 76555ndash562

Young DB and Duncan K (1995) Prospects for new inter-ventions in the treatment and prevention of mycobacterialdisease Annu Rev Microbiol 49 641ndash673

Yuan Y Crane DD and Barry CE III (1996) Stationaryphase-associated protein expression in Mycobacteriumtuberculosis function of the mycobacterial alpha-crystallinhomolog J Bacteriol 178 4484ndash4492

Zhang Y Yang Y Woods A Cotter RJ and Sun Z(2001) Resuscitation of dormant Mycobacterium tubercu-losis by phospholipids or specific peptides Biochem Bio-phys Res Commun 284 542ndash547

624

G V Mukamolova

et al



46

623ndash635

1992 Dye

et al

1999) The phenomenon of persistencehas long been recognised (McDermott 1958 Wayne1960 McCune

et al

1966) but it remains poorly under-stood (Young and Duncan 1995 Parrish

et al

1998Wayne and Sohaskey 2001) It is generally agreed thatthe immune system plays an important role in preventingnet bacterial multiplication (Flynn and Chan 2001) butother aspects of the biology of the persisting organismsremain controversial Some evidence suggests that theymay be metabolically active (reviewed by Houmlner zuBentrup and Russell 2001) whereas there is also evi-dence that they have become dormant or have lost cul-turability (Wayne 1960 1994) The presence of

rpf

-likegenes in these mycobacteria raises the possibility that (alack of) their products may be involved in controlling bac-terial growth

in vivo

Persisting organisms in the latentstate may require one or more of these proteins in orderto re-activate To illuminate these suggestions we haveisolated recombinant forms of the five

rpf

-like proteins of

M tuberculosis

and tested their activities using severaldifferent organisms

Results

Comparison of the five

rpf-

like genes of M tuberculosis

The predicted products of the five

rpf

-like genes of

Mtuberculosis

share with Rpf a conserved

~

70-residuesegment (Fig 1A) Rpf is a secreted protein Thereforethe SignalP and TMMHM servers at the Technical Univer-sity of Denmark (httpwwwcbsdtudkservicesSignalPand httpwwwcbsdtudkservicesTMHMM-20) wereused to determine whether the five Rpf-like proteins of

Mtuberculosis

are also likely to be secreted Two of them

RpfA (Rv0867c 407 aa) and RpfD (Rv2389c 154 aa)were predicted to be secreted proteins ndash see also Gomez

et al

(2000) RpfA is a comparatively large protein inwhich the Rpf-like segment is followed by an extensiveseries (residues 146ndash320) of proline

+

alanine-richrepeats with the consensus sequence APADLAPP TheRpfB protein (Rv1009 362 aa) has its Rpf-like domain atthe C-terminus RpfB is probably anchored to the outersurface of the cell membrane by an N-terminal prokaryoticmembrane lipoprotein lipid attachment site (PrositePS00013) Residues 1ndash117 of RpfB share similarity withthe N-terminal Mce domain (PF02470) that is found in allsix predicted products of the multiple

mce

operons of

Mtuberculosis

at least one of which (

mce1

Rv0169) isinvolved in entry into and survival inside macrophages(Arruda

et al

1993) The status of the remaining two Rpf-like gene products is less clear Although RpfC (Rv 1884c176 aa) is not predicted to contain a

trans

-membrane helixnear its N-terminus a secretory signal sequence waspredicted using a neural network (httpwwwcbsdtudkservicesSignalP) trained on Gram-positive signalsequences RpfE (Rv2450c 172 aa) has a weakly pre-dicted

trans

-membrane helix close to its N-terminuswhereas the presence of a signal sequence was quitestrongly predicted Thus some of these five proteins areprobably secreted whereas others may be anchored inthe cytoplasmic membrane In common with Rpf they allprobably have extra-cytoplasmic functions

The various

rpf

-like genes (Fig 1B) are scatteredabout the

M tuberculosis

genome (Cole

et al

1998) The

rpfA

and

rpfE

genes appear to comprise monocistronicoperons the former lying within a cluster of genes con-cerned with molybdopteroate biosynthesis There is a

Fig 1

A Schematic alignment of the five Rpf-like gene products of

M tuberculosis

The predicted (httpwwwcbsdtudkservicesSignalP) signal sequence cleavage sites and the numbers of the first predicted residues of the mature secreted proteins are also indicatedB The chromosomal context of each gene (httpgenolistpasteurfrTubercuList) The approximate co-ordinates (kbp) of each segment are also given





46

623ndash635

Fig 2


M tuberculosis


M luteus

(A) and

M smegmatis


plusmn


plusmn

4 h (

M luteus

) and 74

plusmn

4 h (

M smegmatis

)


cent

end of

rpfB

and

ksgA


rpfD


hemN

and

nirA


rpfC


fbpB




M tuberculosis




M luteus

and

Msmegmatis


et al

1998) All four

M tuberculosis


Mluteus


M smegmatis



Mluteus


m


M luteus



Msmegmatis































Discussion
















Organisms and media












Activity assay








Confocal microscopy








Acknowledgements





References




































































46

623ndash635

Fig 2


M tuberculosis


M luteus

(A) and

M smegmatis


plusmn


plusmn

4 h (

M luteus

) and 74

plusmn

4 h (

M smegmatis

)


cent

end of

rpfB

and

ksgA


rpfD


hemN

and

nirA


rpfC


fbpB




M tuberculosis




M luteus

and

Msmegmatis


et al

1998) All four

M tuberculosis


Mluteus


M smegmatis



Mluteus


m


M luteus



Msmegmatis































Discussion
















Organisms and media












Activity assay








Confocal microscopy








Acknowledgements





References


























































































Discussion
















Organisms and media












Activity assay








Confocal microscopy








Acknowledgements





References










































































Organisms and media












Activity assay








Confocal microscopy








Acknowledgements





References








































































Activity assay








Confocal microscopy








Acknowledgements





References




































































Confocal microscopy








Acknowledgements





References



































































References
































































a family of autocrine growth factors in mycobacterium...

Documents