› content › 273 › 32 › 20556.full.pdf the j b c printed in u.s.a. -fluoropyrimidine...

2*-Fluoropyrimidine RNA-based Aptamers to the 165-Amino AcidForm of Vascular Endothelial Growth Factor (VEGF165)INHIBITION OF RECEPTOR BINDING AND VEGF-INDUCED VASCULAR PERMEABILITY THROUGHINTERACTIONS REQUIRING THE EXON 7-ENCODED DOMAIN*

(Received for publication, January 7, 1998, and in revised form, March 25, 1998)

Judy Ruckman‡§, Louis S. Green‡, Jim Beeson‡, Sheela Waugh‡, Wendy L. Gillette‡,Dwight D. Henninger‡, Lena Claesson-Welsh¶, and Nebojsa Janjic‡§

From ‡NeXstar Pharmaceuticals, Inc., Boulder, Colorado 80301 and the ¶Department of Medicinal and PhysicalChemistry, Biomedical Center, Box 575, S-751 23 Uppsala, Sweden

Vascular endothelial growth factor (VEGF) has beenimplicated in the pathological induction of new bloodvessel growth in a variety of proliferative disorders.Using the SELEX process (systematic evolution of li-gands by exponential enrichment), we have isolated 2*-F-pyrimidine RNA oligonucleotide ligands (aptamers) tohuman VEGF165. Representative aptamers from threedistinct sequence families were truncated to the mini-mal sequence capable of high affinity binding to VEGF(23–29 nucleotides) and were further modified by re-placement of 2*-O-methyl for 2*-OH at all ribopurine po-sitions where the substitution was tolerated. Equilib-rium dissociation constants for the interaction of VEGFwith the truncated, 2*-O-methyl-modified aptamersrange between 49 and 130 pM. These aptamers bindequally well to murine VEGF164, do not bind to VEGF121or the smaller isoform of placenta growth factor(PlGF129), and show reduced, but significant affinity forthe VEGF165/PlGF129 heterodimer. Cysteine 137 in theexon 7-encoded domain of VEGF165 forms a photo-induc-ible cross-link to a single uridine residue in each of thethree aptamers. The aptamers potently inhibit the bind-ing of VEGF to the human VEGF receptors, KDR andFlt-1, expressed by transfected porcine aortic endothe-lial cells. Furthermore, one of the aptamers is able tosignificantly reduce intradermal VEGF-induced vascu-lar permeability in vivo.

The growth of new blood vessels, or angiogenesis, is anessential physiological response to increased demand for nutri-ents and the accumulation of metabolic end products. In nor-mal physiological processes such as wound healing and theformation of corpus luteum and endometrium, angiogenesis istightly regulated by positive and negative signals. In severaldisease states, however, overactive angiogenesis contributes toadvancement of disease (1, 2).

Vascular endothelial growth factor (VEGF),1 also known asvascular permeability factor, has recently emerged as a cen-tral positive regulator of angiogenesis. VEGF displays activ-ity as an endothelial cell mitogen and chemoattractant in

vitro (3–5) and induces vascular permeability and angiogen-esis in vivo (4, 6–8). VEGF and its two tyrosine kinasereceptors, Flt-1 and Flk-1/KDR, are essential during embry-onic development for the differentiation of endothelial cellprecursors and the formation of a vascular network (9–12).VEGF is secreted as a disulfide-linked homodimer that oc-curs in four isoforms (121, 165, 189, and 206 amino acids)that derive from alternatively spliced forms of a commonmRNA (4, 13). The two larger isoforms are cell matrix-asso-ciated as a consequence of their high affinity for heparin,while the smaller isoforms are more readily diffusible (13).VEGF165 also binds heparin, while VEGF121 does not (13).The role of different isoforms of VEGF in various biologicalcontexts remains to be fully elucidated.

There is now substantial evidence that VEGF induces angio-genesis in several pathological settings. VEGF is secreted by awide variety of cancer cell types and promotes the growth oftumors by inducing the development of tumor-associated vas-culature (6, 7, 14–18). Inhibition of VEGF function has beenshown to limit both the growth of primary experimental tumorsas well as the incidence of metastases in immunocompromisedmice (19–22). Elevated VEGF expression is correlated withseveral forms of ocular neovascularization that often lead tosevere vision loss, including diabetic retinopathy (23), retinop-athy of prematurity (24), and macular degeneration (25). VEGFmay also play a role in inflammatory disorders such as rheu-matoid arthritis (26) and psoriasis (27). Thus, agents thatspecifically inhibit VEGF may have great utility in combattinga variety of human diseases for which few effective treatmentsare presently available.

Nucleic acids, as a function of their primary structure, canfold into complex three-dimensional shapes with a great diver-sity of binding specificities. Using the SELEX (systematic evo-lution of ligands by exponential enrichment) process, oligonu-cleotides may be efficiently isolated from enormous randomizedlibraries of RNA, DNA, or modified nucleic acids that bind withhigh affinity and high specificity to various molecular targets(28, 29). The method has been used to isolate ligands for pro-teins, peptides, carbohydrates, and small organic molecules(reviewed in Ref. 30). Such oligonucleotide ligands, termed“aptamers” (29), can be highly potent antagonists of enzymecatalysis or of specific protein-protein interactions (30). Thepotential utility of aptamers as therapeutic or diagnosticagents is considerably enhanced by chemical modifications thatlend resistance to nuclease attack. In particular, substitutionat the 29-position of ribonucleotides with 29-amino (29-NH2),29-fluoro (29-F), or a variety of 29-O-alkyl moieties confers re-sistance to ribonucleases that utilize the 29-OH group for cleav-age of the adjacent phosphodiester bond (31, 32).

* The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby marked“advertisement” in accordance with 18 U.S.C. Section 1734 solely toindicate this fact.

§ To whom correspondence should be addressed.1 The abbreviations used are: VEGF, vascular endothelial growth

factor; PBS, phosphate-buffered saline; PEG, polyethylene glycol; PAE,porcine aortic endothelial; PlGF, placenta growth factor; 5-I-U, 5-iodo-uridine; HBS, Hepes-buffered saline; TBS, Tris-buffered saline.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 273, No. 32, Issue of August 7, pp. 20556–20567, 1998© 1998 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

This paper is available on line at http://www.jbc.org20556

by guest on March 2, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

We have previously described the use of the SELEX process toidentify RNA (33) and 29-NH2-pyrimidine RNA aptamers toVEGF165 (34). The incentive for performing SELEX experimentswith 29-F-pyrimidine RNA libraries, described in this report, wasessentially 2-fold: first, we hoped to obtain nuclease-resistantaptamers that bind to VEGF with higher affinities than the29-NH2-pyrimidine-based aptamers. 29-NH2 modifications havebeen observed to decrease the stability of model DNA/DNA, RNA/RNA, and RNA/DNA duplexes (35, 36), while substitution of 29-Fin model duplexes dramatically increases their thermal stability(32, 37, 38). If 29-NH2 groups increase the conformational flexi-bility of oligonucleotides in general, the entropic cost of bindingmay limit the affinity of aptamers derived from 29-NH2-pyrimi-dine RNA libraries (39). In contrast, 29-F-pyrimidine aptamersmay adopt more rigid conformations and, thus, may exhibithigher binding affinities for their targets. Second, apart frompossible advantages related to binding affinity, the chemical syn-thesis of aptamers derived from 29-F-pyrimidine libraries is con-siderably more economical. The coupling efficiency of 29-F-pyrim-idine phosphoramidites during oligonucleotide synthesis isgreater than that of 29-NH2-pyrimidine phosphoramidites andthe 29-F groups do not require protection/deprotection steps.

Here we report that VEGF aptamers isolated from 29-F-pyrimidine RNA libraries generally display higher affinities forVEGF than do the 29-NH2-pyrimidine RNA aptamers isolatedpreviously (34). For three representative aptamers, the mini-mal sequence required for high affinity binding to VEGF isencoded in 23–29 nucleotides and all but two of the 29-OH-purine positions can be substituted with 29-O-methyl- (29-OMe-) purines with only modest decreases in binding affinity.The minimal, substituted aptamers bind specifically toVEGF165 with affinities between 49 and 130 pM and show nodetectable binding affinity for VEGF121 or the shorter isoformof placenta growth factor (PlGF129), a protein with 53% homol-ogy to VEGF (40). The aptamers bind to the heterodimers ofVEGF165 and PlGF123, but with reduced affinities. A site ofphoto-cross-linking between each of the aptamers and VEGF165

was mapped to Cys137 in the carboxyl-terminal exon-7-encodeddomain. In vitro, the 29-F-pyrimidine-, 29-OMe-purine-substi-tuted VEGF aptamers inhibit the binding of VEGF165 to boththe human Flt-1 and KDR VEGF receptors expressed on por-cine aortic endothelial cells. Furthermore, one of the aptamersblocks VEGF induction of vascular permeability as measuredin the Miles assay (7), and thus shows potential utility as aninhibitor of VEGF-mediated effects in vivo.

EXPERIMENTAL PROCEDURES

Materials

Recombinant human VEGF165 purified from the insect cell line Sf21was purchased from R & D Systems (Minneapolis, MN) as a carrier-freelyophilized powder. The protein was resuspended in phosphate-bufferedsaline (PBS) to a concentration of 10 mM and stored at 220 °C in smallaliquots until use. Aliquots were stored at 4 °C for up to 4 weeks afterthawing. Sf21-expressed mouse VEGF164, and Escherichia coli-expressedhuman VEGF121, VEGF165/PlGF129 heterodimer, and PlGF129 were alsopurchased from R & D Systems as carrier-free, lyophilized preparations.

Oligonucleotides were purchased from Operon Technologies, Inc.(Alameda, CA), or were synthesized in our laboratories using an Ap-plied Biosystems Model 394 oligonucleotide synthesizer according tooptimized protocols. The covalent coupling of polyethylene glycol (PEG)to aptamers was accomplished by synthesis of an oligonucleotide bear-ing a primary amine at the 59-end using a trifluoroacetyl-protectedpentylamine phosphoramidite, followed by reaction with 40-kDa PEGN-hydroxysuccinimide ester (Shearwater Polymers, Huntsville, AL).29-F- and 29-OMe-ribonucleotide phosphoramidites were prepared byJBL Scientific, Inc. (San Luis Obispo, CA) for NeXstar Pharmaceuti-cals. 29-F-pyrimidine nucleotriphosphates were also purchased fromJBL. 29-OH-purine nucleotriphosphates and deoxynucleotriphosphateswere from Pharmacia Biotech (Piscataway, NJ). [a-32P]ATP and[g-32P]ATP were obtained from NEN Life Science Products (Boston, MA).

