a designer cross-reactive dna immunotherapeutic vaccine that targets multiple … · translational...

Translational Cancer Mechanisms and Therapy

A Designer Cross-reactive DNAImmunotherapeutic Vaccine that Targets MultipleMAGE-A Family Members Simultaneously forCancer TherapyElizabeth K. Duperret1, Shujing Liu2, Megan Paik1, Aspen Trautz1, Regina Stoltz1,Xiaoming Liu2, Kan Ze2, Alfredo Perales-Puchalt1, Charles Reed3, Jian Yan3,Xiaowei Xu2, and David B.Weiner1

Abstract

Purpose: Cancer/testis antigens have emerged as attrac-tive targets for cancer immunotherapy. Clinical studieshave targeted MAGE-A3, a prototype antigen that is amember of the MAGE-A family of antigens, in melanomaand lung carcinoma. However, these studies have not yethad a significant impact due to poor CD8þ T-cell immu-nogenicity, platform toxicity, or perhaps limited targetantigen availability. In this study, we develop an improvedMAGE-A immunogen with cross-reactivity to multiple fam-ily members.

Experimental Design: In this study, we analyzed MAGE-Aexpression in The Cancer Genome Atlas and observed thatmany patients express multiple MAGE-A isoforms, not lim-ited to MAGE-A3, simultaneously in diverse tumors. On thebasis of this, we designed an optimized consensus MAGE-ADNA vaccine capable of cross-reacting with many MAGE-Aisoforms, and tested immunogenicity and antitumor activity

of this vaccine in a relevant autochthonous melanomamodel.

Results: Immunization of this MAGE-A vaccine by electro-poration in C57Bl/6 mice generated robust IFNg and TNFaCD8þ T-cell responses aswell as cytotoxic CD107a/IFNg/T-bettriple-positive responses against multiple isoforms. Further-more, this MAGE-A DNA immunogen generated a cross-reactive immune response in 14 of 15 genetically diverse,outbred mice. We tested the antitumor activity of thisMAGE-A DNA vaccine in Tyr::CreER;BRAFCa/þ;Ptenlox/lox trans-genic mice that develop melanoma upon tamoxifen induc-tion. The MAGE-A DNA therapeutic vaccine significantlyslowed tumor growth and doubled median mouse survival.

Conclusions: These results support the clinical use of con-sensus MAGE-A immunogens with the capacity to targetmultiple MAGE-A family members to prevent tumor immuneescape. Clin Cancer Res; 24(23); 6015–27. �2018 AACR.

IntroductionTherapeutic cancer vaccines are receiving increasing interest

for treatment of various types of cancer, in particular forpatients who do not have naturally occurring antitumor immu-nity, or who do not benefit from immune checkpoint blockade(ICB) therapy. However, identifying appropriate antigens withtumor-restricted expression, high potential for immunogenicityin humans, and high expression in multiple tumor types hasremained challenging.

In the early 1990s, the MAGE-1, melanoma antigen-1 (now re-namedMAGE-A1), protein was the first cancer antigen discoveredto be recognized by cytolytic T lymphocytes in a human mela-noma patient (1). Subsequently, 10 additional MAGE-A familymembers were identified in various human cancers, all of whichhave no or low expression in normal human tissues, with theexception of the placenta and non-MHC–presenting germ cells ofthe testis (2–4). Because of this restricted expression, theMAGE-Afamily represents an ideal immune therapy target. Furthermore,because of this restricted expression it may less subject to tissue-specific immune tolerance, making it easier to generate a robustimmune response against this family of antigens. In support ofthis concept, T lymphocytes specific for both class I and II epitopesof various MAGE-A family members have been identified inpatients with cancer (1, 5–10).

The attractiveness of the MAGE family for cancer immunetherapy has resulted in the initiation of several clinical trials forvaccines targeting a common family member MAGE-A3. Thisspecific isoform was chosen for clinical study because it wasthought at the time to have the highest expression comparedwith other isoforms in various solid tumors (11). Efforts to targetMAGE-A3 have utilized vaccination with a recMAGE-A3 recom-binant protein formulation or cellular therapies using CD8þ

T cells engineered to express a high-affinity MAGE-A3-targeted

1Vaccine & Immunotherapy Center, The Wistar Institute, Philadelphia, Pennsyl-vania. 2Department of Pathology and Laboratory Medicine, University ofPennsylvania, Philadelphia, Pennsylvania. 3Inovio Pharmaceuticals, PlymouthMeeting, Pennsylvania.

Note: Supplementary data for this article are available at Clinical CancerResearch Online (http://clincancerres.aacrjournals.org/).

CorrespondingAuthor:DavidB.Weiner, Vaccine & Immunotherapy Center, TheWistar Institute, 3601 Spruce Street, Philadelphia, PA 19104. Phone: 215-898-0381; Fax: 215-573-9436; E-mail: [email protected]

doi: 10.1158/1078-0432.CCR-18-1013

�2018 American Association for Cancer Research.

ClinicalCancerResearch

www.aacrjournals.org 6015

Cancer Research. by guest on August 28, 2020. Copyright 2018 American Association forhttps://bloodcancerdiscov.aacrjournals.orgDownloaded from

http://crossmark.crossref.org/dialog/?doi=10.1158/1078-0432.CCR-18-1013&domain=pdf&date_stamp=2018-11-13

https://bloodcancerdiscov.aacrjournals.org

TCR. While the recMAGE-A3 vaccine was capable of inducingclear humoral responses in patients with cancer, the vaccineproduced poor CD8þ T-cell responses and ultimately failed todemonstrate efficacy in a phase III clinical trial of non–small celllung cancer (12–14). In contrast, the MAGE-A3 TCR cellulartherapy demonstrated antitumor activity in several patients; how-ever, this therapy exhibited unexpected off-tumor toxicity result-ing in several patient deaths in early-stage clinical trials (15–17).Thus, development of therapies targeting antigens in theMAGE-Afamily driving a more robust T-cell response, but exhibiting abetter safety profile, is of high priority.

Peptide or DNA vaccination approaches for targeting theMAGE-A family members may represent important tools inthis regard (18, 19). Several peptides targeting variousshared MAGE-A epitopes have been tested in a preclinicalor clinical setting, and have shown some induction of lim-ited T-cell responses as well as patient-specific clinicalresponses (7, 20). However, these peptides are HLA-restrict-ed and accordingly this strategy is limited to a subset ofpatients. Clinical trials utilizing optimized synthetic DNAwith improved electroporation technology have shown clin-ical responses and promise for targeting infectious diseaseand virally driven cancers (21, 22). Synthetic DNA vaccinesalso have the advantage of encoding entire antigens, insteadof individual peptides, to generate a broader HLA response.Another important advantage of this platform is the abilityto design consensus immunogens to induce cross-reactiveimmune responses against similar, conserved strains ofviruses (23). In the cancer setting, this consensus designstrategy can be adapted here to help break tolerance againstself-antigens (24, 25).

In this study,we thoroughly examined expressionof theMAGE-A family members in The Cancer Genome Atlas (TCGA) anddiscovered that all MAGE-A isoforms, not just MAGE-A3 aspreviously thought, are highly expressed in human cancers. Inaddition, a high proportion of patients, particularly those withmelanoma, exhibit simultaneous expression ofmultiple isoformswithin the same tumor sample. We took advantage of the uniquegenetic relationships within the MAGE-A family of proteins anddesigned an optimized consensus DNA vaccine capable of target-

ing multiple MAGE-A family members simultaneously. We showthat this vaccine is effective at inducing a robust immune responseagainstmultipleMAGE-A familymembers, and at reducing tumorburden and driving CD8þ T cells to tumors in an autochthonousmousemelanomamodel. This optimized, cross-reactiveMAGE-Aimmunogen likely has a significant advantage compared withpreviously designed MAGE-A3–specific immunotherapies.

