a caspase 8-based suicide switch induces apoptosis in nanobody-directed chimeric receptor expressing...

ORIGINAL ARTICLE

A caspase 8-based suicide switch induces apoptosisin nanobody-directed chimeric receptor expressing T cells

Sepideh Khaleghi • Fatemeh Rahbarizadeh •

Davoud Ahmadvand • Mohammad J. Rasaee •

Philippe Pognonec

Received: 18 December 2011 / Revised: 16 February 2012 / Accepted: 22 February 2012 / Published online: 11 March 2012

� The Japanese Society of Hematology 2012

Abstract In accordance with the two-step hypothesis of

T cell activation and the observation that stimulation

through the T cell receptor (TCR) alone may lead to

anergy, we focused on the introduction of co-stimulatory

signaling to this type of receptors to achieve optimal

activation. Enhanced mRNA and cell surface receptor

expression via the co-stimulatory gene fragment (OX40)

was confirmed by RT-PCR and flow cytometry. Inclusion

of the OX40 co-stimulatory signaling region in series with

the TCR led to enhanced antigen-induced IL-2 production

after stimulation by MUC1-expressing cancer cell lines as

compared to the chimeric receptor without OX40. More-

over, with the aim of maintaining high efficiency, while

providing a means of controlling any possible unwanted

proliferation in vivo, a regulation system was used. This

controls the dimerization of a membrane-bound caspase 8

protein. Toward that goal, pFKC8 and CAR constructs

were co-transfected into Jurkat cells, and the level of

apoptosis was measured. 24 h after addition of the dimer-

izer, a 91% decrease in transfected cells was observed.

Keywords Nanobody � Chimeric receptor � Apoptosis �OX40 � Co-stimulatory signal

Abbreviations

BSA Bovine serum albumin

CAR Chimeric antigen receptor

CH2-CH3-hinge Sequences coding for CH2-CH3-

hinge regions of human IgG3

CH2-CH3-hinge–hinge Sequences coding for CH2-CH3-

hinge-hinge regions of human

IgG3

CD28 cDNA coding for the

transmembrane and intracellular

part of CD28 (153–220 aa)

CD3f cDNA coding for the

intracellular domain of CD3f(52–164 aa)

ELISA Enzyme-linked immunosorbant

assay

IgG Immunoglobulin G

LB Luria-Bertani

MW Molecular weight

Nb Nanobody

PBS Phosphate buffered saline

pFKC8 pC4-MFv2E plasmid containing

myristoylation signal-modified

FKBP12-modified FKBP12-

caspase 8 cassette

pZCHHN CD3f-CD28-(CH2-CH3-hinge–

hinge)-Nb cassette inserted in

pCDNA3.1/Hygro(?) plasmid

pZCHN CD3f- CD28-(CH2-CH3-hinge)-

Nb cassette inserted in


S. Khaleghi � F. Rahbarizadeh (&) � M. J. Rasaee

Department of Medical Biotechnology,

School of Medical Sciences,

Tarbiat Modares University,

P.O. Box: 14115-331, Tehran, Iran

e-mail: [email protected]

D. Ahmadvand

School of Allied Medical Sciences,

Tehran University of Medical Sciences, Tehran, Iran

P. Pognonec

CNRS UMR6235, Faculte de Medecine,

Universite de Nice, 28 avenue de Valombrose,

06107 Nice Cedex 2, France

123

Int J Hematol (2012) 95:434–444

DOI 10.1007/s12185-012-1037-6

pZOCHHN CD3f-OX40-CD28-(CH2-CH3-

hinge–hinge)-Nb cassette

inserted in pCDNA3.1/Hygro(?)

plasmid

pZOCHN CD3f-OX40-CD28-(CH2-CH3-

hinge)-Nb cassette inserted in


scFv Single-chain fragment variable

TAA Tumour-associated antigen

VHH Variable domain from a camel

heavy chain antibody

Introduction

There are many factors which can influence the ability of

the body’s T cells to eradicate cancerous neoplasms such as

the uniformity of antigen expression on tumour cells, the

masking of tumour antigens by other proteins, the loss of

tumour antigens by subsequent mutations or deletions in

tumour variants, production of immunosuppressive cyto-

kines such as IL-10 and TGF-b or prostaglandins that

interfere with activation of T cells, poor lymphocyte

infiltration into the tumour mass, insufficient processing

and presentation of tumour antigens by antigen presenting

cells and apoptosis or elimination of infused tumour reac-

tive T cells [1, 2]. Because of these obstacles, an alternative

approach for T cell therapy is the T body approach, in

which the humoral and cellular arms of the immune system

have been combined and antibody-derived variable regions

of the desired specificity are used for cancer targeting [3].