Methods

The SELEX Protocol—DNA oligonucleotide template libraries (59-TAATACGACTCACTATAGGGAGGACGATGCGG(N30 or 40)CAGAC-GACTCGCCCGA-39, where N 5 any nucleotide) were prepared bychemical synthesis (“30N7” and “40N7”). Italicized nucleotides at the59-end of each template correspond to the T7 RNA polymerase promotersequence. Oligonucleotide primers (59-TCGGGCGAGTCGTCTG-39(“3N7”) and 59-TAATACGACTCACTATAGGGAGGACGATGCGG-39(“5N7”)) were also synthesized for use in template amplification andreverse transcription. Double-stranded DNA templates were preparedby annealing primer 3N7 to the 30N7 or 40N7 libraries and extendingthe primer using Klenow DNA polymerase (New England Biolabs,Beverly, MA) at 37 °C or avian myeloblastosis virus reverse tran-scriptase (Life Sciences, Inc., St. Petersburg, FL) at 45 °C. We reasonedthat the higher temperature of incubation used for the avian myelo-blastosis virus reverse transcriptase reaction would facilitate completeextension through highly structured template oligonucleotides. 1 nmolof each library was transcribed using T7 RNA polymerase (Enzyco, Inc.,Denver, CO) in the presence of 1 mM each of 29-OH-(ATP and GTP), 3mM each of 29-F-(CTP and UTP), and 50 mCi of [a-32P]ATP. RNAs werepurified from denaturing (7 M urea) polyacrylamide gels by excising andcrushing the gel slice containing the RNA and soaking it for severalhours or overnight in 2 mM EDTA. Approximately 5 nmol of RNA wereobtained from each transcription.

The SELEX process of affinity selection followed by amplification ofthe selected pool has been described in detail (41). In brief, one round ofselection and amplification was performed as follows: VEGF was mixedwith a 5- or 10-fold excess of 32P-radiolabeled RNA in PBS with 1 mM

MgCl2 (PBSM) (30N7 and 40N7 libraries) or in Tris-buffered saline, 1mM MgCl2, 1 mM CaCl2 (TBSMC) (30N7 library only). After incubationat 37 °C for 15 min, the mixtures were passed through 0.45-mm TypeHA nitrocellulose filters (Millipore, Bedford, MA) to collect complexes ofVEGF with RNA. The fraction of input RNA bound was monitored bymeasuring the radioactivity bound to the filter. RNAs were eluted fromthe filters by incubation in a 2:1 mixture of phenol (pH 7), 7 M urea.After precipitation from the aqueous phase, RNAs were annealed toprimer 3N7 and reverse transcribed using avian myeloblastosis virusreverse transcriptase. The resultant cDNAs were amplified with 15cycles of the polymerase chain reaction using the 3N7 and 5N7 primersand Taq DNA polymerase (Perkin-Elmer). Transcription of the polym-erase chain reaction product yielded a new library enriched for se-quences with affinity for VEGF. At round 4, the binding of the RNAlibraries to nitrocellulose filters without added VEGF substantiallyincreased in all three selected RNA pools. To deplete the pools offilter-binding RNAs, rounds 5 and 6 were performed with an alternativescheme for partitioning VEGF-bound RNAs from unbound molecules:after incubation of the 32P-radiolabeled RNA pool with VEGF, eachmixture was applied to an 8% polyacrylamide nondenaturing gel andrun at 10 W for 45–60 min at 4 °C. VEGF-RNA complexes migratedabove the unbound RNA in this system and were visualized by autora-diography. For these rounds, selected RNAs were purified by the crushand soak method, as described above. The concentrations of RNA andprotein were decreased in concert (from approximately 1027 M in thefirst selection to approximately 10212 M in the last round) as the affinityof the enriched pool for VEGF improved. After 12 rounds of selectionand amplification, individual molecules in the selected pools werecloned using the pCR-Script Direct Cloning kit from Stratagene (LaJolla, CA). Plasmids were purified using the alkaline lysis method(PERFECTprep Plasmid DNA kit, 5 Prime 3 3 Prime, Inc., Boulder,CO) and sequences of the cloned regions were obtained using the DyeTerminator Cycle Sequencing kit available from Perkin-Elmer. Fluo-rescent sequencing ladders were read in the laboratory of Dr. BrianKotzin, National Jewish Hospital, Denver, CO. Sequences weregrouped into families and aligned by eye and with the aid of softwaredesigned at NeXstar Pharmaceuticals.2

Measurement of Binding Affinities—Aptamers radiolabeled duringtranscription by incorporation of a-32P-labeled nucleotriphosphates, orafter synthesis using [g-32P]ATP and T4 polynucleotide kinase (NewEngland Biolabs), were incubated in low concentration (typically lessthan 70 pM) with varying concentrations of VEGF or other proteins at37 °C for 15–20 min. Incubations were in TBS, PBS, or HEPES-bufferedsaline (HBS), pH 7.4, with or without divalent cations. Samples werepassed through prewashed 0.45-mm nitrocellulose filters followed by a5–10-ml wash with binding buffer. Filters were immersed in scintillantand the radioactivity counted to quantitate the fraction of RNA bound

2 B. Zichi, unpublished data.

29-Fluoropyrimidine RNA-based Aptamers to VEGF165 20557


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

at each protein concentration. The binding of individual aptamers wasoften biphasic in nature, consistent with a model in which two speciesthat do not interconvert on the time scale of the experiment bind to asingle site on VEGF with different affinities. Equations that describethe fraction of RNA bound as a function of Kd and the total concentra-tions of RNA and protein (both measurable quantities) have been de-scribed for both monophasic and biphasic binding behavior (42). Be-cause the concentrations of RNA used in these experiments were nearthe Kd values of the aptamers and were too low to determine accurately,the least squares fitting of the data points to the binding equations wasperformed with the RNA concentration set to a negligibly low value. Inmaking this assumption, we ensured that the binding affinities re-ported here are, at worst, underestimates of the actual values.

Affinity Selection of Aptamer Fragments—Ten pmol of internallyradiolabeled transcripts of high affinity VEGF aptamers were partiallydigested with S7 nuclease (Boehringer Mannheim) to generate a mix-ture of radiolabeled fragments. One-tenth of the fragmented RNA wasincubated with 10 pM VEGF in 45 ml of binding buffer, prior to filtrationthrough nitrocellulose. Selected fragments recovered from the filterwere run out on a high resolution denaturing polyacrylamide gel next toa lane loaded with the unselected fragment pool. The smallest selectedbands were individually purified from the gel and further labeled attheir 59-ends with T4 polynucleotide kinase to increase their specificactivity. One-half of the sample was annealed to a cDNA of the originaltranscript and extended to the end of the template using SequenaseDNA polymerase (U. S. Biochemical Corp., Cleveland, OH). Comparisonof the migration of the purified fragment and its extension product to astandard sequencing ladder was used to determine the probable sizeand position of the selected fragment within the original transcript.Synthetic oligonucleotides corresponding in sequence to the affinityselected fragments were prepared to verify that the truncated aptamerretained affinity for VEGF.

29-OMe Substitution—29-F-pyrimidine oligonucleotides correspond-ing to truncated VEGF aptamer sequences were chemically synthesizedusing a 1:2 mixture of 29-OMe-purine:29-OH-purine phosphoramiditesat five or six purine positions. Because 29-OMe-nucleoside phosphora-midites couple with higher efficiency, the actual ratio of 29-OMe-purineto 29-OH-purine incorporated at each substituted position was roughly3:1. The sequences of the oligonucleotides are shown below, with thesubstituted purine positions underlined. U and C represent 29-F-uri-dine and 29-F-cytidine, unless otherwise indicated. All oligonucleotideswere synthesized using commercial sources of controlled pore glassbeads, and thus, bear an additional 29-OH-nucleotide at their 39-ends.The sequences are as follows: t22.29-OMe1, GACGAUGCGGUAGGA-AGAAUUGGAAGCGC(U-29OH); t22.29-OMe2, GACGAUGCGGUAG-GAAGAAUUGGAAGCGC(U-29-OH); t22.29-OMe3, GACGAUGCGGU-AGGAAGAAUUGGAAGCGC(U-29OH); t22.29-OMe4, GACGAUGCG-GUAGGAAGAAUUGGAAGCGC(U-29OH); t2.31-OMe1, GGCGAACC-GAUGGAAUUUUUGGACGCUCGCC(U-29OH); t2.31-OMe2, GGCGA-ACCGAUGGAAUUUUUGGACGCUCGCC(U-29OH); t2.31-OMe3,GGCGAACCGAUGGAAUUUUUGGACGCUCGCC(U-29OH); t44.29-OMe1, GCGGAAUCAGUGAAUGCUUAUACAUCCGC(U-29OH);t44.29-OMe2, GCGGAAUCAGUGAAUGCUUAUACAUCCGC(U-29OH); t44.29-OMe3, GCGGAAUCAGUGAAUGCUUAUACAUCCGC-(U-29OH). Each oligonucleotide was radiolabeled at the 59-end andincubated with VEGF at 320, 60, and 20 pM concentration. The mix-tures were filtered through nitrocellulose and bound RNAs were col-lected by incubation of the filter in 2:1 phenol, pH 7, 7 M urea. SelectedRNAs were collected from the aqueous phase by ethanol precipitation.The selected RNAs, along with aliquots of each unselected, radiolabeledoligonucleotide, were subjected to partial alkaline hydrolysis by incu-bation at 90 °C in 50 mM sodium carbonate buffer, pH 9, for 11 min.Hydrolyzed samples were applied to a 20% polyacrylamide, 7 M ureagel. Radioactive bands were visualized using a Fuji Fujix BAS 1000PhosphorImager and the intensity of bands corresponding to hydrolysisat individual purine positions was quantitated using MacBAS software,version 2.0. Band intensities were normalized to the total intensity inthe lane to correct for variability in sample loading. Band intensity ratioswere determined for each purine position by dividing the normalized bandintensity in the affinity selected sample by the normalized band intensityat the same position in the unselected sample. Values for the two or threeoligonucleotides where a particular purine was not substituted were av-eraged to obtain a baseline band intensity ratio. Band intensity ratios forsubstituted positions that fell well below or above the baseline valueprovided a qualitative indication of positions that show bias for oragainst 29-OMe substitution.

Temperatures of Melting (Tm)—Approximately 10 mg of aptamerwere diluted in 2.5 ml of degassed buffer. Absorbance at 260 nm was

monitored in a Varian Cary spectrophotometer relative to a bufferreference as the temperature of the sample was raised from 10 or 20 °Cto 90 or 95 °C at a rate of 1°/min. Tm values were determined by fittingthe data to a mathematical model (43) in which each aptamer is as-sumed to occupy one of two states (folded or unfolded). The baselineabsorbance of the folded and unfolded states is assumed to be linearwith changes in temperature. Six parameters describe the mathemat-ical model, including the slope and intercept of the upper and lowerlinear baselines and values for the DH and DS of the folded to unfoldedtransition. The temperature at which DG 5 0 (Tm) was calculated fromthe fitted values for DH and DS. Tm values for aptamers t22.23, t22-OMe, t2.29, and t2-OMe were determined in PBS. For t44.27 andt44-OMe, HBS with 1 mM EGTA was used for an initial determination;after cooling, CaCl2 or MgCl2 was added to 2 mM final concentration andthe Tm was measured again.