Materials and MethodsCell culture and transfection

293T cells were purchased fromATCCand YUMM1.7 cells werea gift from Dr. Ashani Weeraratna at The Wistar Institute (Phila-delphia, PA). These cells were maintained in DMEM supplemen-ted with 10% FBS. These cell lines were routinely tested forMycoplasma contamination, and were maintained at low passage(<20 passages) in cell culture. 293T cells were transfected with theindicated constructs using the GeneJammer transfection reagentaccording to the manufacturer's guidelines (Agilent). Cells wereharvested using RIPA lysis buffer (Cell Signaling Technology)supplemented with EDTA-free protease inhibitor (Roche) foranalysis by Western blot analysis, or were harvested using theRNeasy Plus Mini Kit (QIAGEN) for RNA extraction.

DNA plasmidsThe synthetic mouse consensus MAGE-A sequence was gener-

ated by aligning mouse MAGE-A1, mouse MAGE-A2, mouseMAGE-A3, mouse MAGE-A5, mouse MAGE-A6, and mouseMAGE-A8 amino acid sequences using ClustalX2. The synthetichuman MAGE-A consensus #1 sequence was generated by align-ing human MAGE-A2, human MAGE-A3, human MAGE-A6, andhuman MAGE-A12 amino acid sequences using ClustalX2. Thesynthetic human MAGE-A consensus #2 sequence was generatedby aligning human MAGE-A1, human MAGE-A4, and humanMAGE-A5 amino acid sequences using ClustalX2. All sequenceswere RNA and codon optimized, with a Kozak sequence and anIgE leader sequence added at the N terminus. All plasmids werecloned into the modified pVax1 vector by GenScript. The per-centage homology between sequences was calculated usingMega6. Comparative models of the defined MAGE-A consensussequences were built using the MODELLER algorithm (26),implemented in Discovery Studio (Biovia). Sequences were ana-lyzed using the PONDR algorithm to predict potential intrinsi-cally disordered regions prior to model building (27).

Western blot analysisA total of 4%–12% Bis-Tris NuPAGE gels (Thermo Fisher

Scientific) and polyvinylidene difluoride membranes (Millipore)were used for Western blot analysis. Odyssey blockingbuffer reagents were used for blocking primary and secondaryantibody incubations. The following primary antibodies wereused: anti-Actin AC-15 (Sigma, 1:1000), anti-MAGE-A (6C1,Santa Cruz Biotechnology, 1: 200), and anti-FLAG (M2, Sigma,1:500). The following secondary antibodies were used: IRDye680RD goat anti-mouse and IRDye 800CW goat anti-rabbit(LI-COR Biosciences). The membrane was imaged using theLI-COR Odyssey CLx.

RNA extraction and qPCRRNA extraction was performed using a QIAGEN RNeasy Plus

Mini Kit. RNA was converted to cDNA using the Applied

Translational Relevance

Clinical efforts to target the MAGE-A family of cancer/testis antigens, which are overexpressed in tumors and havelow expression in normal tissues, thus far have focused onthe MAGE-A3 family member. In this study, we show, usingdata from The Cancer Genome Atlas, that expression of allMAGE-A family members is high in a variety of differenttumor types. Importantly, multiple MAGE-A isoforms areoften expressed within the same tumor. We generated across-reactive consensus MAGE-A immunogen that wascapable of targeting most MAGE-A family members, anddemonstrate robust immunogenicity and antitumor activityof this immunogen in a transgenic melanoma model. Thisunique vaccine design may have important clinical benefitfor patients expressing multiple MAGE-A family members inpreventing tumor progression.

Duperret et al.

Clin Cancer Res; 24(23) December 1, 2018 Clinical Cancer Research6016



BiosystemsHighCapacity RNA to cDNA kit. qPCRwas performedusing Power SYBR Green on an ABI 7900 Fast RT PCR machine.Expression levels are expressed in terms of 2�DCt (DCt is comparedwith the GAPDH control). The following qPCR primers wereused for these studies: pan-mouse MAGE: CCACCTCAAA-TAAAGTGTATGGCA (F), ACCAGAAAGTCCACCAAGTCA (R),mouse MAGE-A consensus: GCCACCATGGATTGGACTTG (F),TGGCCATTGTCTCCTGATCG (R), human MAGE-A consensus#1: GTTTGCACACCCCAGAAAGC (F), GGGTGGGTAGCTGATG-TGAG (R), humanMAGE-A consensus #2: TGGCAGATCTGGTG-CACTTT (F), TTCACGTCGATGCCGAAGAT (R), and GAPDH:CCTGCACCACCAACTGCTTA (F), AGTGATGGCATGGACTGT-GGT (R).

Mice and immunizationC57Bl/6 and CD-1 outbred mice were acquired from Jackson

Laboratories and housed at The Wistar Institute. The Tyr::CreER;BrafCa/þ; Ptenlox/lox transgenic mice were generated by Drs.Bosenberg and McMahon (University of California, San Fran-cisco, CA) and housed at the University of Pennsylvania (Phi-ladelphia, PA; ref. 28). Genotyping of the mice was performedas described previously (29). For tumor induction, 6- to 8-week-old mice were treated topically with a 5 mmol/L 4-hydroxytamoxifen (4-HT, Sigma) solution on the flank toinitiate tumor formation (28). For tumor measurements, thefollowing formula was used: volume ¼ a � b � c/2, where a ¼maximum length, b ¼maximum width, and c ¼ thickness (30).Mice were euthanized when they achieved the standard bodycondition score (multiple tumor spots with maximum lengthof 30 mm). For immunization, mice were injected with 30 mL ofDNA (25 mg per mouse) into the tibialis anterior (TA) muscle,followed by electroporation using the CELLECTRA-3P device(Inovio Pharmaceuticals). Mice were delivered two 0.1-Ampelectric constant current square-wave pulses for each immuni-zation. The vaccine schedule is indicated in each figure legend.For subcutaneous YUMM1.7 implantation studies, 2� 105 cellswere implanted into the flank of each mouse. For in vivodepletion experiments, mice were given 200 mg of either isotypecontrol antibody (rat IgG2b, anti-keyhole limpet hemocyanin)or CD8 depletion antibody (clone YTS 169.4, BioXCell) intra-peritoneally. Tumor volume for subcutaneous tumors wascalculated using the formula: volume ¼ (p/6) � (height) �(width2). Mice were euthanized when tumor diametersexceeded 1.5 cm. All animal procedures were done underapproval from either the Wistar or University of PennsylvaniaInstitute Animal Care and Use Committee (IACUC) and theNIH (Bethesda, MD).

Splenocyte and tumor-infiltrating lymphocyte isolationAfter mice were euthanized, spleens and tumor tissues (if

applicable) were collected in RPMI medium supplementedwith 10% FBS. Spleens were processed using a stomacher, redblood cells were lysed using ACK lysis buffer (Life Technolo-gies), and the remaining cells were filtered through a 40-mmfilter. Tumors were minced using a scalpel, and incubated in atumor dissociation enzyme mix consisting of: 170 mg/L col-lagenase I, II and IV (Thermo Fisher Scientific), 12.5 mg/LDNAse I (Roche), 25 mg/L Elastase (Worthington) in 50%RPMI þ 10% FBS and 50% Hyclone L-15 Leibowitz medium(Thermo Fisher Scientific). Tumors were incubated in thismixture with end-over-end mixing for 1 hour at 37�C, and

then filtered twice through a 40-mm filter prior to plating forstaining.

ELISpot assayMABTECH Mouse IFNg ELISpotPLUS plates were used for

ELISpot analysis. A total of 2 � 105 splenocytes were plated perwell and stimulated for 18–24 hours with 5 mg/mL of peptides(15-mer peptides overlapping by 9 amino acids) in RPMI þ 10%FBS. Spots were developed according to the manufacturer'sinstructions, and quantified using an ImmunoSpot CTL reader.Spot-forming units (SFU) were calculated by subtracting mediaalone wells from the peptide-stimulated wells. Concanavalin Astimulation was used as a positive control to ensure proper spotdevelopment.