In accordance with the two-step hypothesis of T cell

activation, the observation that stimulation through the T

cell receptor (TCR) alone may lead to anergy or death

rather than activation [4], and the importance of co-stim-

ulation in tumour immunotherapy [5], recent effort has

focused on the introduction of co-stimulatory signaling of

this type of receptor [6]. While CD28 signaling provides

the initial co-stimulus for proliferation [7], the domains

from co-stimulatory molecules such as OX40, 4-1BB and

inducible T cell co-stimulator (ICOS) facilitate the survival

of effector T cells and promote proliferation and induction

of T cell effector functions through chimeric antigen

receptor (CAR) recognition [8, 9]. Among these co-stim-

ulatory molecules, linking the CD28 with the OX40

domain has in particular been shown to greatly enhance the

functions of chimeric receptor-transduced cells with a

markedly increased proliferation, cytokine release and

effector function [10, 11].

Variable domain of heavy chain of heavy chain anti-

bodies (VHH) or nanobodies (Nb) are the smallest frag-

ments of antibodies that have great homology to the human

variable domain of the heavy chain of conventional anti-

bodies (VH) and low immunogenic potential. For the first

time, we used Nb as the antigen recognizing fragment in

the T cell receptor. A panel of CAR expressing constructs

that harbour the anti-MUC1 nanobody [12], the signaling

and co-signaling moieties of the CD3f/CD28 chimera and

different spacer regions derived from human IgG3 with one

repeat of the hinge sequence (pZCHN) or two repeats of

the hinge sequence (pZCHHN) were constructed. Here, we

hypothesized that antigen engagement of this CAR linked

to an endodomain supplying CD3f, CD28 and OX40 sig-

nals would produce sustained activation, proliferation and

effector function in resting T cells.

Moreover, with the aim of maintaining a high efficiency

but concomitantly guaranteeing a way to control any pos-

sible unwanted in vivo T cell proliferation, a suicide gene

system has been adopted and different combinations were

tested [13, 14]. Several enzymes that convert prodrugs such

as 5-fluorocytosine [15], 6-thioxantine, fludarabine, meth-

otrexate and cyclophosphamide can potentially be used as

suicide genes for genetically modified T cells [16]. The

modified form of caspase 8 appears as an attractive proa-

poptotic factor that could be considered as a suicide gene.

The system has low leakiness under non-induced condi-

tions and is highly efficient upon induction. Administration

of the chemical inducer of dimerization (CID) results in the

aggregation of inducible caspase 8 molecules, leading to

their activation [17]. Caspase 8 is recruited to the death-

inducing signal complex (DISC), a multi-protein complex

that forms rapidly on the cytoplasmic portion of the Fas/

APO-1/CD95 receptor after ligand engagement by the

adapter protein FADD/MORT1. The caspase 8 precursor

protein is cleaved at three aspartate residues to become

active and ultimately induces apoptosis. This mechanism

defines caspase 8 as a powerful humanized system for

suicide gene applications, as well as for mechanistic

research related to apoptosis. Caspase 8 is an initiator

caspase in the death receptor pathway. Its position at the

top of the caspase cascade permits the triggering of both

extrinsic and intrinsic apoptosis pathways [18]. To create a

third generation of MUC1 specific chimeric T cell recep-

tors with a safety switch, we used a regulated dimerization

system with caspase 8 as a suicide gene system.

Materials and methods

Cell culture

The cell lines used in this study were chosen from cells

with different levels of human MUC1 expression. T47D

(Human breast ductal carcinoma, with a high expression of

MUC1), MCF7 (human breast adenocarcinoma, with a

A caspase 8-based suicide switch for CAR transfectants 435

123

high expression of MUC1), A431 (human squamous cell

carcinoma of head and neck cell line, with dubious

expression of MUC1), NIH3T3 (Swiss NIH mouse embryo

fibroblast-like, with no expression of MUC1) were the cells

chosen for this study. Jurkat E6.1 (Human lymphoblast-

like) cells were used as a T cell model. The cells were

cultured in DMEM (Sigma, St. Louis, MO, USA) or RPMI

(Sigma) based on the information provided with each cell

line supplemented with 10% fetal bovine serum (FBS) and

penicillin and streptomycin (100 IU/ml and 100 lg/ml,

respectively). All cells were grown at 37�C in a humidified

5% CO2 atmosphere.