Binding Rate Constants—A small amount (typically less than 1pmol) of 59-radiolabeled aptamers were incubated with 1 nM VEGF at37 °C in 1 ml of buffered saline supplemented with divalent cations. Attime 0, 50 ml were filtered through nitrocellulose to determine thefraction of RNA bound to protein, then an excess (100 or 500 nM finalconcentration) of unlabeled aptamer was added in a volume of 2–4 mland 50-ml aliquots were filtered at time points thereafter. Filters werecounted in scintillant to determine the amount of radiolabeled RNA stillbound to VEGF at each time point. The data, plotted as fraction of RNAbound (f) versus time, were fit to a first order rate equation, f (t) 5f0e2(kd)t 1 b, where f0 is the fraction of RNA bound at time 0, kd is thedissociation rate constant, and b is the residual binding of radiolabeledRNA to the filter at infinite time. Association rate constants (ka values)were calculated from the measured kd and Kd values according to theequation, ka 5 kd/Kd.

Photo-cross-linking of Aptamers to VEGF—Truncated VEGF aptam-ers were synthesized with 29-OH, 5-iodo-U (5-I-U) in place of 29-F-U atone position in the molecule. All possible substituted oligonucleotideswere prepared for each of the aptamers. The substituted aptamers wereinitially screened for their capacity to form a cross-link to VEGF165: atrace amount of 59-end-radiolabeled oligonucleotide was incubated with0.1 or 1 mM VEGF at 37 °C in binding buffer, then exposed to pulses of308 nm monochromatic light in a 1-cm path length cuvette using a XeClexcimer laser (175 mJ/pulse, 20 pulses/s). The cuvette was positioned 50cm from a lens of 10-cm focal length. Aliquots were removed from thecuvette after 0, 500, 2000, 5000, and 7500 pulses and the samples wereapplied to an 8% polyacrylamide, 7 M urea gel to separate the moreslowly migrating cross-linked VEGF-aptamer complexes from free ra-diolabeled RNA. The efficiency of cross-linking was estimated for eachaptamer from a PhosphorImage of the gel. Aptamers with no 5-I-Usubstitutions cross-linked with an efficiency of 1% or less. Substitutedoligonucleotides varied in efficiency from 1 to 33%. For the aptamerswith the highest cross-linking efficiency, cross-linked material wasprepared at a preparative scale for trypsin or chymotrypsin digestionand peptide sequencing. 2 nmol of 5-I-U-substituted aptamer weremixed with 2 nmol of VEGF in 2-ml volume and the mixture wasirradiated as described above with 5000 pulses of light. The irradiatedsample was precipitated and resuspended in 0.5 M TriszHCl, pH 7.5, 8 M

urea, 2 mM EDTA and reduced and alkylated according to publishedprocedures (44), with some modifications. Dithiothreitol was added to10 mM final concentration and the sample was incubated at 37 °C for1 h. Iodoacetamide was added to 12 mM final concentration and incu-bation was continued at 37 °C for 1 h. Alkylation of sulfhydryls in theprotein allows a more reliable assignment of cysteine residues duringautomated peptide sequencing. The reduced and alkylated cross-linkedcomplex was precipitated and resuspended in 15 ml of 1% SDS. 15 ml of1 M TriszHCl (pH 8.5 for trypsin digestions or pH 7.8 for chymotrypsindigestions) were added and trypsin or chymotrypsin (sequencing grade,Boehringer Mannheim) dissolved in 1 mM HCl was added in equal massto the VEGF. The sample was brought to 150 ml with water andincubations were performed at room temperature or 37 °C for severalhours. Typically, an additional 5 mg of enzyme was added and incuba-tion was continued overnight. The peptide-RNA complexes were sepa-rated on a 20% polyacrylamide, 8 M urea gel and electroblotted to apolyvinylidene difluoride membrane. Alternatively, the major digestionproduct was excised from the gel, extracted by incubation in 2.5 M

ammonium acetate overnight at 37 °C, and precipitated with ethanol.Samples were resuspended by boiling in a small volume of 1% SDSbefore diluting to 0.05% SDS final concentration and applied to apolyvinylidene difluoride membrane using a ProSorb cartridge (Perkin-Elmer) according to the manufacturer’s recommendations. Sampleswere submitted to Dr. David McCourt at Midwest Analytical, Inc., St.Louis, MO, for automated peptide sequencing.

29-Fluoropyrimidine RNA-based Aptamers to VEGF16520558


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Receptor Binding Inhibition—Porcine aortic endothelial (PAE) cellstransfected with either the flt-1 or kdr VEGF receptor gene have beendescribed previously (45). Cells were cultured in Ham’s F-12 (LifeTechnologies, Inc. or Biochrom) supplemented with penicillin/strepto-mycin and 10% fetal calf serum (Life Technologies, Inc.). Confluent cellsin 24-well tissue culture plates (approximately 400,000 cells/well) werewashed twice with ice-cold Ham’s F-12 medium, 1 mg/ml bovine serumalbumin, then incubated for 2 h on ice in 0.5 ml of the same mediumcontaining 35,000 cpm/ml 125I-labeled VEGF (Amersham) and varyingconcentrations of aptamer or control oligonucleotide. The cells werewashed 3 times with ice-cold binding medium, then lysed in 20 mM

TriszHCl, pH 7.5, 1% Triton X-100, 10% glycerol. Cell lysates werecounted in a g-counter. 125I-VEGF binding in the absence of competitorwas taken as the maximum signal; nonspecific binding of the radiola-beled protein was determined by incubation in the presence of 50 ng/mlunlabeled VEGF. Estimates for the maximum and minimum values ofeach competition curve, expressed as a percentage of maximum signal,were obtained by fitting the data to a competition equation that de-scribes mutually exclusive binding of two species to the same target(46). The concentration of aptamer inhibiting 50% of the maximumsignal above background (IC50) was determined from the fitted curve.

Dermal Vascular Permeability Assay—The ability of the minimal29-OMe-modified aptamers to attenuate VEGF-induced changes in thepermeability of the dermal vasculature (Miles assay) was performed asdescribed previously (7) with minor modifications. Briefly, adult femaleguinea pigs (3/study) were anesthetized with isoflurane and the hair onthe dorsal and lateral back areas was removed with clippers. EvansBlue dye (2.5 mg/guinea pig) was administered intravenously. Injectionsolutions (PBS, VEGF, aptamers, and anti-VEGF monoclonal antibody)were prepared $30 min in advance, co-mixed where indicated, withfinal concentrations as shown. Each solution was then injected intrad-ermally (duplicate injections/guinea pig; 40 ml/site) in a randomizedmanner in a grid pattern drawn on the clippered area. Guinea pigs wereallowed to recover from anesthesia and were sacrificed by CO2 exposure30 min after completion of the intradermal injections. The skin wasthen harvested, trimmed free of subcutis, and transilluminated. Imageswere captured and analyzed using a color CCD camera (Hitachi DenshiKP-50U, Japan) and Image-Pro Plus software (Version 3.1, Media Cy-bernetics, Silver Spring, MD). Each skin sample was normalized forintensity with each injection site analyzed for optical density and thearea involved. The resultant vascular permeability indices were aver-aged for duplicate spots on the same animal, then normalized to theaverage signal obtained with VEGF alone on that animal (% of control).The mean and S.E. were calculated from the normalized data for threeguinea pigs (n 5 3) for all aptamer-containing samples and for sixanimals (n 5 6) for injection of PBS alone.

RESULTS

Selection of Aptamers—Aptamers to VEGF165 were isolatedin three separate SELEX experiments from 29-F-pyrimidineRNA libraries containing 30 or 40 random nucleotides. Selec-tions were performed in PBS supplemented with 1 mM MgCl2(30N and 40N libraries) or in TBS with 1 mM MgCl2 and 1 mM

CaCl2 (30N library only). Approximately 1 nmol of RNA wasincluded in the first selection cycle of each experiment. After 10cycles, the affinity between VEGF and each RNA pool hadimproved approximately 1000-fold relative to the starting pools(data not shown). As no further improvement in binding affin-ity was observed after two additional cycles, individual mem-bers of the 12th round pools were cloned and sequences weredetermined for about 50 isolates from each selection.

Of a total of 143 clones analyzed, 75 sequences differing bymore than one nucleotide were obtained. 46 of these sequenceswere grouped into three major families based on conservedprimary structure motifs (Table I). The remaining sequencescould be grouped into minor families with five or fewer mem-bers or were orphan sequences that were not obviously relatedto any other sequence. Ligands containing the primary struc-ture motif defined by Families 1 and 2 were enriched in allthree affinity selections. Family 1 ligands share a stronglyconserved sequence (boldface in Table I) flanked by variableregions. Although possible base pairing interactions may beidentified for some of the ligands, generally between the 59-

fixed sequence and nucleotides on the 39-side of the conservedsequence motif, no predicted secondary structure common to allor most of the ligands is evident. In contrast, members ofFamily 2 share the ability to form a short base paired stem(underlined in Table I) enclosing a conserved, discontinuoussequence motif. With the exception of the closing A/U base pair,the sequence identity of bases in the putative stem regions isnot conserved. Such co-variation of bases that conserves sec-ondary rather than primary structure supports the existence ofthe putative stem and suggests that this structure may beimportant for the high affinity conformation of this family ofVEGF aptamers. The conserved primary structure motifs ofFamily 1 and Family 2 are similar: most ligands include thesequence 59-GAAN(3–4)UUGG-39. Indeed, two members ofFamily 2 (VP40.9 and VP40.14) could as easily be grouped withFamily 1 sequences. Members of both families are thus likely toform similar complexes with VEGF.

A third family of ligands were enriched only in the selectionsperformed in TBSMC (Family 3, Table I). In addition to ahighly conserved primary structure motif (boldface, Table I), themembers of this family also share a predicted secondary struc-ture: 3–10 nucleotides 39 of the conserved sequence region showbase pairing complementarity to nucleotides in the 59-fixed re-gion adjacent to the selected sequence region (underlined in Ta-ble I). For three of the ligands (VT30.29, VT30.44, and VT30.54),the 59-side of the putative stem extends one additional base intothe variable sequence region. Our efforts to define a minimalhigh affinity sequence derived from this family (described below)were guided by the strong conservation of this motif.

The affinities of the individual RNA ligands for VEGF weredetermined as described under “Experimental Procedures.”With few exceptions, the ligands showed very high affinity forVEGF, with most Kd values ranging between 5 and 50 pM.