Intracellular cytokine staining and flow cytometrySplenocytes were stimulated in the presence of 5 mg/mL pep-

tide, Protein Transport Inhibitor Cocktail (eBioscience) and FITCa-mouse CD107a (clone 1D4B, Biolegend) for 5–6 hours.Cell stimulation cocktail was used as a positive control forstimulation instead of peptide. Tumor-infiltrating lymphocytes(TIL)were stained directly without stimulation. After stimulation,cells were washed and incubated with LIVE/DEAD violet. Cellswere then incubated with surface stain (in 1% FBS in PBS) for 30minutes at room temperature, followed by fixation and permea-bilization (BD Biosciences) for 15 minutes at 4�C. After permea-bilization, cells were washed and incubated in intracellular stain(in fixation/permeabilization wash buffer) for 1 hour at 4�C. Thefollowing antibodies were used for analysis: PECy5 aCD3 (clone145-2C11, BD Pharmingen), BV510 aCD4 (clone RM4-5, Bio-Legend), BV605 aTNFa (clone MP6-XT22), PE aT-bet (clone4B10, BioLegend), APCCy7 aCD8 (clone 53-6.7, BioLegend),AF700 aCD44 (clone IM7, BioLegend), APC aIFNg (cloneXMG1.2, BioLegend), FITC aCD45 (30-F11, BioLegend), BV711aPD-1 (clone 29F.1A12, BioLegend), PECy7 aCD25 (PC61.5,eBioscience), and APC aFoxP3 (clone FJK-16s, eBioscience). Alldata were collected on an LSR18 flow cytometer (BD Biosciences)and analyzed using FlowJo software (TreeStar). For analysis,media alone control wells were subtracted from peptide-contain-ing wells for antigen-specific immune responses.

Immunofluorescence/IHC stainingHematoxylin and eosin staining was performed according

to standard protocols from tissue that was fixed in 10% neu-tral-buffered formalin and paraffin-embedded. For immunofluo-rescence staining, tissues were collected in optimal cutting tem-peraturemedium (Tissue-Tek) on dry ice and stored at�80�C. ForCD8, CD31, and Ly6G staining, frozen tissue was fixed on slideswith 4% paraformaldehyde (in PBS) for 15 minutes at roomtemperature, and then permeabilized with 0.5% Triton X-100for 15 minutes at room temperature. The tissue was blocked for1 hour at room temperature with 2.5% BSA and 5% horse serumin PBS. The Avidin/Biotin Blocking Kit (Vector Laboratories)was also used to reduce background staining. Primary antibody(CD8a-biotin, 53-6.7 Abcam, 1:2,000; CD31, ab124432, 1:800;Ly6G-biotin, RB6-8C5 Abcam, 1:2,000) in 1% horse serum in PBSwas incubated overnight at 4�C in a humidified chamber. Thenext day, the TSA-Biotin kit (Perkin Elmer) was used for signalamplification for the biotinylated primary antibodies, and slideswere incubated in secondary antibody (Streptavidin AF488,1:500, or goat anti-rabbit AF594 1:300) for 30 minutes at room

DNA Vaccine Targeting Multiple MAGE-A Isoforms

www.aacrjournals.org Clin Cancer Res; 24(23) December 1, 2018 6017



temperature. Slides were mounted with Prolong Gold Antifadewith DAPI. Staining of paraffin-embedded tissues was performedby the Wistar Histotechnology Facility. Slides were imaged with aNikon 80i upright microscope at The Wistar Institue or a ZeissLSM Confocal microscope at the University of Pennsylvania Celland Developmental Biology Microscopy Core. Image analysis wasperformed using Photoshop or Fiji/ImageJ software.

TCGA data analysisRNA-seq data (RSEM values) from TCGA were downloaded

through the GDAC data portal (https://gdac.broadinstitute.org/).All samplesmarked asmatchednormalwerefiltered and includedin the normal tissue control group (n ¼ 754). The followinghuman tumor types were analyzed: ACC (n ¼ 79), BLCA (n ¼408), BRCA (n¼ 1100), CESC (n¼ 306), COADREAD (n¼ 382),DLBC (n¼ 48), ESCA (n¼ 185), GBM (n¼ 166), GBMLGG (n¼696), HNSC (n¼ 522), KIPAN (n¼ 891), LAML (n ¼ 173), LGG(n ¼ 530), LIHC (n ¼ 372), LUAD (n ¼ 518), LUSC (n ¼ 501),MESO (n¼ 87),OV (n¼ 307), PAAD (n¼ 179), PCPG (n¼ 184),PRAD (n ¼ 498), READ (n ¼ 72), SARC (n ¼ 263), SKCM (n ¼472), STAD (n ¼ 415), STES (n ¼ 600), TGCT (n ¼ 156), THCA(n¼ 509), THYM (n¼ 120), UCEC (n¼ 370), UCS (n¼ 57), andUVM (n ¼ 80). We set the threshold for expression to be greaterthan 2 SDs above the mean for the normal tissue for eachMAGE-A isoform.

Statistical analysisAll statistical analysis was done using GraphPad Prism soft-

ware. All error bars represent the mean � the SEM. Statisticalsignificance was determined by a two-tailed t test for experimentswith only two experimental groups, or a one-way ANOVA fol-lowed by Tukey post hocHSD test for experiments with more thantwo experimental groups. For tumor growth over time, multiple ttests were performed for each time point. For mouse survivalanalysis, significance was determined using a Gehan–Brelow–Wilcoxon test.

ResultsMAGE-A isoform expression in human tumors

Various MAGE-A family members have shown to be upregu-lated in many different human cancers at the protein level,including non–small cell lung cancer, melanoma, breast cancer,ovarian cancer, colon cancer, multiple myeloma, hepatocellularcarcinoma, and others (3, 31, 32). However, currently availableanti-human MAGE-A antibodies cross-react with many differentisoforms, making it difficult to evaluate isoform-specific expres-sion in patient samples (33). To achieve a more global picture ofMAGE-A isoform expression in human cancers, we analyzedhuman patient RNA-seq data from TCGA. We downloadednormalized RSEM counts through the GDAC data portal for allhuman tumors and matched normal samples available (https://gdac.broadinstitute.org/). We used log-transformed data for ouranalysis. We set the threshold for expression to be greater than 2SDs above the mean for the normal tissue control group for eachisoform individually. We found that, despite the fact that mostimmune therapies target the MAGE-A3 isoform, the other 10isoforms are also highly expressed in a variety of human cancers(Fig. 1A). When examining all human cancer samples availablefrom the GDAC data portal, tumors that express each isoformrange from 9.5% (MAGE-A8) to 29.5% (MAGE-A12; Fig. 1B).Expression of MAGE-A isoforms were particularly high for

patients with bladder cancer, esophageal cancer, glioblastoma,head and neck cancer, lung squamous cell carcinoma, rectumadenocarcinoma, skin cutaneousmelanoma, testicular germ centertumors, and uterine carcinosarcoma (Fig. 1A). Importantly, over80% of patients with these tumor types show expression of one ormore MAGE-A isoforms. We also found that it was common forpatients to expressmultipleMAGE-A isoforms simultaneously (Fig.1C). For instance, over half of patients with lung squamous cellcarcinoma (LUSC), skin cutaneous melanoma (SKCM) or testic-ular germ center tumors (TGCT) show expression of more than 5MAGE-A isoforms simultaneously (Fig. 1C). This analysis indicatesthat an immune therapy targeting multiple MAGE-A isoforms, notjust MAGE-A3, would likely be beneficial for a large proportion ofpatients.