Constructs

Chimeric T cell receptor

The intracellular domain of CD3f (52–164 aa) was ampli-

fied by PCR utilizing pZCHN as the template and flanked

with a XbaI restriction site using the P1 (50-AGAGT

GAAGTTCAGCAGGAGC-30) and P2 (50-TGCTCTAGAT

GGCTGTTAGCGAGG-30) primers. The transmembrane

and intracellular parts of CD28 (153–220 aa) were amplified

by PCR utilizing pZCHN as the template as well and flanked

with a XhoI restriction site using the P3 (50-CCGCTCG

AGTTTTGGGTGCTGGTGGTGGTTG-30) and P4 (50-GCTGAACTTCACTCTGGAGCGATAG-30) primers. The

trans-membrane part of OX40 was synthesized by overlap-

ping oligonucleotides, P4-OX40 (50-CCTGCTCCTCTTGG

ATGGGGGTCCGGAAACTGCCTCCCCCAGGGGGCTT

GTGGGCATCGGGGGGCAGCCTCTGGTCCCTCCGGA

GCAGGTACAGGGCGGAGCGATAGGCTGCGAAGT

C-30) and P1-OX40 (50-CCATCCAAGAGGAGCAGGCCG

ACGCCCACTCCACCCTGGCCAAGATCAGAGTGAA

GTTCAGCAGGAGC-30) on the above PCR products. We

synthesized the CD28-OX40-CD3f gene construct by SOE

PCR and amplified this construct using P2 (50-TGCTCTAG

ATGGCTGTTAGCGAGG-30) and P3 (50-CCGCTCGAGT

TTTGGGTGCTGGTGGTGGTTG-30) primers for intro-

ducing Xba1/Xho1 flanking sites on this construct. The

resulting fragment was verified by sequencing and replaced

in the Xba1/Xho1 site of the previously prepared CAR

constructs (pZCHN and pZCHHN) to generate CD3f-OX40-

CD28 -(CH2-CH3-hinge)-Nb and CD3f-OX40-CD28

-(CH2-CH3-hinge–hinge)-Nb cassettes in the pCDNA3.1/

Hygro(?) vector (pZOCHN and pZOCHHN, respectively).

Dimerization construct

To evaluate the efficiency of caspase 8-derived constructs

and the induction of apoptosis in a controllable manner in

CAR expressing T cells, we used pFKC8. In that construct,

262 amino acids of the C-terminal portion of human caspase

8 were fused to a repetition of two modified domains of the

human protein FKBP12 and to a myristoylation signal to

mimic recruitment to the membrane in the pC4-MFv2E

plasmid (pFKC8). The inducer of dimerization is AP20187,

a non-toxic synthetic FK506-analogue, which has been

modified to reduce interactions with endogenous FKBPs,

while enhancing binding to the FK506-BP12 variant [17].

We have included a schematic representation of the

chimeric T cell receptor and pFKC8 constructs in Fig. 1.

Fig. 1 Schematic presentation

of CAR and FKC8 cassettes.

ZCHN: ‘‘CD3f-CD28-(CH2-

CH3-hinge)-nanobody’’

cassette; ZCHHN: ‘‘CD3f-

CD28-(CH2-CH3-hinge–

hinge)-nanobody’’ cassette;

ZOCHN: ‘‘CD3f-OX40-CD28-

(CH2-CH3-hinge)-nanobody’’

cassette; ZOCHHN: ‘‘CD3f-

OX40-CD28-(CH2-CH3-hinge–

hinge)-nanobody’’ cassette;

FKC8: ‘‘myristoylation signal-

modified FKBP12-modified

FKBP12-caspase 8’’ cassette

436 S. Khaleghi et al.

123

Transfection

One day prior to transfection, 4 9 105 Jurkat cells were

dispensed into a 6-well plate. Jurkat cells were transfected

in triplicate with 2.5 lg of pZCHN, pZCHHN, pZOCHN,

pZOCHHN or pCDNA3.1/Hygro(?). In parallel, the cells

were co-transfected with 2.5 lg of either pZOCHN or

pZOCHHN and 2.5 lg of pFKC8 in a 1:1 CAR expressing

plasmids to apoptosis inducer plasmid ratio. Transfection

was carried out using Lipofectamine 2000 (Invitrogen, San

Diego, CA, USA) according to the manufacturer’s

procedure.