Minimal Aptamers—To identify the minimal sequence ele-ments that confer high affinity binding to VEGF, we used botha biochemical approach and predictions based on conservedsecondary structure motifs to derive a high affinity truncatedaptamer from one member of each sequence family (asterisksin Table I). For clone VP30.22 from Family 1, which shares noobvious secondary structure potential with other members ofthe group, an initial prediction for a minimal sequence wasmade by mapping the ends of a purified, affinity-selected frag-ment of the full-length aptamer (data not shown and see “Ex-perimental Procedures”). The sequence of the 29-nucleotidehigh affinity fragment (59-GACGAUGCGGUAGGAAGAAUU-GGAAGCGC-39) encompassed the conserved sequence motif,and an oligonucleotide corresponding to the selected fragment(t22.29; truncated aptamer derived from clone VP30.22, 29 nuc-leotides in length) showed an approximately 3-fold loss in bind-ing affinity for VEGF (Kd 5 60 pM) relative to the full-lengthligand. Further truncation at the 39-end of this molecule causeda precipitous loss in affinity. In contrast, up to 6 additionalnucleotides could be removed from the 59-end with little or noeffect on binding affinity. The resultant 23-nucleotide aptamer,t22.23 (Table I, gray shading), included all of the consensusprimary structure motif and bound to VEGF with a Kd of 90 pM.For Families 2 and 3, the conserved regions of basecomplementarity (indicated by underlining in Table I and be-low) were used to define the initial boundaries of truncatedaptamers derived from clones VP30.2 and VT30.44. Aptamert2.31 (59-GGCGAACCGAUGGAAUUUUUGGACGCUCGCC-39) bound to VEGF with a Kd of 20 pM. Deletion of one nucleo-tide from the 59- and 39-ends of this molecule reduced thelength of the putative stem to four base pairs and increased theKd to 40 pM. Removal of an additional base pair from the baseof the proposed stem increased the Kd still further to 100 pM.



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Similarly, the truncated aptamer t44.29 (59-GCGGAAUCAGU-GAAUGCUUAUACAUCCGC-39) and a shorter, 27-nucleotidemolecule lacking the G/C base pair at the base of the putativestem retained an affinity for VEGF equivalent to that of thefull-length molecule (Kd 5 10 pM). However, further truncationof the stem to yield a 25-nucleotide aptamer increased the Kd to60 pM. Based on these data, 29- and 27-nucleotide minimalsequence aptamers (t2.29 and t44.27) were chosen for clonesVP30.2 and VT30.44, respectively (Table I, gray shading).

29-OMe Substitution at Purines—Substitution at the 29-OHpositions of RNA oligonucleotides by 29-OMe improves theirstability against nucleases present in a variety of biologicalfluids (34, 47), and, like 29-F-modified nucleotides, allows formore efficient chemical synthesis of aptamers because the 29-OMe group does not need to be protected. Unfortunately, 29-OMe-modified nucleoside triphosphates are not generally ac-cepted as substrates by RNA polymerases under standardreaction conditions. However, 29-OMe-purines may be incorpo-

TABLE ISequences and affinities of 29-F-pyrimidine RNA aptamers to VEGF165

Oligonucleotide ligands to VEGF165 were isolated in three separate SELEX experiments. Individual clones were isolated and sequenced and thesequences grouped into families based on shared primary structural motifs. The name of each ligand indicates the target (V 5 VEGF), the selectionbuffer (P 5 PBS; T 5 TBS), the length of the randomized region in the library (30 or 40 nucleotides) and the clone number (following the decimal).The frequency with which a sequence appeared among the clones analyzed is indicated in parentheses; sequences that differed by only onenucleotide were attributed to polymerase chain reaction mutations of a common precursor and were grouped together with the variable baseindicated in the sequence by the appropriate symbol (Y 5 U or C). The fixed sequences common to all ligands are shown in lower case letters atthe top. For individual clones the sequence of the variable region is shown in upper case. For some ligands, fixed region sequences in lower caseare appended to the variable region sequence where they contribute to a conserved sequence motif or possible secondary structures. Underliningindicates regions of potential base pairing. The value of Kd for the high affinity binding fraction of each ligand is shown (N.D., not determined).One ligand in each family was selected for further analysis (asterisks). Gray boxes indicate the minimal high affinity aptamer derived from eachsequence.



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

rated at any position in a specific oligonucleotide by chemicalsynthesis. We and others3 have observed that high affinityRNA ligands generally accept a high percentage of 29-OMe-purine substitutions with little or no loss of affinity for thetarget protein (34, 48). To identify those purine positions inaptamers VP30.22, VP30.2, and VT30.44 where 29-OMe sub-stitution is compatible with high affinity binding to VEGF,syntheses of the truncated aptamers t22.29, t2.31, and t44.29were prepared in which five or six purines at a time werepartially substituted with the modified nucleotide. Affinity se-lection of each partially substituted library was used to isolatethose molecules that retained substantial affinity for VEGF. Insuch an affinity selected pool, positions that do not toleratesubstitution are biased for 29-OH and thus show higher sensi-tivity to hydrolysis by alkali relative to the same position in theunselected library. 59-Radiolabeled unselected and affinity se-lected pools were partially hydrolyzed by alkali and the prod-ucts were displayed on a high resolution polyacrylamide gel. Arepresentation of the relative band intensity at each purineposition is shown in Fig. 1. Open circles indicate the average“baseline” band intensity ratio for each purine position deter-mined from those libraries where the position was unmodified.Filled circles represent relative band intensities where theposition was partially 29-OMe-substituted. A position that dis-plays a strong preference for 29-OH may be easily identifiedfrom these plots by a filled circle that falls well above thebaseline value for that position (34). For t22.29, G4 and A6showed substantial bias for 29-OH in the affinity selected pool,as did A5 and G20 in t2.31, and A4 and A5 in t44.29 (Fig. 1).Note that the numbering of the nucleotide positions is adjustedsuch that the first nucleotide of the minimal truncated se-quence, described above, is position one.

While the foregoing analysis identifies those positions atwhich the 29-OMe substitution is likely to result in reducedaffinity, one cannot predict from these data how simultaneousmodification of all other purines will affect the binding affinity.This analysis was conducted using the minimal sequenceaptamers described above. Substitution of all but two purineswith 29-OMe-purines in the minimal ligand t22.23 (t22-OMe)had little or no impact on its binding affinity for VEGF (Kd 5 72pM, Table II). Aptamer t2-OMe, corresponding to the minimalaptamer t2.29 substituted at all purines except A5 and G20,showed a 3.5-fold increase in Kd relative to the unsubstitutedmolecule (130 pM compared with 40 pM), while t44-OMe (t44.27substituted at all but the adjacent residues A4 and A5) showeda 5-fold increase, from 10 to 49 pM (Table II). Thus, the effect ofthe combined 29-OMe substitutions on the Kd values of theminimal aptamers was either neutral or slightly unfavorable.Further substitution at either or both of the remaining 29-OHpositions in each of the aptamers resulted in at least a 10-folddecrease in binding affinity.

Divalent Cation Dependence of Aptamer Binding—Aptamersin Families 1 and 2 were selected in the presence of magnesiumcations while Family 3 aptamers were selected in a buffercontaining both magnesium and calcium. Since divalent cat-ions may stabilize RNA structures by binding within a specificpocket formed by the RNA or through nonspecific interactionwith the phosphodiester backbone, we asked whether magne-sium and/or calcium were required for the high affinity bindingof representative aptamers to VEGF. The affinities of t22-OMeand t2-OMe (from Families 1 and 2, respectively) were un-changed in the presence or absence of supplemental divalentcations or the chelating agent EDTA (data not shown). How-

ever, for Family 3 ligands, as represented by t44-OMe in Fig. 2,calcium was absolutely required for high affinity binding toVEGF. Binding was dramatically reduced (Kd . 1027) whendivalent cations in the binding buffer were replaced withEGTA. The addition of excess MgCl2 to the binding bufferdepleted of divalent cations resulted in no improvement inbinding affinity. In contrast, CaCl2, in 2-fold molar excess overEGTA, fully restored binding activity. Similar binding behaviorwas observed for the unmodified aptamer t44.29 and for othermembers of the sequence family (data not shown).

Thermal Denaturation Properties of Aptamers—Tm, the in-flection point of the thermal denaturation profiles of nucleicacids, is often used as an indicator of the thermodynamic sta-bility of the structured conformation. A higher Tm suggeststhat more energy is required to disrupt the folded conformationand that a greater proportion of molecules will occupy thefolded state at 37 °C, the temperature at which binding affin-ities are measured. The Tm values determined for the minimal

3 T. Fitzwater, Y. Chang, R. Jenison, D. O’Connell, and D. Parma,unpublished observations.

FIG. 1. Effect of 2*-OMe-purine substitutions on binding. 59-Radiolabeled libraries were prepared for each of three truncated aptam-ers in which five or six 29-OH-purine positions were partially 29-OMe-substituted, as described under “Experimental Procedures.” Eachlibrary was incubated with VEGF, and substituted oligonucleotidesbound by the protein were collected on nitrocellulose filters. The se-lected pool and the starting unselected library were partially hydro-lyzed by alkali and the products were displayed on a high resolutionpolyacrylamide gel. The “band intensity ratio” corresponds to the nor-malized PhosphorImage signal obtained from hydrolysis at a particularpurine position in the selected pool divided by the signal obtained forthe same position in the unselected library. Filled circles representband intensity ratios where the position was partially 29-OMe substi-tuted in the library; open circles show the average band intensityratio 6 S.D. for all libraries in which the position was unsubstituted.Filled circles that fall well above the range for a particular position areindicative of a bias for 29-OH (against 29-OMe) in the affinity selected pool.The numbering of the nucleotide positions in each aptamer is such thatthe first nucleotide of the minimal aptamer sequence is position one.



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

length aptamers were 48 °C for t22.23, 63 °C for t2.29 (bothmeasured in PBS), and 57 °C for t44.27 (measured in HBS with1 mM EGTA and 2 mM CaCl2). These Tm values are somewhathigher (for t22.23) or considerably higher (for t2.29 and t44.27)compared with those observed for 29-NH2-pyrimidine aptamersto VEGF (34) and other targets.4 The Tm values determined forthe three 29-OMe-substituted aptamers were slightly higherthan those of the unsubstituted aptamers (Table II), consistentwith the increase in thermal stability observed generally for29-OMe substitution in model duplexes (32, 37) and aptamers(34). The measured values were 49 °C for t22-OMe, 66 °C fort2-OMe, and 62 °C for t44-OMe. Family 3 ligands show anabsolute dependence on the presence of calcium for high affin-ity binding to VEGF. Since calcium might affect the stability ofa particular solution conformation of these aptamers, we askedwhether the observed thermal stability of aptamer t44-OMewas significantly different in the absence of calcium. In HBSwith 1 mM EGTA only, the Tm was 59 °C; thus, the presence ofcalcium appeared to cause a slight increase of 3 °C in thethermal stability of the aptamer. However, in the presence ofHBS with 1 mM EGTA and 2 mM MgCl2, a buffer in which highaffinity binding to VEGF was not observed (Fig. 2), the Tm wasidentical to that measured in HBS/EGTA/CaCl2 (62 °C). Thus,the specific effect of calcium, as compared with magnesium, onthe high affinity interaction of t44-OMe with VEGF cannot be

observed by comparison of the thermal stability of the aptamerin the presence of either divalent cation.