MAGE-A vaccine design and expressionThe MAGE-A family does exist in lower vertebrates, and the

general domain structure of this antigen family is conservedbetween mouse and human, with an unstructured N-terminaldomain and a MAGE homology domain (Fig. 2A). However,the sequence is poorly conserved. The mouse and humanMAGE-A proteins share between 25.3% (MAGE-A2) to38.4% (MAGE-A10) identity (calculated using sequence align-ment with ClustalX2). Furthermore, the MAGE-A9, MAGE-A11and MAGE-A12 isoforms have not been identified in mice. Wetherefore designed separate vaccines for testing in mice and forpreclinical development for humans. We generated a syntheticconsensus MAGE-A vaccine for proof-of-concept experimentsin mice that shares 94.1% identity with MAGE-A1, 95.1%identity with MAGE-A2, 94.5% identity with MAGE-A3,96.8% identity with MAGE-A5, 91% identity with MAGE-A6,and 94.8% identity with MAGE-A8 (Fig. 2B and D). For pre-clinical development for humans, we generated two consensusMAGE-A vaccines. The human MAGE-A consensus #1shares 91.4% identity to human MAGE-A2, 92.7% identity toMAGE-A3, 92.4% identity to MAGE-A6, and 92% identity toMAGE-A12. The human MAGE-A consensus #2 shares 84.6%identity to MAGE-A1, 84.6% identity to MAGE-A4, and 86.3%identity to MAGE-A5 (Fig. 2C, E, and F). These homologies werechosen as they would allow for theoretical T-cell cross-reactivity forthe majority of possible MAGE-A T-cell epitopes. All of thesevaccines were RNA and codon optimized for efficient translationand include the IgE leader sequence which promotes proteinproduction and secretion.

We next tested for plasmid vaccine expression in vitro. Wetransfected 293T cells with themouse consensusMAGE-A vaccineor a GFP-expressing plasmid as a control. Because there are nocommercially available antibodies that recognizemouseMAGE-Aisoforms, we probed for expression using qPCR. We detectedrobust expression of the consensus mouse MAGE-A vaccine in293T cells in vitro (Supplementary Fig. S1A). We next testedexpression of the human MAGE-A consensus #1 and consensus#2 plasmids. We were able to detect robust expression of theseplasmids by qPCR (Supplementary Fig. S1B).Wewere also able todetect expression of these plasmids by Western blot analysis,using either a Pan-MAGE-A antibody or a FLAG antibody thatrecognizes FLAG-tagged constructs (Supplementary Fig. S1C).The Pan-MAGE-A antibody was able to recognize the MAGE-AConsensus #2 vaccine construct, but not the Consensus #1 con-struct. As a control, we included 293T cells that were transfectedwith a human MAGE-A6 plasmid, which is slightly smaller than

Duperret et al.



https://gdac.broadinstitute.org/




Figure 1.

Expression of MAGE-A isoforms in human tumors. A, Percentage of tumors expressing indicated MAGE-A isoform based on RSEM RNA-seq expressiondata. B, Overall percentage of all tumor samples available from GDAC that express the indicated isoform. C, Percentage of tumors expressingmultiple MAGE-A isoforms simultaneously. Abbreviations: ACC, adrenocortical carcinoma; BLCA, bladder urothelial carcinoma; BRCA, breast invasivecarcinoma; CESC, cervical and endocervical cancers; CHOL, cholangiocarcinoma; COADREAD, colorectal adenocarcinoma; DLBC, lymphoid neoplasm diffuselarge B-cell lymphoma; ESCA, esophageal carcinoma; GBM, glioblastoma multiforme; GBMLGG, glioma; HNSC, head and neck squamous cell carcinoma;KIPAN, pan-kidney cohort (kidney chromophobe þ kidney renal clear cell carcinoma þ kidney renal papillary cell carcinoma); LAML, acute myeloid leukemia;LGG, brain lower grade glioma; LIHC, liver hepatocellular carcinoma; LUAD, lung adenocarcinoma; LUSC, lung squamous cell carcinoma; MESO, mesothelioma;OV, ovarian serous cystadenocarcinoma; PAAD, pancreatic adenocarcinoma; PCPG, pheochromocytoma and paraganglioma; PRAD, prostateadenocarcinoma; READ, rectum adenocarcinoma; SARC, sarcoma; SKCM, skin cutaneous melanoma; STAD, stomach adenocarcinoma; STES, stomach andesophageal carcinoma; TGCT, testicular germ cell tumors; THCA, thyroid carcinoma; THYM, thymoma; UCEC, uterine corpus endometrial carcinoma; UCS,uterine carcinosarcoma; UVM, uveal melanoma.





the MAGE-A consensus #1 or consensus #2 plasmids by Westernblot analysis (Supplementary Fig. S1C). This size shift is likelydue to the addition of the IgE leader sequence.

Consensus mouse MAGE-A vaccine breaks tolerance tomultiple MAGE-A isoforms in C57Bl/6 mice

To test the capacity of the mouse MAGE-A vaccine tobreak tolerance to multiple MAGE-A isoforms, we immunizedC57Bl/6 mice with 25 mg of the mouse consensus MAGE-Avaccine three times at 2-week intervals and assessed cellularimmune responses 1 week following the final vaccination(Fig. 3A). We show, via IFNg ELISpot assay as well as intracellularcytokine staining of splenocytes that were stimulated with mousenative isoform–specific peptides, that our optimized designervaccine is capable of inducing robust CD8þ IFNg responses to all6 isoforms predicted to cross-react with this vaccine (Fig. 3B–I).Furthermore, nearly all of these antigen-specific CD8þ spleno-cytes coexpressed the degranulation marker CD107a and thetranscription factor T-bet, in addition to IFNg , indicating thatthese CD8þ T cells have high cytolytic potential (Fig. 3J). High

levels of TNFa are also induced in CD8þ T cells upon stimulationof splenocytes with isoform-specific peptides (Fig. 3K). Theimmune response detected in C57Bl/6 mice was largely drivenby CD8þ T cells, as evidenced by the lower level of CD4þ T-cellresponse for the individual MAGE-A isoforms (SupplementaryFig. S2). These data demonstrate that this optimized, syntheticMAGE-A vaccine is capable of breaking tolerance to multipleMAGE-A isoforms simultaneously in mice.

Because most of the immune responses observed were inpeptide Pool 2, we ran IFNg ELISpots using the individual pep-tides that make up Pool 2. By running the individual peptides,we determined that the response in C57Bl/6 mice was dominat-ed by a single epitope: MKVLQFFASINKTHP (SupplementaryFig. S3). This epitope contains both an 8-mer (VLQFFASI) and9-mer (KVLQFFASI) that are predicted to have the highest MHCclass I binding affinity (36.8 nmol/L and 20.5 nmol/L IC50,respectively) of all possible mouse MAGE-A epitopes, accordingto the IEDB NetMHCPan prediction program.

We next evaluated memory responses to the MAGE-Avaccine in C57Bl/6 mice. We immunized mice two times, and

Figure 2.

Design of mouse and human consensus MAGE-A vaccines. A, General domain structure of the MAGE-A proteins. The N-terminal is predicted to beunstructured using methods for detecting putative intrinsically disordered regions in proteins. B and C, Phylogenetic trees for murine (B) and human(C) MAGE-A families. Sequences were aligned using ClustalX2. Indicated are the sequences used for each consensus vaccine. D–F, Comparative models,shown in cpk format, for the MHD region of the murine consensus vaccine (D) or the human consensus 1 (E) and consensus 2 (F) vaccines. Redresidues indicate identity in the consensus with all sequences, and yellow indicates residues that differ in one or more of the MAGE-A native isoforms.

Duperret et al.




sacrificed the mice either one week after final dose or 50 daysafter final dose of vaccine (Supplementary Fig. S4A). Theimmune responses decreased over time, but were maintainedinto memory 50 days after the final immunization (Supple-mentary Fig. S4B). Importantly, we were able to detect T cellsthat expressed IFNg , TNFa, and coexpressed IFNg/T-bet/CD107a in response to antigen stimulation in the mice sacri-ficed 50 days post-final dose (Supplementary Fig. S4C–S4E).

Because of potential toxicity concerns related to MAGE-A3–targeted TCR gene therapy, we closely examined MAGE-A DNAvaccine–immunized mice for adverse events. We immunized5 mice three times at 2-week intervals, and monitored mice fora total of 9 months after the first immunization. We did notobserve any apparent toxicity in these mice upon observation.Upon euthanization and dissection of these mice, we also did notobserve any gross organ abnormalities. Upon closer pathologicexamination of organs, we noted mild inflammation in the

kidney, liver, pancreas, and spleen (Supplementary Fig. S5A andS5B). A similar degree of inflammationwas noted in age-matchedcontrol immunizedmice, indicating that this pathologywas likelynot due to the MAGE-A vaccine itself. Importantly, no pathologicabnormalities were noted in the brain or heart.