Four hours after transfection, the medium was replaced

with complete RPMI 1640 medium containing 10% FBS,

and incubated at 37�C. After 24 h, aliquots of the cells

were taken for expression analysis and the medium was

replaced with complete RPMI 1640 medium.

CAR mRNA expression analysis

Total RNA was isolated from 106 receptor grafted and non-

transfected Jurkat cells by Nucleo Spin RNA II (Machin-

ery-Nagel, Duren, Germany). cDNA was synthesized using

M-MuLV reverse transcriptase and oligo-dT (MBI, Fer-

mentas, St. Leon-Rot, Germany). As non-treated Jurkat

cells do not express the CD28-OX40-CD3f chimera, the P2

and P3 primers were used for mRNA expression analysis in

semi-quantitative and quantitative real-time PCR by stan-

dard procedures.

Due to the increased sensitivity and dynamic range of

real-time PCR, many of the well-known house keeping

genes such as GAPDH and b-actin have been shown in

different tissues or cell types to be affected by different

treatments and biological processes [19], Nevertheless,

since b-actin as the internal control had the best results in

our pilot assay, we decided to rely on it. The primers used

are BA-For (50-AGTAGGCTTTGTGGTTGATG-30) and

BA-Bac (50-CTGTCAGGAAAGGAGAAATC-30). Analy-

sis of transcript relative copy number adjusted to b-actin

was carried out using iTaqTM SYBR� Green Supermix

(BioRad, Hercules, CA, USA) and by the thermal cycler

from Applied Biosystems. The quantity of each sample is

expressed relative to a single calibrator sample during

relative quantization. The changes in sample gene expres-

sion are measured based on either an external standard or a

reference sample (calibrator), and results are expressed as a

target/reference ratio.

Flow cytometry

To confirm the surface expression of chimeric receptor

cassettes on T cells, approximately 5 9 105 non-transfec-

ted or gene-modified T cells were washed twice with 1%

BSA in phosphate buffered saline (PBS) then re-suspended

and incubated with antibodies against nanobodies (10 lg/

ml) at 4�C for 35 min. Then cells were washed twice, and

re-suspended in 200 ll PBS with FITC conjugated goat

anti-rabbit antibody (LifeSpan BioSciences). Thereafter,

the cells were re-suspended in 500 ll 1% paraformalde-

hyde in PBS and the expression levels of chimeric recep-

tors were analysed by flow cytometry (FACScan,

BectonDickinson, Heidelberg, Germany). Results were

statistically evaluated using the CellQuest program (Bec-

ton–Dickinson, San Jose, CA, USA). Monoclonal mouse

IgG was used in all experiments to determine background

immunostaining.

Chimeric receptor functional assays

The proliferation and IL-2 production of CAR receptor

grafted Jurkat cells upon incubation with T47D, MCF7,

A431 and NIH3T3 cells were evaluated. Transfected and

non-transfected Jurkat cells (6 9 104 cells/well) were co-

cultivated in 96-well plates upon confluent MUC1 positive

cell lines (T47D and MCF7), A431 tumour cells and a MUC1

negative cell line (NIH3T3 cells) (2 9 104 cells/well). Non-

transfected Jurkat cells and Jurkat cells transfected with

pCDNA3.1/Hygro(?) vector were used as controls.

After 24 h, suspended cells were harvested and collected

viable cells (receptor grafted and control Jurkat cells) were

counted. Tests were performed in triplicate wells, and

transfected and non-transfected Jurkat cells were counted

in a Neubauer WBC chamber. Specific cytotoxicity of

receptor grafted and non-transformed Jurkat cells against

cancerous cells was measured by counting and evaluating

the number of dead and alive cells by trypan blue staining.