Binding Rate Constants for Substituted Aptamers—Dissoci-ation rate constants (kd) were determined for each of the three29-OMe-substituted aptamers by following the loss of a pre-formed complex between radiolabeled aptamer and VEGF uponthe addition of a large excess of unlabeled aptamer. t22-OMeshowed the fastest rate of dissociation with a kd of 0.012 s21,corresponding to a t1⁄2 of 60 s (Table II). t2-OMe and t44-OMeshowed slightly slower rates of dissociation (kd 5 0.0042 and0.0074 s21, or t1⁄2 values of 170 and 90 s, respectively. Associa-tion rate constants (ka), calculated from the dissociation rateconstant and the equilibrium dissociation constant (ka 5 kd/Kd), ranged from 3 3 107 to 2 3 108 M21 s21 (Table II). Suchrapid rates of association suggest that the binding interactionbetween these aptamers and VEGF may be nearly diffusion-limited, and are similar to the association rate constants de-termined for aptamers derived to other targets (49) or fromother libraries (34, 42).

Specificity of Aptamers—The oligonucleotides described herewere selected based on their affinities for VEGF165. All threeminimal 29-OMe-substituted aptamers bind to humanVEGF165 and its mouse homologue (VEGF164) with comparablyhigh affinity (Fig. 3). No binding, or minimal binding, wasobserved for the three aptamers with up to 100 nM VEGF121,PlGF129, a protein with 53% homology to VEGF (40), or reducedVEGF165 (Fig. 3). Because the affinity of the aptamers for PlGFwas very low, we tested the ability of each ligand to recognizea single subunit of VEGF in the context of a VEGF/PlGFheterodimer. Although the binding affinity of t22-OMe andt44-OMe for the VEGF/PlGF heterodimer was lower comparedwith the VEGF165 homodimer, an appreciable fraction of highaffinity binding remained (Kd 5 750 and 430 pM, respectively).In contrast, aptamer t2-OMe bound the heterodimer with con-siderably lower affinity (Kd 5 40 nM) (Fig. 3).

Photo-cross-linking Aptamers to VEGF165—To probe for sitesof close contact between VEGF and the three minimal aptam-ers, oligonucleotides corresponding in sequence to t22.23, t2.31,and t44.29 were synthesized in which one 29-F-U position at atime was substituted with 29-OH-, 5-iodo-U (5-I-U). Cross-link-ing may occur when a photo-induced uridinyl radical generatedfrom the 5-iodo-substituted base reacts with an amino acid inclose proximity within the bound complex (50, 51). While theeffect of most single 5-I-U substitutions on the affinity of theaptamers for VEGF was small, some substitutions did result inlower binding affinity for VEGF. 5-I-U substitution at U14 orU15 in aptamer t22.23, at U18 or U19 in t2.31, and at U6 inaptamer t44.29 caused a significant loss in binding affinityand/or significantly reduced the fraction of RNA that boundwith higher affinity. The lower binding affinity displayed bythese aptamers was acceptable in these experiments because4 B. Feistner and S. Gill, unpublished observations.

TABLE IIBinding parameters and Tm values of 29-OMe-substituted minimal aptamers

Truncated ligands t22.23, t2.29, and t44.27 were chemically synthesized with all but two 29-OH-purine positions (boldface) substituted by29-OMe-purines. All three aptamers (t22-OMe, t2-OMe, and t44-OMe) were terminated by a 39-39-linked deoxythymidine (not shown). Asterisksmark the positions where 5-iodo-U substitution permits a photo-induced cross-link to VEGF165. Values for Kd and kd represent average (6S.E.) forfive or six determinations or three to five determinations, respectively. ka values were calculated from the relationship ka 5 kd/Kd. Errors for kacalculations were determined using the delta method. Tm values were determined in PBS for aptamers t22-OMe and t2-OMe and in HBS with 1mM EGTA and 2 mM CaCl2 for t44-OMe.

Aptamer Sequence KD kd ka 3 1028 Tm

pM s21M

21s21 °C5 10 15 20 25

*t22-OMe GCGGUAGGAAGAAUUGGAAGCGC 72 6 11 0.012 6 0.0025 1.7 6 0.27 49

*t2-OMe GCGAACCGAUGGAAUUUUUGGACGCUCGC 130 6 19 0.0042 6 0.00091 0.32 6 0.084 66

*t44-OMe CGGAAUCAGUGAAUGCUUAUACAUCCG 49 6 6 0.0074 6 0.00091 1.5 6 0.25 62

FIG. 2. Divalent cation dependence of aptamer t44-OMe. Thebinding of t44-OMe to VEGF was monitored as described under “Ex-perimental Procedures” in HEPES-buffered saline supplemented with 1mM each MgCl2 and CaCl2 (filled circles), 1 mM EGTA (open circles), 1mM EGTA plus 2 mM MgCl2 (filled boxes), or 1 mM EGTA plus 2 mM

CaCl2 (open boxes).



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

the cross-linking was performed at relatively high concentra-tions of VEGF and oligonucleotide. 59-End-radiolabeled aptam-ers were incubated with VEGF and the mixtures were exposedto pulses of 308 nm monochromatic light. A slowly migratingcross-linked complex was separated from free RNA by electro-phoresis through a denaturing polyacrylamide gel. Complexformation required the presence of VEGF and was inhibited bythe presence of an excess of high affinity unsubstituted VEGFaptamer, but not by an excess of oligonucleotide with lowaffinity for VEGF (for example, Fig. 4a). The most efficientcross-linking was observed for 5-I-U14 substitution in t22.23(15%), 5-I-U18 substitution in t2.31 (34%), and 5-I-U14 substi-tution in t44.29 (10%). Less efficient cross-linking was observedfor several of the aptamers substituted at other positions, whileless than 1% cross-linking was observed with the unsubstitutedoligonucleotides. The highest efficiency cross-linked complexfor each aptamer was generated on a preparative scale anddigested with trypsin or chymotrypsin. The products were sep-arated by electrophoresis and the major cross-linked fragmentwas eluted from the gel and submitted for automated peptide

sequencing. Trypsin digestion of VEFG-aptamer complexes de-rived from either t22.23 (5-I-U14) or t2.31 (5-I-U18) yielded themajor peptide sequence, _SCK, where the underscore corre-sponds to a blank in the sequencing data. Tryspin cleavageafter Lys136 and Lys140 in VEGF would yield a peptide ofsequence CSCK (Fig. 4b). These data were thus consistent withthe formation of a photo-inducible cross-link between aptamert22.23 (5-I-U14) or t2.31 (5-I-U18) and Cys137 of VEGF. How-ever, a second minor peptide was also present in both se-quences in 5–10-fold lower molar yield that mapped to theamino-terminal domain of VEGF. To clarify these results,cross-linked VEGF was also digested with chymotrpysin andthe major fragment was purified and sequenced. The sequence,VQDPQTCK_SCKN, mapped to residues 129 through 141 ofVEGF, where the blank residue indicated by the underscoreagain corresponds to Cys137 (Fig. 4b). Peptide sequence beyondAsn141 was not obtained. Minor peptides present in these se-quences were smaller chymotryptic fragments of the majorsequence or were fragments of chymotrypsin itself. Aptamert44.29 (5-I-U14) was cross-linked to VEGF and digested withchymotrypsin only. The sequence of the major cross-linkedchymotryptic fragment again corresponded to residues 129through 141 of VEGF. In this case, both Cys137 and Ser138 werenot detected in the peptide sequence; however, since serinegave a relatively weak signal in all sequences obtained, webelieve these data are interpreted most simply as a cross-linkat Cys137 and a poorly yielding sequencing cycle at Ser138.Thus, all three aptamers appear to bind to VEGF in a mannerwhich brings the aptamer surface in close proximity to Cys137.

VEGF Receptor Binding Inhibition—Previous selections foroligonucleotide ligands to VEGF yielded molecules that boundwith high affinity to the growth factor and inhibited its bindingtoVEGF receptors expressed by human umbilical vein endothe-lial cells (33, 34). Two VEGF receptors, Flt-1 (fms-like tyrosinekinase) and KDR (kinase insert domain-containing receptor),have been identified on human vascular endothelial cells (52,53). Site-specific mutations in the VEGF protein differentiallyimpact its association with Flt-1 or KDR, suggesting that dif-ferent regions of VEGF form close contacts with one or theother receptor (54, 55). We assessed the capacity of the minimal29-OMe-substituted aptamers to inhibit VEGF binding to eachof the receptors individually. PAE cells transfected with eitherthe flt-1 or kdr human VEGF receptor gene (45) were incubatedwith 125I-labeled VEGF165 in the absence or presence of in-creasing concentrations of the three truncated, 29-OMe-substi-tuted aptamers. Cell-associated VEGF decreased, in each case,with increasing concentration of the aptamer (Fig. 5). Higherconcentrations of aptamer were required to inhibit VEGF bind-ing to PAE/Flt-1 cells compared with PAE/KDR cells, in accordwith the reported higher binding affinity of Flt-1 for VEGFcompared with KDR (16). In general, the concentration of eachaptamer required to inhibit 50% of the 125I-labeled VEGF bind-ing above background (IC50) correlated with the affinity of eachligand for VEGF. IC50 values for aptamer competition with theFlt-1 receptor ranged from 5 3 10211 to 3 3 10210 M, comparedwith 2 3 1027 M for a sequence-scrambled analog of t44-OMe(scr-t44-OMe, Kd 5 350 nM for binding to VEGF). 50% inhibi-tion of VEGF binding to KDR required about 2 or 3 3 10212 M

for aptamers t22-OMe and t44-OMe, respectively, 6 3 10211 M

for t2-OMe, and 5 3 1028 M for scr-t44-OMe. None of the threeminimal aptamers at 1 nM concentration inhibited the bindingof 125I-platelet-derived growth factor-BB to PAE cells express-ing the platelet-derived growth factor b-receptor.