Consensus MAGE-A vaccine breaks tolerance to multipleMAGE-A isoforms in CD-1 outbred mice

Because the inbred C57Bl/6 mice responded primarily to oneimmunodominant epitope, we next tested this consensus mouseMAGE-A vaccine in CD-1 outbred mice to determine whether itwould generate cross-reactive immune responses in geneticallydiverse mice. We immunized 15 CD-1 outbred mice with 25 mgof the mouse consensus MAGE-A vaccine three times at 2-weekintervals and assessed cellular immune responses one week fol-lowing the final vaccination. We determined, by IFNg ELISpot,that the consensus mouse MAGE-A vaccine is immunogenic in

Figure 3.

Consensus mouse MAGE-A vaccine breaks tolerance to multiple MAGE-A family members in C57Bl/6 mice. A, C57Bl/6 mice were immunized 3 times at 2-weekintervals and sacrificed 1 week following final vaccination. Mice were immunized with 25 mg of DNA followed by electroporation. B–H, Frequencyof mouse MAGE-A isoform–specific IFNg SFU per million splenocytes isolated from vaccinated mice. Splenocytes were stimulated with consensus peptidesmatching the vaccine sequence (consensus peptides, B), mouse MAGE-A1–specific peptides (C), mouse MAGE-A2–specific peptides (D), mouseMAGE-A3–specific peptides (E), mouse MAGE-A5–specific peptides (F), mouse MAGE-A6–specific peptides (G), mouse MAGE-A8–specific peptides (H). I–K,Intracellular cytokine staining of splenocytes isolated from control (pVax) or immunized (MAGE-A) mice, stimulated with the indicated peptides. Shown is thefrequency of IFNgþ CD8 T cells (I), CD107aþ/IFNgþ/T-betþ CD8 T cells (J), or TNFaþ CD8 T cells (K). Significance was determined by a Student t test.� , P < 0.05; ��, P < 0.01; �� , P < 0.001; �� , P < 0.0001. n ¼ 5 mice per group. A representative of two independent experiments is shown. Error barsindicate � SEM.





CD-1 mice against peptides matched to the consensus vaccinesequence, and is capable of breaking tolerance to multipleMAGE-A isoforms simultaneously in the majority of the mice(Fig. 4A and B). Despite the genetic diversity of these mice,the majority of animals generated immune responses against all6 individual MAGE-A isoforms (Fig. 4B).

Antitumor activity of MAGE-A vaccine in melanoma tumormodels

To identify an appropriate model for a tumor challenge, weevaluated MAGE-A expression in a panel of mouse cell linessyngeneic to either C57Bl/6 or Balb/c strains of mice. We usedPan-MAGE-A qPCR primers that recognize MAGE-A isoformsA1, A2, A3, A5, A6, and A8 simultaneously. This analysis showedhigh expression of MAGE-A isoforms in the B16F10 andYUMM1.7melanoma cell lines and the LLC and TC-1 lung cancercell lines (Supplementary Fig. S6A). The highest expression wasobserved in the YUMM1.7 cell line, which is derived from atransgenic melanoma model expressing BrafV600E, and hasboth Pten and Cdkn2 knockout (34). Therefore, we chose to test

the MAGE-A in a similar autochthonous tumor model in whichBraf V600E expression and PTEN loss are driven by Cre activationin melanocytes of the skin by tamoxifen induction (Tyr::CreER;BrafCA/þ;Ptenlox/lox mice; ref. 28). We verified that autochthonoustumors from these mice express MAGE-A isoforms at the RNAlevel (Supplementary Fig. S6B). Upon induction with topical4-OHT (tamoxifen), these mice develop melanoma with 100%penetrance. One week after 4-OHT induction, we began immu-nization with either a modified pVax control plasmid or theconsensus mouse MAGE-A plasmid (Fig. 5A). We observed thatthe mouse consensus MAGE-A vaccine was effective at signifi-cantly slowing tumor growth in thismodel, and prolongedmousesurvival by a median of 50 days compared with the modifiedpVax control group (2-fold prolongation in survival, Fig. 5Band C). We sacrificed half of the mice in the study at day 50 toevaluate appearance and immune infiltration in melanomatumors, as well as examine the immune response in the spleen.We found that the MAGE-A vaccine was able to decrease mela-noma invasion depth in the skin (Fig. 5D and E), as well asdrive CD8þ T cells to the tumor (Fig. 5F and G). Furthermore, the

Figure 4.

Consensus mouse MAGE-A vaccine breaks tolerance to multiple MAGE-A isoforms in CD-1 outbred mice. CD-1 outbred mice were immunized 3 times at 2-weekintervals and sacrificed 1 week following final vaccination. Mice were immunized with 25 mg of DNA followed by electroporation. A and B, IFNgELISpot responses to consensus vaccine-matched peptides (A) or individual MAGE-A isoform–matched peptides (B). Five mice were used in thecontrol group, and 15 mice were used in the consensus MAGE-A–immunized group. Error bars, � SEM.

Duperret et al.




Figure 5.

Antitumor activity of MAGE-A vaccine in an autochthonous melanoma model. A, Tumor study outline. Tyr::CreER; BRAFCa/þ; Ptenlox/lox transgenic mice wereadministered topical tamoxifen on their backs on day 0 to initiate melanoma formation. Mice were immunized with either control (pVax) or MAGE-A vaccine onceweekly starting on day 7 for a total of 4 immunizations. Mice were monitored for tumor growth and survival. B, Tumor volume measurements over time forpVax control mice or MAGE-A–immunized mice. C, Mouse survival over time for pVax control mice or MAGE-A–immunized mice. Mice were euthanizedaccording to the standard body condition score. D, Representative H&E images of tumors harvested from pVax control and MAGE-A–immunized mice that weresacrificed on day 50. E, Quantification of invasion depth in mm from H&E images of tumor tissue harvested from pVax or MAGE-A–immunized mice at day50. F, Representative images of immunofluorescence staining of melanomas for CD8 (green) T cells and DAPI (blue). G, Quantification of images in (F), interms of CD8þ T cells per image. Image quantification was performed for three representative images per mouse. HPF, high-power field. H and I, Surface staining oftumor-infiltrating CD8þ (H) and CD4þ (I) T cells for CD44 and PD1 expression. For (B), N ¼ 11 mice for pVax control group and 16 mice for MAGE-A–immunizedgroup. Eight mice from the MAGE-A group were sacrificed for immune analysis on day 50, and the remaining mice were followed for survival (C). Significance fortumor volume measurements over time was determined by multiple t tests for each time point. Significance for mouse survival was determined by theGehan–Breslow–Wilcoxon test. �, P < 0.05; ��, P < 0.01; �� , P < 0.001; �� , P < 0.0001. Error bars, � SEM. Scale bar, 100 mm for D. Scale bar, 50 mm for F.





CD4þ and CD8þ T cells in tumor tissues exhibited higher expres-sion of CD44 and PD-1, markers of immune activation (Fig. 5Hand I). Tumor-bearing mice immunized with the MAGE-Avaccine also exhibited robust antigen-specific CD8þ T-cellresponses in the spleen, which persisted at least 22 days after thefinal immunization (Supplementary Fig. S7A). Additional aspectsof the tumor microenvironment, such as blood vessel size anddensity, myeloid-derived suppressor cell infiltration and regula-tory T-cell infiltration, were not impacted by the MAGE-A vaccine(Supplementary Fig. S7B–S7F).

We next tested the efficacy of our vaccine in the moreaggressive, faster-growing subcutaneous YUMM1.7 tumor

model (Supplementary Fig. S8). We set up a tumor challengestudy to evaluate the efficacy of the MAGE-A vaccine in thistumor model as well as to assess the dependence of anyantitumor activity on CD8 T-cell–mediated immunity. Weimplanted mice with YUMM1.7 tumor cells, began immuni-zation after palpable tumors formed on day 7, and treated micewith either an isotype control antibody or a CD8 depletionantibody (Supplementary Fig. S8A). We found that the MAGE-A vaccine had a significant antitumor impact in this model,which was lost upon depletion of CD8 T cells in the mice(Supplementary Fig. S8B). These results strongly support thepotency of this MAGE-A vaccine for melanoma therapy.