To quantify secreted IL-2, the supernatants were harvested

and levels of IL-2 were measured by ELISA assay,

according to the manufacturer’s instructions (CLB,

Amsterdam, The Netherlands). This experiment was per-

formed in triplicate.

Induction and analysis of apoptosis

For determining the best concentration of AP20187 di-

merizer, a dose–response curve was performed with

increasing amounts of AP20187 (0.001, 0.01, 0.05, 0.1, 1,

10, and 100 nM) using Jurkat cells [17]. The optimum

concentration was determined using pZOCHHN transfec-

ted and a transient co-transfected (CAR construct and

apoptosis construct) Jurkat cells. For this experiment, 24 h

after CAR transfection or co-transfection of CAR

expressing plasmids and apoptosis inducer plasmid in

Jurkat cells, optimum concentration of CID was added to

the wells. The cells were incubated at 37�C in a humidified

5% CO2 atmosphere. Cell viability and mode of cell death


123

were determined 12, 24, 48, 72 h after treatments by MTT

and flow cytometric assay, respectively.

For the MTT assay, 2 9 105 cells were harvested after the

induction of apoptosis and 10 ll of the MTT reagent was

added to the wells and incubated for 3 h at 37�C. At the end

of the incubation, the medium was removed. Then, 100 ll

DMSO was added into each well to dissolve the formazan

crystals by pipetting up and down several times. The

absorbance on an ELISA plate reader with a test wavelength

of 540 nm was measured to obtain sample signal.

Cell apoptosis was quantified by analysing phosphati-

dylserine (PS) exposure and membrane integrity by

Annexin-V coupled to FITC (IQ product, Groningen, The

Netherlands) according to the manufacturer’s instructions.

Annexin-V has a strong, specific affinity for PS, and binds

tightly to PS exposed on the cell surface during apoptosis.

Briefly, the cells were harvested and washed with calcium

chloride buffer (BD Pharmingen, San Jose, CA, USA).

Cells were stained with Annexin-V for 20 min in 4�C in

the dark then washed by calcium chloride buffer and

adjusted to 100 ll. Within 1 h post staining, cells were

analysed by flow cytometry.

Statistical methods

Different experimental groups within the study were

compared using the Kruskal–Wallis test. Comparisons

between the pairs of groups were performed with the

Mann–Whitney test. A probability of less than 0.05

(p \ 0.05) was used for statistical significance.

Results

Construct preparations

The CD28-OX40-CD3f cassette was made by overlapping

oligonucleotides. Figure 2 shows the result of the PCR-

amplified cassette (690 bp). After replacement of this cas-

sette in the Xba1/Xho1 site in the previously prepared CAR

expressing constructs (pZCHN and pZCHHN) [12], its

sequence and orientation were confirmed by sequencing. In

the products, the anti-MUC1 nanobody was joined by spacers

(the CH2 and CH3 constant domains and one or two repeats of

hinge region of human IgG3) to the CD28-OX40-CD3fchain. A panel of chimeric receptors comprising the same

antigen-binding specificity and extracellular spacer region

but different signaling regions was prepared and evaluated.

mRNA expression analysis of chimeric receptors

24 h after cell transfection, total RNA of each well was

isolated and cDNA was synthesized using oligo-dT primer.

The mRNA expression of the CARs was evaluated by

semi-quantitative and quantitative real-time RT-PCR using

P2 and P3 primers (for expression detection of CD28-

OX40-CD3f and CD28-CD3f cassettes) and b actin

primers. The b actin house keeping gene is implicated in

diverse cellular processes and commonly used as an

internal reference for quantitative real-time PCR in animals

was used for expression stability analysis.

In semi-quantitative RT-PCR, the net intensity of each

individual band was evaluated (Fig. 3a). According to

Fig. 3a, results show that the expression ratio of CAR

mRNA in both OX40 containing CAR constructs was more

than the pZCHN and pZCHHN transfected cells.

In another set of experiments, analysis of CAR gene

expression was achieved via real-time quantitative RT-PCR

by the Pfaffl model (Fig. 3b). A primer amplification per-

formance test by real-time RT-PCR showed that all primer

combinations yield a single amplicon and the absence of

primer dimmer formation in the dissociation step. The

overall cycle threshold values (Ct) obtained for the different

constructs were compared. This model combines gene

quantification and normalization into a single calculation.