Vascular Permeability Assay—The Miles assay (7) offers asimple and rapid means of monitoring the ability of variouscompounds to inhibit the activity of VEGF in vivo. In this

FIG. 3. Specificity of aptamer binding. The affinity of aptamerst22-OMe (upper panel), t2-OMe (middle panel), and t44-OMe (lowerpanel) for VEGF and related proteins described in the text were deter-mined as described under “Experimental Procedures.” Measurementswere performed in PBSM for t22-OMe and t2-OMe and in HBSMC fort44-OMe. h, human; m, murine; red, reduced with dithiothreitol.



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

assay, intradermal injection of VEGF in adult guinea pigsinduces a rapid increase in the permeability of dermal mi-crovessels that may be monitored by quantitating the leakageof intravascular Evans Blue dye into the skin. Co-injection ofVEGF with an excess of neutralizing anti-VEGF antibody re-duces the dye leakage to a level equivalent to that upon injec-tion of PBS alone. Preincubation of VEGF with 1 or 0.1 mM ofeach 29-OMe-substituted aptamer showed varying degrees ofinhibition of the vascular permeability response (Fig. 6). Rela-tive to the vascular leakage observed with VEGF alone,aptamer t22-OMe inhibited 37% of the response at 1 mM and13% at 0.1 mM; however, only the data for the lower concentra-tion of aptamer meets the p , 0.05 criterion for statisticalsignificance. Aptamer t2-OMe showed no inhibition in thisassay. t44-OMe inhibited the response by 58% at 1 mM and 48%at 0.1 mM. The sequence-scrambled control oligonucleotide, scr-t44-OMe, showed no significant inhibitory activity. Aptamert44-OMe is thus the most effective antagonist of VEGF-induced

vascular permeability. The moderate degree of inhibition ob-served with t44-OMe was substantially enhanced by conjugat-ing the aptamer to 40-kDa PEG. The addition of 40-kDa PEG atthe 59-end of t44-OMe resulted in a slight apparent reduction(;4-fold) in binding affinity to VEGF (data not shown) but amarked enhancement in inhibitory activity in the Miles assay(Fig. 6). The 40-kDa PEG-t44-OMe conjugate inhibited 83% ofVEGF-induced vascular permeability at 0.1 mM, while a conju-gate of 40-kDa PEG to the scr-t44-OMe control oligonucleotideshowed no inhibition at the same concentration.

DISCUSSION

The choice of oligonucleotide library has an enormous impacton the outcome of a SELEX experiment. Without exception,selections performed with the same target but with nucleic acidlibraries with different 29-moieties have yielded families ofaptamers with distinctly different sequences, (33, 34, 56, 57).This may be explained, in part, by differences in the size and

FIG. 4. Photo-cross-links of 5-I-U-substituted aptamers to VEGF. 59-Endradiolabeled 5-I-U-substituted aptamerswere incubated with VEGF and exposedto pulses of 308 nm monochromatic light.Cross-linked complexes were separatedfrom free aptamer by electrophoresis in adenaturing polyacrylamide gel. In a, thespecificity of the observed complex is dem-onstrated for ligand t22.23 (5-I-U14). Atrace amount of radiolabeled aptamerwas incubated in buffer alone or with 1 nM

VEGF in the presence or absence of 10 nM

unlabeled competitor oligonucleotide.Competitors were either the VEGF-spe-cific aptamer, t22.23 (t22 in lane 3) or acontrol 29-F-pyrimidine oligonucleotidenot selected for binding to VEGF. Thecross-linked complex is observed onlywhen VEGF is present in the incubationmixture (compare lanes 1 and 2) and itsformation is inhibited only in the pres-ence of an oligonucleotide that can com-pete for the high affinity aptamer-bindingsite on VEGF (compare lanes 3 and 4).Photo-degradation products of the 5-I-U-substituted aptamer are indicated. In b, aportion of the carboxyl-terminal sequenceof VEGF165 with the numbering of theamino acids in the mature, secreted pro-tein is shown above with the amino acidthat participates in cross-linking to three5-I-U-substituted aptamers circled. Thechymotryptic (upper bar) and tryptic (low-er bar) fragments of VEGF that remaincross-linked to the aptamers after diges-tion are indicated below the amino acidsequence. The dashed line indicates thepoint at which the sequence data were nolonger reliable. Below, schematic repre-sentations of the three aptamers areshown where the U that participates incross-link formation is circled. The nucle-otide position of the cross-linking Uwithin the minimal aptamer sequence isindicated. Similarities in the consensusprimary structures of aptamers t22.23and t2.31 are boxed for emphasis. Nucle-otides shown in white shadowed letters atthe base of the stems in aptamers t2.31and t44.29 are deleted in the minimalaptamer sequences shown in Table II.



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

hydrogen bonding properties of various 29-substituents. In ad-dition, the 29-substituent on ribose affects its propensity toadopt a 29-endo or 39-endo pucker (58) which, in turn, influ-ences the tertiary structure of an oligonucleotide: the A- andB-form helices seen for RNA and DNA, respectively, provide afamiliar example. For these reasons, it is not surprising thatthe VEGF aptamers derived previously from RNA (33) or 29-NH2-pyrimidine RNA libraries (34) and those isolated from 29-F-pyrimidine libraries, described here, are not obviously related.

Aptamers with more stable structures may be expected tohave a lower entropic barrier to binding and may thereforehave higher affinity for their targets than aptamers that areconformationally unstable in solution (39). In model duplexes,a single 29-NH2 substitution has been observed to cause pro-found destabilization of the helix (35, 36), while 29-F- or 29-OMe-modified oligomers generally show enhanced helix stabil-ities (32, 37, 59). The VEGF aptamers derived from 29-F-pyrimidine-modified RNA libraries described here were almostexclusively of very high affinity, with Kd values in the range of10211 M. Three of the aptamers could be truncated significantlyto a minimal length ranging from 23 to 29 nucleotides. Despitetheir small size, the Tm values for the three minimal aptamers,prior to modification of the 29-OH-purines, ranged between 48and 63 °C. The affinities of the 29-F-pyrimidine VEGF aptam-ers were indeed higher than most of the 29-NH2-pyrimidineligands isolated previously (34), and, while there are insuffi-

cient data to make a systematic comparison, the three trun-cated 29-F-pyrimidine aptamers showed substantially higherthermal stabilities than the 29-NH2-pyrimidine-based aptamers(34). A comparison of 29-F- and 29-NH2-pyrimidine aptamershas also been made for ligands to keratinocyte growth factor(56), P-selectin,4 and interferon-g (57). With some exceptions(57), the aptamers derived from the 29-F-pyrimidine librariesdisplayed higher affinities for their target proteins. Together,these data support the notion that oligonucleotide librarieswith intrinsically higher thermal stabilities may be more likelyto yield aptamers with very high affinities for a moleculartarget. Relevant to this idea is the recent x-ray crystallographicevidence that affinity maturation of a hapten-binding antibodywas accompanied with a reduction in conformational change inthe antibody combining site upon antigen binding (60).

The VEGF165 spliced transcript includes exon 7 which en-codes a basic, carboxyl-terminal domain that mediates much ofthe heparin binding activity of the protein (61, 62). VEGF121,which lacks the exon 7-encoded domain, does not bind to hep-arin, and is about 100-fold less potent than VEGF165 in induc-ing a mitogenic response in endothelial cells (62, 63). The threetruncated, 29-OMe-substituted oligonucleotides show no bind-ing to VEGF121 at up to 100 nM concentration. The aptamersdescribed here are thus useful reagents for further delineatingthe role of VEGF165 relative to VEGF121.

All three aptamers can form a cross-link to VEGF165 atresidue Cys137 within the exon 7-encoded domain. Combinedwith the absence of binding to VEGF121, these data suggestthat the basic domain encoded by exon 7 contributes key con-tacts to the binding site for each of the aptamers. Structuralinformation for this region of the VEGF protein has not beenobtained (55) but we hypothesize from the cross-linking data

FIG. 5. VEGF receptor binding inhibition. 125I-Labeled VEGF(0.5 ng/ml) was incubated in the absence or presence of increasingconcentrations of aptamers or a control oligonucleotide with porcineaortic endothelial cells expressing either the Flt-1 (upper panel) or KDR(lower panel) human VEGF receptor. Counts/min of cell associatedradioactivity is plotted against the concentration of competing oligonu-cleotide for each of the three aptamers described in the text (t22-OMe,t2-OMe, and t44-OMe) and for a control oligonucleotide (scr t44-OMe)that corresponds to a sequence-scrambled analog of ligand t44-OMe.The points are the average of three separate experiments; less than 10%deviation was observed in any value. Cell associated radioactivity in theabsence of competitor was 1479 cpm for PAE/Flt-1 cells and 3431 cpmfor PAE/KDR cells. Residual binding in the presence of 50 ng/ml unla-beled VEGF was 456 cpm for PAE-Flt-1 cells and 1236 cpm for PAE/KDR cells.

FIG. 6. Inhibition of VEGF-induced vascular permeability.Adult female guinea pigs were injected intravascularly with Evans Bluedye followed by intradermal injection of VEGF alone (20 nM) or VEGFco-mixed with aptamer at 1 or 0.1 mM concentration. Leakage of the dyeinto the skin at the injection site as a result of VEGF-induced vascularpermeability was quantitated from a digital image of the trans-illumi-ninated skin. Data for each sample are expressed as a percentage of thesignal obtained with VEGF alone. PBS alone provided a control forVEGF-independent optical density associated with the injection site.PEG oligonucleotides were conjugated to 40-kDa polyethylene glycol atthe 59-end. Asterisks indicate those samples where the average valuewas significantly different from 100% (p , 0.05, one-sample t tests). Thestandard error of three determinations is shown for all oligonucleotidecontaining samples or of six determinations for PBS alone.



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

that Cys137 is solvent-accessible and that each of the aptamersbinds to a similar site on the VEGF protein that is very nearthis residue. It is interesting to note in this context that Sokeret al. (64) have found Gys137 to be essential for the binding ofexon 7-encoded peptides to the recently identified VEGF165-specific receptor (now also known as neuropilin-1 (65)). Weassume that the site of cross-linking within each aptamer oc-curs at the position of 5-I-U substitution. For all three aptam-ers, the cross-linking site corresponds to a residue that ishighly conserved among the members of each sequence family.As noted previously, Family 1 aptamers (represented by t22.23)and Family 2 aptamers (represented by t2.31) share a commonconserved sequence pattern, 59-GAAN(3–4)UUGG-39. The firstU in this sequence corresponds to the site of cross-linking inboth aptamers. This observation further supports the notionthat the members of both sequence families share a relatedtertiary structure and interact similarly with VEGF.