Figure 6.

Immunogenicity and cross-reactivity of human MAGE-A consensus vaccines in mice. A, C57Bl/6 mice were immunized 3 times at 2-week intervals andsacrificed 1 week following final vaccination. Mice were immunized with 25 mg of DNA followed by electroporation. B and C, Frequency of humanMAGE-A isoform–specific IFNg SFU per million splenocytes isolated from mice immunized with the human MAGE-A consensus #1 vaccine. Mouse splenocyteswere stimulated with human MAGE-A consensus #1 peptides matching the vaccine sequence (B) or with isoform-specific peptides matching human MAGE-A2,MAGE-A3, MAGE-A6, or MAGE-A12 (C). D and E, Frequency of human MAGE-A isoform–specific IFNg SFU per million splenocytes isolated from miceimmunized with the human MAGE-A consensus #2 vaccine. Mouse splenocytes were stimulated with human MAGE-A consensus #2 peptides matching thevaccine sequence (D) or with isoform-specific peptides matching human MAGE-A1, MAGE-A4, or MAGE-A5. n ¼ 5 mice per group. Error bars, � SEM. Con,consensus.

Duperret et al.




Immunogenicity and cross-reactivity of human MAGE-Aconsensus DNA vaccines in mice

We next tested the ability of the human versions of ourMAGE-A DNA vaccines to generate cross-reactive immuneresponses in C57Bl/6 mice (Fig. 6A). We immunized C57Bl/6mice with 25 mg of the Human MAGE-A Consensus #1 vaccineor the Human MAGE-A Consensus #2 vaccine three times at2-week intervals, and assessed cellular immune responsesone week following the final immunization (Fig. 6A). Weobserved that both vaccines are immunogenic and generaterobust IFNg ELISpot responses to the vaccine-matched, con-sensus MAGE-A peptides (Fig. 6B and D). We also showthat both vaccines generate cross-reactive responses towardsall predicted human MAGE-A isoforms by IFNg ELISpot(Fig. 6C and E). The MAGE-A Consensus #1 vaccine generatescross-reactive immune responses against MAGE-A2, MAGE-A3,MAGE-A6, and MAGE-A12. The MAGE-A Consensus #2 vaccinegenerates cross-reactive immune responses against MAGE-A1,MAGE-A4, and MAGE-A5.

DiscussionPrevious clinical efforts to target the MAGE-A family mem-

ber with immunization have focused on MAGE-A3 specifical-ly, based on limited gene expression data showing highexpression for this particular isoform in various solid tumors(11). Here, we report data from TCGA showing that eachmember of the MAGE-A family, not just MAGE-A3, is highlyexpressed in human tumors (approximately 10%–30% ofall human tumors for each isoform). In fact, based on TCGAdata, 84% of melanoma patients express 1 or more isoformsthat are targeted by the two Human MAGE-A consensusvaccines that we developed, indicating important clinicalapplicability for patients with melanoma. Furthermore, mul-tiple MAGE-A family members are expressed within the sametumor, particularly so in patients with melanoma. These dataprovide further support for the development of a cross-reactivevaccine that can target multiple MAGE-A family memberssimultaneously.

The entire MAGE-A family is clustered on the X-chromo-some; however, each family member is under independenttranscriptional control (35). The reason for this independentregulation is not clear, nor is our understanding of the indi-vidual regulation; however, this family of antigens is thought tobe silenced by promoter methylation in normal human tissues(4, 36, 37). This methylation is removed in tumor cells due toepigenetic reprogramming. While certain MAGE-A isoforms aresuggested to have roles in cancer-promoting signaling path-ways, it is not clear whether these isoforms are necessary fortumor progression (38–41). This suggests that tumors couldescape immune pressure from a MAGE-targeted vaccinethrough downregulation of a particular MAGE isoform. How-ever, this immune evasion becomes less probable when mul-tiple MAGE-A family members are targeted simultaneously.Thus, a cross-reactive MAGE-A vaccine has a significant advan-tage over vaccines that target individual MAGE-A isoforms inpreventing tumor immune escape.

The MAGE-A family of proteins may be unique in its abilityto generate spontaneous T-cell responses in patients, indicatinga potential lack of tolerance or more limited tolerance to thisfamily of antigens (1, 5–10). While naturally occurring

responses to MAGE-A family members do exist, they are stillrelatively rare, making the role of tolerance to this antigenunclear (42, 43). In a small cohort of patients (5 patients), itwas shown that there is expression of MAGE-A isoforms inmedullary thymic epithelial cells, but that expression of eachisoform was variable (44). MAGE-A1 isoform expression wasonly detected in 1 of 5 patients, while MAGE-A3 and MAGE-A4expression was detected in 4 of 5 patients (44). These dataindicate that targeting multiple MAGE-A isoforms may beadvantageous for eliciting an immune response against selectisoforms that may not be subject to central tolerance. Morestudy needs to be performed in this regard in humans to betterunderstand factors that affect tolerance to this family of anti-gens. One advantage of this design is that, by including diver-sity into the design of these antigens, these hotspots of dis-similarity are quite similar to neoepitopes. They would beexpected to drive cross-reactive class II responses to these hot-spots, generating improved ability to break tolerance. Indeed,using the mouse MAGE-A immunogen, we demonstrate thatthe consensus vaccine design strategy is effective at breakingtolerance to many mouse MAGE-A isoforms.

There are some toxicity concerns regarding MAGE-A3–targeted TCR gene therapy. Two cellular CD8-based MAGE-A3 TCR therapies have been tested in the clinic. Unfortunately,in both clinical trials, patients experienced unexpected toxicity,which precluded further clinical development of these thera-pies. An affinity-enhanced HLA-A�01–specific MAGE-A3 TCRtherapy showed unexpected cardiovascular toxicity in thefirst 2 patients treated due to cross-reactivity of the TCR withpeptide from the muscle-specific titin protein (15, 16). A sepa-rate study used a high-avidity HLA-A�0201–specific MAGE-A3TCR, which showed unexpected neurologic toxicity in 3 of9 patients, resulting in 2 unexpected deaths (45, 17). This waslikely due to cross-reactivity of the TCR with low levels ofMAGE-A9/12 expression in neuronal cells of these patients.The toxicity correlated with the number of engineered T cellsthat were adoptively transferred, suggesting that lower levels ofT cells or a lower affinity TCR may avoid this type of toxicity(45, 17). Patients in this study received between 28–79 billionMAGE-specific T cells, in addition to one or more doses ofIL2 (17). Despite the fact that there was unprecedented toxic-ity, 5 of 9 patients did show clinical regression of theirlesions after treatment, suggesting that CD8þ T-cell therapycan be effective in generating an antitumor response againstthis antigen that can have clinical impact (45, 17).

Despite this toxicity shown with the MAGE-A3 TCR therapy,MAGE-A4 TCR therapy was successfully performed in patientswith esophageal cancer without significant toxicity (10). Further-more, MAGE-A3–targeted vaccine immunotherapy was safein patients, despite induction of MAGE-A3–specific CD4þ Tcells and antibodies (12, 13). One advantage of the DNA vaccineplatform is that we were able to examine mice immunized withthe cross-reactive mouse MAGE-A immunogen long-term, whichis not possible with TCR-based gene therapy. We did not observeany apparent off-tumor toxicity in these mice. Further studiesin larger organisms, such as non-human primates, can furtheraddress this important issue. The DNA vaccine targeting MAGE-Aantigens described here elicits antitumor immunity while gener-ating fewer MAGE-specific CD8þ T cells compared with TCR-based gene therapy, decreasing the likelihood of off-tumor tox-icity. In addition, because DNA vaccines induce natural antigen-





specific immunity (not ex vivo affinity-enhanced), there is likelyin vivo regulation of the immune response to prevent this type ofautoimmune attack. Because MAGE-A antigens are also inducedin inflammatory conditions such as wound healing, as well as inthe placenta during pregnancy (46, 47), careful considerationwill be required when selecting patient populations to excludefrom receiving this therapy (for instance, patients who intendto become pregnant or patients with the potential to developchronic wounds).