The Pfaffl model incorporates the amplification efficiencies

of the target and reference (normalization) genes to correct

for differences between the two assays. The expression ratio

is calculated with the following formula:

Expression ratio ¼ EðCtcontrol�CttargetÞtarget =E

ðCtcontrol�CttargetÞreference

Figure 3b shows chimeric receptors and b-actin

expression ratio in different treatments. According to

these results, in both pZOCHHN and pZOCHN

transfected Jurkat cells, the expression ratio of the CAR

mRNA was similar. The Ct values of the candidate

Fig. 2 Agarose gel electrophoresis of representative CD3f-OX40-

CD28 PCR product, 1: CD28-OX40 (307 bp); 2:CD3f-OX40

(392 bp); 3: CD3f-OX40-CD28 (690 bp); M: molecular weight

marker


123

constructs (data not shown) were distributed from 21 to 32,

in which the lowest Ct (highest expression) corresponds to

pZOCHHN and pZOCHN and the highest Ct is related to

the calibrator. The expression ratio of the constructs

including the OX40 gene fragment is 256 times and

16.11 times more abundant as compared to the calibrator

and pZCHHN and pZCHN, respectively (Kruskal–Wallis

one-way analysis of variance, p = 0.003). So we

concluded that insertion of the OX40 co-stimulatory

molecule in CAR constructs has a significant effect on

the increasing mRNA expression. As was expectedly, the

level of CAR mRNA in pCDNA/Hygro(?) transfected and

non-transfected Jurkat cells was not detectable.

Cell surface CAR receptor expression

For analysis of cell surface expression, transfected Jurkat

cells that express the MUC1 specific chimeric immunore-

ceptor were identified by flow cytometry after 24 h. The

results of the flow cytometry demonstrated significant

levels of surface expression of the CARs on the transfected

cells. Figure 3c shows the results of flow cytometry assay

which are results of histograms of FL1 signal plotted

against frequency for the transfectants expressing the chi-

meric receptor cassettes and non-transfected cells. The

results show that the expression of CD3f-OX40-CD28-

(CH2-CH3-hinge)-Nb and CD3f-OX40-CD28-(CH2-CH3-

hinge–hinge)-Nb was similar to that of the CD3f-CD28-

(CH2-CH3-hinge)-Nb and CD3f-CD28-(CH2-CH3-hinge–

hinge)-Nb cassettes. The presence of the OX40 domain did

not result in less expression of the CAR than the pZCHN

and pZCHHN did.

Proliferation and cytokine production mediated

by specific activation of chimeric receptors

To monitor the changes in the growth rate of receptor

grafted Jurkat cells in the context of antigen stimulation,

Fig. 3 mRNA expression analysis of CAR receptor. a Semi-quanti-

tative RT-PCR, electrophoresis on 1% agarose gel (CD3f-OX40-

CD28 PCR product is 690 bp, CD3f-CD28 PCR product is 568 bp

and b actin product is 131 bp): 1 pZCHN transfected cell, 2 pZCHHN

transfected cell, 3 pZOCHN transfected cell, 4 pZOCHHN transfected

cell, 5 pCDNA3.1/Hyg(?) transfected cell, 6 non-transfected cell,

7 PCR negative control; M molecular weight marker. b Real-time

RT-PCR. Error bars represent standard deviation of a triplicate

determination. c Cell surface expression: 1 non-transfected cells,

2 pZCHN transfectants, 3 pZCHHN transfectants, 4 pZOCHN

transfectants, 5 pZOCHHN transfectants


123

transfected and non-transfected Jurkat cells were co-cul-

tured with T47D, MCF7, A431 and NIH3T3 cells. After

24 h, recombinant receptor grafted Jurkat cell proliferation

was substantially enhanced upon incubation with the T47D

and MCF7 tumour cells while the non-transfected Jurkat

cells and pCDNA3.1/Hygro(?) transfected Jurkat cells did

not significantly increase their proliferation rate in the

presence of MUC1? tumour cells. In the cell lines with the

low expression of MUC1, such as the A431, there was a

weak increase in cell number after co-culturing. No

increase in the proliferation of CAR grafted Jurkat cells

was seen upon co-culture with MUC1- cells (Kruskal–

Wallis one-way analysis of variance, p = 0.003) (Fig. 4).