Placenta growth factor (PlGF) is a recently described cyto-kine whose amino acid sequence shows homology to that ofVEGF (53% identity) (40). Both proteins share a conservedpattern of eight cysteine residues with platelet-derived growthfactor that defines a tertiary structure common to all threeproteins (40, 55). PlGF binds to Flt-1 and, like VEGF, elicitsmigration of monocytes and tissue factor expression in mono-cytes and endothelial cells in culture (66). However, unlikeVEGF, PlGF is a very weak mitogen for endothelial cells (66).Consistent with the very high specificity that is generally dis-played by SELEX-derived aptamers, no binding was seen toPlGF homodimers. The recombinant PlGF used in these exper-iments corresponds to the smaller, 129-amino acid isoform ofthe protein (67). It is possible that the larger isoform, PlGF152,that includes a short, highly basic, carboxyl-terminal domain,may bind with higher affinity to the aptamers.

Heterodimers between PlGF and VEGF have recently beenisolated from the supernatants of tumor-derived cell lines andhave been shown to be potent endothelial cell mitogens (68, 69).We therefore tested whether the aptamers selected for bindingto VEGF165 display cross-reactivity with heterodimers ofPlGF129 and VEGF165. The affinities of the three aptamerswere consistently lower for the heterodimer relative toVEGF165, with Kd values of 790 pM, 40 nM and 430 pM forligands t22-OMe, t2-OMe and t44-OMe, respectively. This cor-responds to a reduction in affinity for the heterodimer com-pared with the VEGF165 homodimer of 11-, 308-, and 9-fold,respectively. The fact that the homodimer of VEGF has twopotential binding sites for an aptamer while the VEGF/PlGFheterodimer has only one can account for at most a 2-folddifference in the observed Kd. Since all of the observed bindingmay be presumed to derive from contacts to the VEGF subunitin the heterodimer, these data suggest that the high affinitybinding site for each of the aptamers involves contributionsfrom both subunits in the VEGF homodimer. Alternatively, theVEGF subunit may adopt a slightly different conformation, orcritical contact sites may be buried or blocked, in the het-erodimer. Thus, despite the similarity in the binding sites ofthe aptamers suggested by the cross-linking data, eachaptamer clearly forms a unique set of contacts with VEGF thataffect its behavior in assays of heterodimer binding, inhibitionof VEGF binding to its receptors and inhibition of VEGF-induced vascular permeability.

In addition to PlGF, other proteins with considerable homol-ogy to VEGF have been described, such as VEGF-B andVEGF-C (also called VEGF-related protein or VRP) (70–72),and since the amino acid conservation extends to the eightcysteine residues involved in inter- and intra-subunit disulfidebonds, VEGF may form heterodimers with these or other mem-

bers of this protein family. Indeed, VEGF and VEGF-B are ca-pable of forming heterodimers (70). Furthermore, partial diges-tion of VEGF165 by plasmin transiently generates a VEGF165/VEGF110 heterodimer whose mitogenic potency is intermediatebetween the undigested and fully digested (VEGF110/VEGF110)species (62). The ability of aptamers such as t44-OMe to bindwith appreciable affinity to VEGF165 (and, by inference, inhibitits activity) in various heterodimeric or partially digested formsmay have important functional consequences.

Human umbilical vein endothelial cells express two majorVEGF receptors: Flt-1 is expressed at a few thousand copiesper cell and binds VEGF with higher affinity (Kd 5 1–20 pM),while KDR shows a lower affinity for VEGF (Kd 5 50–770 pM)but is more abundant on the cell surface (16, 52, 53). Experi-ments using PAE cells transfected with the flt-1 or kdr receptorgene have suggested that KDR is the primary transducer inendothelial cells of VEGF-mediated signals related to changesin cell morphology and mitogenicity (41). More recently it wasdemonstrated that VEGF (or PlGF) signaling through Flt-1induces cell migration in monocytes and secretion of tissuefactor in both endothelial cells and monocytes (73, 74). Site-directed mutagenesis studies of VEGF165 or of a VEGF(1–109)

construct (which lacks the exon 7-encoded domain) have iden-tified discrete regions in the protein where charged residue-to-alanine mutations resulted in significantly reduced binding ofthe mutant protein to Flt-1 or KDR receptor fusion proteins(54, 55). The recently described crystal structure of VEGF(8–

109) bound to domain 2 of Flt-1 has further delineated many ofthe contacts in the high affinity VEGF-VEGF receptor complex(75). The VEGF aptamers described here inhibit the binding ofVEGF165 to both receptors expressed on PAE cells. It is likelythat the three aptamers make contacts with VEGF outside ofthe basic carboxyl-terminal domain, particularly in light of thefact that the oligonucleotides are nearly one-fifth as large asthe homodimeric protein. Thus, regions of VEGF critical forbinding to each of the receptors may be blocked by a boundaptamer. Furthermore, while the relative contribution of KDR-and Flt-1-mediated signaling to angiogenesis in vivo requiresfurther clarification, these data suggest that the minimal 29-OMe-modified aptamers should potently inhibit activities in-duced by either signaling pathway.

Since the minimal 29-OMe-modified aptamers were noteasily differentiated on the basis of length, degree of 29-OMesubstitution, affinity for VEGF, kinetics of binding, or thereceptor binding inhibition properties, we used the Milesassay to screen the three ligands for their relative capacity toinhibit the vascular permeability response induced by VEGFin vivo. One of the aptamers, t2-OMe, showed no activity inthis assay relative to a control oligonucleotide. This aptamerwas also somewhat less potent in inhibiting the binding of125I-labeled VEGF to receptor-expressing cell lines, in agree-ment with its somewhat lower affinity for VEGF. In contrast,a small decrease in permeability was observed with aptamert22-OMe and significant inhibition was observed with t44-OMe. A VEGF concentration of 20 nM was required to obtaina reproducibly robust vascular permeability response in ourhands. This exceeds by several orders of magnitude the con-centration of VEGF used to monitor VEGF receptor bindingand must account, in part, for the much higher concentrationof aptamer required to inhibit VEGF-induced vascular per-meability. While the relative inhibitory activity of the ligandsroughly correlates with their affinities for VEGF, the differ-ences in the Kd values are small and this seems an unlikelyexplanation for their differing behavior in the Miles assay.The dissociation rates of all three aptamers are comparableand fairly rapid so that diffusion away from the injection site



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

may limit opportunities for rebinding of the aptamers toVEGF. Consistent with this notion is the observation thatconjugation of polyethylene glycol to one of the aptamersdramatically improves its inhibitory capacity, an effect thatmay derive from the relatively slower diffusion rate of thehigher molecular weight conjugate.

Aptamers are chemically synthesized and can be readilyderivatized with a wide variety of functional groups (e.g. PEG)to modulate their properties in vivo, including plasma resi-dence time and biodistribution. We are currently testing the29-F-pyrimidine, 29-OMe-purine-substituted aptamers conju-gated to a variety of chemical moieties for inhibitory activity inin vivo models of angiogenesis.

Acknowledgments—We are indebted to Jeff Walenta and DaveSchneider for numerous analytical scale oligonucleotide syntheses andChandra Vargeese for large scale synthesis and PEG conjugation ofaptamers for the vascular permeability assay. We thank Brenda Zichifor help with sequence alignments and Bruce Feistner and Dom Zichifor advice concerning the generation and interpretation of meltingcurves. Thanks also to Julie Morris for help with the statistical analysisof the data and Brian Hicke at NeXstar and Tad Koch at the Depart-ment of Chemistry and Biochemistry, University of Colorado, Boulder,for guidance with the photo-cross-linking experiments.

REFERENCES

1. Folkman, J. (1995) Nat. Med. 1, 27–312. Risau, W. (1997) Nature 386, 671–6743. Gospodarowicz, D., Abraham, J. A., and Schilling, J. (1989) Proc. Natl. Acad.

Sci. U. S. A. 86, 7311–73154. Leung, D. W., Cachianes, G., Kuang, W.-J., Goeddel, D. V., and Ferrara, N.

(1989) Science 246, 1306–13095. Conn, G., Soderman, D. D., Schaeffer, M.-T., Wile, M., Hatcher, V. B., and

Thomas, K. A. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 1323–13276. Senger, D. R., Galli, S. J., Dvorak, A. M., Perruzzi, C. A., Harvey, V. S., and

Dvorak, H. F. (1983) Science 219, 983–9857. Senger, D. R., Perruzzi, C. A., Feder, J., and Dvorak, H. F. (1986) Cancer Res.

46, 5629–56328. Keck, P. J., Hauser, S. D., Krivi, G., Sanzo, K., Warren, T., Feder, J., and

Connolly, D. T. (1989) Science 246, 1309–13129. Carmeliet, P., Ferreira, V., Breier, G., Pollefeyt, S., Kieckens, L., Gertsenstein,

M., Fahrig, M., Vandenhoeck, A., Harpal, K., Eberhardt, C., Declercq, C.,Pawling, J., Moons, L., Collen, D., Risau, W., and Nagy, A. (1996) Nature380, 435–439

10. Ferrara, N., Carver-Moore, K., Chen, H., Dowd, M., Lu, L., O’Shea, K. S.,Powell-Braxton, L., Hillan, K. J., and Moore, M. W. (1996) Nature 380,439–442

11. Fong, G.-H., Rossant, J., Gertsenstein, M., and Breitman, M. L. (1995) Nature376, 66–70

12. Shalaby, F., Rossant, J., Yamaguchi, T. P., Gertsenstein, M., Wu, X.-F.,Breitman, M. L., and Schuh, A. C. (1995) Nature 376, 62–66

13. Ferrara, N., Houck, K., Jakeman, L., Winer, J., and Leung, D. W. (1991)J. Cell. Biochem. 47, 211–218

14. Takahashi, A., Sasaki, H., Kim, S. J., Tobisu, K., Kakizoe, T., Tsukamoto, T.,Kumamoto, Y., Sugimura, T., and Terada, M. (1994) Cancer Res. 54,4233–4237

15. Yoshiji, H., Gomez, D. E., Shibuya, M., and Thorgeirsson, U. P. (1996) CancerRes. 56, 2013–2016

16. Brown, L. F., Detmar, M., Claffey, K., Nagy, J. A., Feng, D., Dvorak, A. M., andDvorak, H. F. (1997) in Regulation of Angiogenesis (Goldberg, I. D., andRosen, E. M., eds) pp. 233–269, Birkhauser Verlag, Basel

17. Plate, K. H., Breier, G., Weich, H. A., Mennel, H. D., and Risau, W. (1994) Int.J. Cancer 59, 520–529

18. Ferrara, N., and Davis-Smyth, T. (1997) Endocr. Rev. 18, 4–2519. Kim, K. J., Li, B., Winer, J., Armanini, M., Gillett, N., Phillips, H. S., and

Ferrara, N. (1993) Nature 362, 841–84420. Millauer, B., Shawver, L. K., Plate, K. H., Risau, W., and Ullrich, A. (1994)

Nature 367, 576–57921. Warren, R. S., Yuan, H., Matli, M. R., Gillett, N. A., and Ferrara, N. (1995) J.