Because of the evolving cancer immunotherapy landscape, itwill be important to evaluate any new cancer vaccine strategiesin the context of immune checkpoint blockade. It has beenrecently reported that MAGE-A expression correlates with resis-tance to CTLA-4 blockade in patients with melanoma (48),indicating that this MAGE-A vaccine may be an effective therapyfor patients who do not respond to ICB, or may be able tosensitize patients who are resistant to ICB. We reported that aDNA vaccine targeting the tumor-associated antigen TERTsynergized with ICB in a mouse tumor model that is resistantto ICB alone (49). In addition, this MAGE-A vaccine maysynergize with epigenetic modifiers, which are known to upre-gulate expression of cancer germline antigens such as the MAGEfamily (50). These combination strategies will be important toconsider for future clinical applications.

Disclosure of Potential Conflicts of InterestC. Reed holds ownership interest (including patents) in Inovio Pharma-

ceuticals. D.B. Weiner holds ownership interest (including patents) in InovioPharmaceuticals and is a consultant/advisory board member for GeneOnePharma. No potential conflicts of interest were disclosed by the otherauthors.

Authors' ContributionsConception and design: E.K. Duperret, J. Yan, X. Xu, D.B. WeinerDevelopment of methodology: E.K. Duperret, X. XuAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): E.K. Duperret, S. Liu, M.J. Paik, A. Trautz, X. Liu,K. Ze, A. Perales-Puchalt, X. XuAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): E.K. Duperret, M.J. Paik, A. Trautz, A. Perales-Puchalt,C. ReedWriting, review, and/or revision of the manuscript: E.K. Duperret, A. Trautz,A. Perales-Puchalt, J. Yan, X. Xu, D.B. WeinerAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): M.J. Paik, R. StoltzStudy supervision: X. Xu, D.B. Weiner

AcknowledgmentsThis work was supported by an NIH/NCI NRSA Individual Fellowship

(F32 CA213795; to E.K. Duperret), a Penn/Wistar Institute NIH SPORE(P50CA174523; to D.B. Weiner), the Wistar National Cancer InstituteCancer Center (P30 CA010815), the W.W. Smith Family Trust (toD.B. Weiner), funding from the Basser Foundation (to D.B. Weiner) and agrant from Inovio Pharmaceuticals (to D.B. Weiner). The authors would like tothank Jeffrey Faust at the Wistar Flow Cytometry Facility for technical assistancewith flow cytometry and James Hayden at the Wistar Imaging Facility forassistance with microscopy. The authors would also like to thank Dr. DavidGarlick from Histo-Scientific Research Laboratories (Mount Jackson, VA) forpathologic evaluation of mouse organs.

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received April 1, 2018; revised July 13, 2018; accepted August 28, 2018;published first September 27, 2018.

References1. van der Bruggen P, Traversari C, Chomez P, Lurquin C, De Plaen E, Van den

Eynde B, et al. A gene encoding an antigen recognized by cytolyticT lymphocytes on a human melanoma. Science 1991;254:1643–7.

2. Dreno B, Thompson JF, Smithers BM, Santinami M, Jouary T, Gutzmer R,et al. MAGE-A3 immunotherapeutic as adjuvant therapy for patientswith resected, MAGE-A3-positive, stage III melanoma (DERMA): adouble-blind, randomised, placebo-controlled, phase 3 trial. LancetOncol 2018;19:916–29.

3. Roeder C, Schuler-Thurner B, Berchtold S, Vieth G, von den Driesch P,Schuler G, et al. MAGE-A3 is a frequent tumor antigen of metastasizedmelanoma. Arch Dermatol Res 2005;296:314–9.

4. De Smet C, Lurquin C, Leth�e B, Martelange V, Boon T. DNAmethylation isthe primary silencing mechanism for a set of germ line- and tumor-specificgenes with a CpG-rich promoter. Mol Cell Biol 1999;19:7327–35.

5. Gaugler B, Van den Eynde B, van der Bruggen P, Romero P, Gaforio JJ, DePlaen E, et al. Human gene MAGE-3 codes for an antigen recognized on amelanoma by autologous cytolytic T lymphocytes. J Exp Med 1994;179:921–30.

6. Chaux P, Vantomme V, Stroobant V, Thielemans K, Corthals J, Luiten R,et al. IdentificationofMAGE-3 epitopes presented byHLA-DRmolecules toCD4 þ T lymphocytes. J Exp Med 1999;189:767–78.

7. Graff-Dubois S, Faure O, Gross D-A, Alves P, Scardino A, Chouaib S, et al.Generation of CTL recognizing an HLA-A�0201-restricted epitope sharedby MAGE-A1, -A2, -A3, -A4, -A6, -A10, and -A12 tumor antigens: impli-cation in a broad-spectrum tumor immunotherapy. J Immunol 2002;169:575–80.

8. Huang L-Q, Brasseur F, Serrano A, De Plaen E, van der Bruggen P, Boon T,et al. Cytolytic T lymphocytes recognize an antigen encoded byMAGE-A10on a human melanoma. J Immunol 1999;162:6849–54.

9. Zhu S, Van den Eynde BJ, Coulie PG, Li YF, El-GamilM, Rosenberg SA, et al.Characterization of T-cell receptors directed against HLA-A�01-restricted

and C�07-restricted epitopes of MAGE-A3 and MAGE-A12. J Immunother2012;35:680–8.

10. Kageyama S, Ikeda H, Miyahara Y, Imai N, Ishihara M, Saito K, et al.Adoptive transfer of MAGE-A4 T-cell receptor gene-transduced lympho-cytes in patients with recurrent esophageal cancer. Clin Cancer Res2015;21:2268–77.

11. Vantomme V, Dantinne C, Amrani N, Permanne P, Gheysen D, Bruck C,et al. Immunologic analysis of a phase I/II study of vaccination withMAGE-3 protein combined with the AS02B adjuvant in patients withMAGE-3-positive tumors. J Immunother 2004;27:124–35.

12. Vansteenkiste J, Zielinski M, Linder A, Dahabreh J, Gonzalez EE,Malinowski W, et al. Adjuvant MAGE-A3 immunotherapy in resectednon–small-cell lung cancer: phase II randomized study results.J Clin Oncol 2013;31:2396–403.

13. Kruit WHJ, Suciu S, Dreno B, Mortier L, Robert C, Chiarion-Sileni V,et al. Selection of immunostimulant AS15 for active immunizationwith MAGE-A3 protein: results of a randomized phase II study ofthe European Organisation for Research and Treatment of CancerMelanoma Group in Metastatic Melanoma. J Clin Oncol 2013;31:2413–20.

14. Atanackovic D, Altorki NK, Cao Y, Ritter E, Ferrara CA, Ritter G, et al.Booster vaccination of cancer patients with MAGE-A3 protein revealslong-term immunological memory or tolerance depending on priming.Proc Natl Acad Sci U S A 2008;105:1650–5.

15. Cameron BJ, Gerry AB, Dukes J, Harper J V, Kannan V, Bianchi FC, et al.Identification of a Titin-derived HLA-A1-presented peptide as a cross-reactive target for engineered MAGE A3-directed T cells. Sci Transl Med2013;5:197ra103.

16. Linette GP, Stadtmauer EA, Maus MV, Rapoport AP, Levine BL, Emery L,et al. Cardiovascular toxicity and titin cross-reactivity of affinity-enhancedT cells in myeloma and melanoma. Blood 2013;122:863–71.

Duperret et al.




17. Morgan RA, Chinnasamy N, Abate-Daga D, Gros A, Robbins PF, ZhengZ, et al. Cancer regression and neurological toxicity following anti-MAGE-A3 TCR gene therapy. J Immunother 2013;36:133–51.

18. Wang L, Rollins L, Gu Q, Chen S-Y, Huang XF. A Mage3/Heat ShockProtein70 DNA vaccine induces both innate and adaptive immuneresponses for the antitumor activity. Vaccine 2009;28:561–70.

19. You Z, Hester J, Rollins L, Spagnoli GC, van der Bruggen P, Chen S-Y.A retrogen strategy for presentation of an intracellular tumor antigen asan exogenous antigen by dendritic cells induces potent antitumor Thelper and CTL responses. Cancer Res 2001;61:197–205.

20. Marchand M, van Baren N, Weynants P, Brichard V, Dr�eno B, Tessier MH,et al. Tumor regressions observed in patients with metastatic melanomatreated with an antigenic peptide encoded by gene MAGE-3 and presentedby HLA-A1. Int J Cancer 1999;80:219–30.

21. TrimbleCL,MorrowMP, KraynyakKA, ShenX,DallasM, Yan J, et al. Safety,efficacy, and immunogenicity of VGX-3100, a therapeutic synthetic DNAvaccine targeting human papillomavirus 16 and 18 E6 and E7 proteinsfor cervical intraepithelial neoplasia 2/3: a randomised, double-blind,placebo-controlled phase 2b trial. Lancet 2015;386:2078–88.

22. Tebas P, Roberts CC, Muthumani K, Reuschel EL, Kudchodkar SB, Zaidi FI,et al. Safety and immunogenicity of an anti-Zika Virus DNA vaccine—preliminary report. N Engl J Med 2017 Oct 4 [Epub ahead of print].

23. Yan J, Morrow MP, Chu JS, Racine T, Reed CC, Khan AS, et al. Broad cross-protective anti-hemagglutination responses elicited by influenza micro-consensus DNA vaccine. Vaccine 2018;36:3079–89.

24. Walters JN, Ferraro B, Duperret EK, Kraynyak KA, Chu J, Saint-Fleur A, et al.A novel DNA vaccine platform enhances neo-antigen-like T cell responsesagainstWT1 to break tolerance and induce anti-tumor immunity.Mol Ther2017;25:976–88.

25. Duperret EK, Trautz A, AmmonsD, Perales-Puchalt A,WiseMC, Yan J, et al.Alteration of the tumor stroma using a consensus DNA vaccine targetingFibroblast Activation Protein (FAP) synergizes with anti-tumor vaccinetherapy in mice. Clin Cancer Res 2018;24:1190–201.

26. Webb B, Sali A. Comparative protein structure modeling usingMODELLER. Curr Protoc Protein Sci 2016;86:2.9.1–2.9.37.

27. Dunker AK, Lawson JD, Brown CJ, Williams RM, Romero P, Oh JS, et al.Intrinsically disordered protein. J Mol Graph Model 2001;19:26–59.

28. Dankort D, Curley DP, Cartlidge RA, Nelson B, Karnezis AN, DamskyWE,et al. Braf(V600E) cooperates with Pten loss to induce metastatic mela-noma. Nat Genet 2009;41:544–52.

29. Liu S, Yu H, Kumar SM, Martin JS, Bing Z, Sheng W, et al. Norcantharidininduces melanoma cell apoptosis through activation of TR3 dependentpathway. Cancer Biol Ther 2011;12:1005–14.

30. Sreenivasan S, Madhugiri V, Sasidharan G, Kumar RR. Measuring gliomavolumes: a comparison of linear measurement based formulae with themanual image segmentation technique. J Cancer Res Ther 2016;12:161.

31. Tajima K, Obata Y, Tamaki H, Yoshida M, Chen Y. Expression of cancer/testis (CT) antigens in lung cancer. Lung Cancer 2003;42:23–33.

32. Jungbluth AA, Ely S, DiLiberto M, Niesvizky R, Williamson B, Frosina D,et al. The cancer-testis antigens CT7 (MAGE-C1) and MAGE-A3/6 arecommonly expressed in multiple myeloma and correlate with plasma-cellproliferation. Blood 2005;106:167–74.

33. Jungbluth AA, Busam KJ, Kolb D, Iversen K, Coplan K, Chen Y-T, et al.Expression of MAGE-antigens in normal tissues and cancer. Int J Cancer2000;85:460–5.

34. Meeth K, Wang JX, Micevic G, Damsky W, Bosenberg MW. The YUMMlines: a series of congenic mouse melanoma cell lines with defined geneticalterations. Pigment Cell Melanoma Res 2016;29:590–7.

35. Barker PA, Salehi A. The MAGE proteins: Emerging roles in cell cycleprogression, apoptosis, and neurogenetic disease. J Neurosci Res 2002;67:705–12.

36. Wischnewski F, Pantel K, Schwarzenbach H. Promoter demethylation andhistone acetylation mediate gene expression of MAGE-A1, -A2, -A3, and-A12 in human cancer cells. Mol Cancer Res 2006;4:339–49.

37. Weber J, Salgaller M, Samid D, Johnson B, Herlyn M, Lassam N, et al.Expression of the MAGE-1 tumor antigen is up-regulated by the demethy-lating agent 5-aza-20-deoxycytidine. Cancer Res 1994;54:1766–71.

38. Pineda CT, Ramanathan S, Fon Tacer K, Weon JL, Potts MB, Ou Y-H, et al.Degradation of AMPK by a cancer-specific ubiquitin ligase. Cell2015;160:715–28.

39. Doyle JM, Gao J, Wang J, Yang M, Potts PR. MAGE-RING proteincomplexes comprise a family of E3 ubiquitin ligases. Mol Cell 2010;39:963–74.

40. Yang B, O'Herrin SM, Wu J, Reagan-Shaw S, Ma Y, Bhat KMR, et al. MAGE-A, mMage-b, and MAGE-C proteins form complexes with KAP1 andsuppress p53-dependent apoptosis in MAGE-positive cell lines. CancerRes 2007;67:9954–62.

41. Liu W, Cheng S, Asa SL, Ezzat S. The melanoma-associated antigen A3mediates fibronectin-controlled cancer progression andmetastasis. CancerRes 2008;68:8104–12.

42. Stockert E, J€ager E, Chen YT, ScanlanMJ, Gout I, Karbach J, et al. A survey ofthe humoral immune response of cancer patients to a panel of humantumor antigens. J Exp Med 1998;187:1349–54.

43. Dhodapkar MV, Young JW, Chapman PB, Cox WI, Fonteneau JF,Amigorena S, et al. Paucity of functional T-cell memory to melanomaantigens in healthy donors and melanoma patients. Clin Cancer Res2000;6:4831–8.

44. Gotter J, Brors B, Hergenhahn M, Kyewski B. Medullary epithelial cellsof the human thymus express a highly diverse selection of tissue-specific genes colocalized in chromosomal clusters. J Exp Med 2004;199:155–66.

45. Chinnasamy N, Wargo JA, Yu Z, Rao M, Frankel TL, Riley JP, et al. ATCR targeting the HLA-A�0201-restricted epitope of MAGE-A3 recognizesmultiple epitopes of the MAGE-A antigen superfamily in several typesof cancer. J Immunol 2011;186:685–96.

46. Jungbluth AA, Silva WA Jr, Iversen K, Frosina D, Zaidi B, Coplan K, et al.Expression of cancer-testis(CT) antigens in placenta. Cancer Immun 2007;7:15.

47. Becker JC, Gillitzer R, Br€ocker E-B. A member of the melanoma antigen-encoding gene (MAGE) family is expressed in human skin during woundhealing. Int J Cancer 1994;58:346–8.

48. Shukla SA, Bachireddy P, Schilling B, Galonska C, Zhan Q, Bango C, et al.Cancer-germline antigen expression discriminates clinical outcome toCTLA-4 blockade. Cell 2018;173:624–633.

49. Duperret EK, Wise MC, Trautz A, Villarreal DO, Ferraro B, Walters J, et al.Synergy of immune checkpoint blockade with a novel synthetic consensusDNA vaccine targeting TERT. Mol Ther 2018;26:435–45.

50. Karpf AR. A potential role for epigenetic modulatory drugs in the enhance-ment of cancer/germ-line antigen vaccine efficacy. Epigenetics 2006;1:116–20.





a designer cross-reactive dna immunotherapeutic vaccine that targets multiple … · translational...

Documents