Clin. Invest. 95, 1789–179722. Melnyk, O., Shuman, M. A., and Kim, K. J. (1996) Cancer Res. 56, 921–92423. Adamis, A. P., Miller, J. W., Bernal, M.-T., D’Amico, D. J., Folkman, J., Yeo,

T.-K., and Yeo, K.-T. (1994) Am. J. Ophthalmol. 118, 445–45024. Pierce, E. A., Avery, R. L., Foley, E. D., Aiello, L. P., and Smith, L. E. H. (1995)

Proc. Natl. Acad. Sci. U. S. A. 92, 905–90925. Kvanta, A., Algvere, P. V., Berglin, L., and Seregard, S. (1996) Invst. Ophthalmol.

& Visual Sci. 37, 1929–193426. Koch, A. E., Harlow, L. A., Haines, G. K., Amento, E. P., Unemori, E. N., Wong,

W. L., Pope, R. M., and Ferrara, N. (1994) J. Immunol. 152, 4149–415627. Detmar, M., Brown, L. F., Claffey, K. P., Yeo, K. T., Kocher, O., Jackman,

R. W., Berse, B., and Dvorak, H. F. (1994) J. Exp. Med. 180, 1141–114628. Tuerk, C., and Gold, L. (1990) Science 249, 505–51029. Ellington, A., and Szostak, J. (1990) Nature 346, 818–82230. Gold, L., Polisky, B., Uhlenbeck, O., and Yarus, M. (1995) Annu. Rev. Biochem.

64, 763–79731. Pieken, W. A., Olsen, D. B., Benseler, F., Aurup, H., and Eckstein, F. (1991)

Science 253, 314–31732. Cummins, L. L., Owens, S. R., Risen, L. M., Lesnik, E. A., Freler, S. M., McGee,

D., Guinosso, C. J., and Cook, P. D. (1995) Nucleic Acids Res. 23, 2019–202433. Jellinek, D., Green, L. S., Bell, C., and Janjic, N. (1994) Biochemistry 33,

10450–1045634. Green, L. S., Jellinek, D., Bell, C., Beebe, L. A., Feistner, B. D., Gill, S. C.,

Jucker, F. M., and Janjic, N. (1995) Chem. Biol. 2, 683–69535. Aurup, H., Tuschl, T., Benseler, F., Ludwig, J., and Eckstein, F. (1994) Nucleic

Acids Res. 22, 20–2436. Miller, D. S., Bhan, P., and Kan, L.-S. (1993) Nucleosides Nucleotides 12,

785–79237. Lesnik, E. A., Guinosso, C. J., Kawasaki, A. M., Sasmor, H., Zounes, M.,

Cummins, L. L., Ecker, D. J., Cook, P. D., and Freier, S. M. (1993)Biochemistry 32, 7832–7838

38. Kawasaki, A. M., Casper, M. D., Freier, S. M., Lesnik, E. A., Zounes, M. C.,Cummins, L. L., Gonzalez, C., and Cook, P. D. (1993) J. Med. Chem. 36,831–841

39. Eaton, B. E., Gold, L., and Zichi, D. A. (1995) Chem. & Biol. 2, 633–63840. Maglione, D., Guerriero, V., Viglietto, G., Delli-Bovi, P., and Persico, M. G.

(1991) Proc. Natl. Acad. Sci. U. S. A. 88, 9267–927141. Fitzwater, T., and Polisky, B. (1996) Methods Enzymol. 267, 275–30142. Green, L. S., Jellinek, D., Jenison, R., Ostman, A., Heldin, C.-H., and Janjic, N.

(1996) Biochemistry 35, 14413–1442443. Petersheim, M., and Turner, D. H. (1983) Biochemistry 22, 256–26344. Konigsberg, W. (1969) Methods Enzymol. 13, 185–18845. Waltenberger, J., Claesson-Welsh, L., Siegbahn, A., Shibuya, M., and Heldin,

C.-H. (1994) J. Biol. Chem. 269, 26988–2699546. Gill, S. C., Weitzel, S. E., and von Hippel, P. H. (1991) J. Mol. Biol. 220,

307–32447. Beigelman, L., McSwiggen, J. A., Draper, K. G., Gonzalez, C., Jensen, K.,

Karpeisky, A. M., Modak, A. S., Matulic-Adamic, J., DiRenzo, A. B.,Haebereli, P., Sweedler, D., Tracz, D., Grimm, S., Wincott, F. E., Thackray,V. G., and Usman, N. (1995) J. Biol. Chem. 270, 25702–25708

48. Green, L., Waugh, S., Binkley, J. P., Hostomska, Z., Hostomsky, Z., and Tuerk,C. (1995) J. Mol. Biol. 247, 60–68

49. Jenison, R. D., Walker, D. W., Jennings, S. D., Bargatze, R. F., and Parma, D.(1998) Antisense & Nucleic Acid Drug Develop. 8, in press

50. Norris, C. L., Meisenheimer, P. L., and Koch, T. H. (1996) J. Am. Chem. Soc.118, 5796–5803

51. Meisenheimer, K. M., and Koch, T. H. (1997) Crit. Rev. Biochem. Mol. Biol. 32,101–140

52. de Vries, C., Escobendo, J. A., Ueno, H., Houck, K., Ferrara, N., and Williams,L. T. (1992) Science 255, 989–991

53. Terman, B. I., Dougher-Vermazen, M., Carrion, M. E., Dimitrov, D., Armellino,D. C., Gospodarowicz, D., and Bohlen, P. (1992) Biochem. Biophys. Res.Commun. 187, 1579–1586

54. Keyt, B. A., Nguyen, H. V., Berleau, L. T., Duarte, C. M., Park, J., Chen, H.,and Ferrara, N. (1996) J. Biol. Chem. 271, 5638–5646

55. Muller, Y. A., Li, B., Christinger, H. W., Wells, J. A., Cunningham, B. C., andde Vos, A. M. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 7192–7197

56. Pagratis, N. C., Bell, C., Chang, Y.-F., Jennings, S., Fitzwater, T., Jellinek, D.,and Dang, C. (1997) Nat. Biotechnol. 15, 68–73

57. Kubik, M. F., Bell, C., Fitzwater, T., Watson, S. R., and Tasset, D. M. (1997)J. Immunol. 159, 259–267

58. Guschlbauer, W., and Jankowski, K. (1980) Nucleic Acids Res. 8, 1421–143359. Kakiuchi, N., Marck, C., Rousseau, N., Leng, M., De Clercq, E., and

Guschlbauer, W. (1982) J. Biol. Chem. 257, 1924–192860. Wedemayer, G. J., Patten, P. A., Wang, L. H., Schultz, P. G., and Stevens, R. C.

(1997) Science 276, 1665–166961. Soker, S., Fidder, H., Neufeld, G., and Klagsbrun, M. (1996) J. Biol. Chem.

271, 5761–576762. Keyt, B. A., Berleau, L. T., Nguyen, H. V., Chen, H., Heinsohn, H., Vandlen, R.,

and Ferrara, N. (1996) J. Biol. Chem. 271, 7788–779563. Plouet, J., Moro, F., Bertagnolli, S., Coldeboeuf, N., Mazarguil, H., Clamens,

S., and Bayard, F. (1997) J. Biol. Chem. 272, 13390–1339664. Soker, S., Gollamundi-Payne, S., Fidder, H., Charmahelli, H., and Klagsbrun,

M. (1997) J. Biol. Chem. 272, 31582–3158865. Soker, S., Takashima, S., Miao, H. Q., Neufeld, G., and Klagsbrun, M. (1998)

Cell 92, 735–74566. Park, J. E., Chen, H. H., Winer, J., Houck, K. A., and Ferrara, N. (1994) J. Biol.

Chem. 269, 25646–2565467. Maglione, D., Guerriero, V., Viglietto, G., Ferraro, M. G., Aprelikova, O.,

Alitalo, K., Del Vecchio, S., Lei, K.-J., Chou, J. Y., and Persico, M. G. (1993)Oncogene 8, 925–931

68. DiSalvo, J., Bayne, M. L., Conn, G., Kwok, P. W., Trivedi, G., Soderman, D. D.,Palisi, T. M., Sullivan, K. A., and Thomas, K. A. (1995) J. Biol. Chem. 270,7717–7723

69. Cao, Y., Chen, H., Zhou, L., Chiang, M.-K., Anand-Apte, B., Weatherbee, J. A.,Wang, Y., Fang, F., Flanagan, J. G., and Tsang, M. L.-S. (1996) J. Biol.Chem. 271, 3154–3162

70. Olofsson, B., Pajusola, K., Kaipainen, A., von Euler, G., Joukov, V., Saksela,O., Orpana, A., Pettersson, R. F., Alitalo, K., and Eriksson, U. (1996) Proc.Natl. Acad. Sci., U. S. A. 93, 2576–2581

71. Joukov, V., Pajusola, K., Kaipainen, A., Chilov, D., Lahtinen, I., Kukk, E.,Saksela, O., Kalkkinen, N., and Alitalo, K. (1996) EMBO J. 15, 290–298

72. Lee, J., Gray, A., Yuan, J., Luoh, S.-M., Avraham, H., and Woold, W. I. (1996)Proc. Natl. Acad. Sci. U. S. A. 93, 1988–1992

73. Clauss, M., Weich, H., Breier, G., Knies, U., Rockl, W., Waltenberger, J., andRisau, W. (1996) J. Biol. Chem. 271, 17629–17634

74. Barleon, B., Sozzani, S., Zhou, D., Weich, H. A., Mantovani, A., and Marme, D.(1996) Blood 87, 3336–3343

75. Wiesmann, C., Fuh, G., Christinger, H. W., Eigenbrot, C., Wells, J. A., and deVos, A. M. (1997) Cell 91, 695–704



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Henninger, Lena Claesson-Welsh and Nebojsa JanjicJudy Ruckman, Louis S. Green, Jim Beeson, Sheela Waugh, Wendy L. Gillette, Dwight D.

INTERACTIONS REQUIRING THE EXON 7-ENCODED DOMAINAND VEGF-INDUCED VASCULAR PERMEABILITY THROUGH

): INHIBITION OF RECEPTOR BINDING165Endothelial Growth Factor (VEGF-Fluoropyrimidine RNA-based Aptamers to the 165-Amino Acid Form of Vascular′2

doi: 10.1074/jbc.273.32.205561998, 273:20556-20567.J. Biol. Chem.

http://www.jbc.org/content/273/32/20556Access the most updated version of this article at

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/273/32/20556.full.html#ref-list-1

This article cites 73 references, 34 of which can be accessed free at


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/content/273/32/20556

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;273/32/20556&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/273/32/20556

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=273/32/20556&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/273/32/20556

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/273/32/20556.full.html#ref-list-1

http://www.jbc.org/

› content › 273 › 32 › 20556.full.pdf the j b c printed in u.s.a. -fluoropyrimidine...

Documents