To assess the effect of the co-stimulatory signaling of

OX40 to enhance CAR receptor mediated T cell activation,

cytokine production in response to antigen stimulation was

compared. Figure 4 shows the concentration of IL-2 mea-

sured in the cell culture supernatants of the transfectants

24 h after co-culturing. Inclusion of the OX40 co-stimu-

latory signaling region in series with the TCR led to

enhanced antigen-induced IL-2 production compared with

the chimeric receptors without OX40. As the results show,

T47D co-culturing has the highest induction effect on

cytokine production for CAR receptor transfectants and

inclusion of the OX40 in the chimeric receptor cassettes led

to a 1.7–2.2 times increase in the secretion of IL-2 after

challenge with the solid phase MUC1 antigen (Kruskal–

Wallis one-way analysis of variance, p = 0.001). A431

and NIH3T3 have no significant effect on the specific

activation of chimeric receptors.

The pZOCHHN transfectants had the highest cytokine

production in co-cultivation with the MUC1? cell lines

(nearly, 2.5 and 3 times more than the chimeric receptors

without OX40 in MCF7 and T47D, respectively) (Kruskal–

Wallis one-way analysis of variance, p = 0.003). The IL-2

production in the pZOCHHN transfectants is 20 and 31.7%

more than the pZOCHN transfected cells after induction by

the MCF7 and T47D cancerous cells, respectively (Krus-

kal–Wallis one-way analysis of variance, p = 0.002). The

cytokine production was antigen specific, demonstrated by

a low level of cytokine production in the absence of the

MUC1 antigen (antigen-negative target cells).

Apoptosis evaluation

One of the objectives of this study was to evaluate the

efficiency of caspase 8-derived constructs in being able to

induce apoptosis in CAR grafted Jurkat cells in a control-

lable manner. A dose–response curve was performed with

increasing amounts of the AP20187 dimerizer (data not

shown). Two concentrations of AP20187 from the dose–

response curve (10 and 20 nM) were tested on pZOCHHN/

pFKC8 co-transfected Jurkat cells. The cell cytotoxicity

effect of the apoptotic vector after 12, 24, 48 and 72 h was

evaluated by the MTT assay (Fig. 5).The reduction ratio of

cell viability in co-transfectants in comparison to the

control cells showed that cell death driven by the induced

dimerization of FKC8 by 10 nM AP20187 is highly

efficient.

To confirm that following the addition of AP20187, the

cell death observed in the FKC8 transfected cells is due to

apoptosis activity, we monitored the phosphatidylserine

(PS) externalization from the inner to the outer leaflet of

the plasma membrane 12, 24, 48 and 72 h after induction

with 10nM AP20187. Figure 6 shows that after 24 h in the

presence of dimerizer, apoptosis reached a plateau, with no

significant increase after 48 and 72 h.

Discussion

T lymphocytes provide an important opportunity for the

immunotherapy of cancer. [1, 20, 21]. T cells genetically

modified with TCRs recognize only a single, HLA-

restricted epitope, which limits patient eligibility based on

HLA haplotype and introduces a risk of tumour escape by

mutation or down regulation [2]. An approach to modifying

the specificity of T cells in a non-HLA-restricted manner

involves the use of genes that encode monoclonal antibody

chains specific for TAAs like chimeric antigen receptors

(CARs) [22, 23]. Preclinical studies have demonstrated that

T cells expressing CARs can eliminate tumours in murine

models [24, 25].

T bodies require signaling through both their stimulatory

and co-stimulatory molecules, primarily CD28 [4, 26, 27].

Domains from co-stimulatory molecules have also been

Fig. 4 Results of functional assays of CARs grafted Jurkat cells after

co-culturing with MUC1 high expressing cells (T47D and MCF7),

A431 (with dubious expression of MUC1) or NIH3T3 as a control cell

line (without expression of MUC1). The results are average of IL-2

production of each transfected cell. Error bars represent standard

deviation of a triplicate determination


123

shown to improve the induction of T cell effector functions

through CAR recognition [8]. OX40, a type I transmem-

brane glycoprotein of the TNFR family, was first identified

by Paterson et al., as a 50 kDa molecule, expressed on

CD4? T cells [5, 9, 11].

Due to their great homology to human VH (which

reduces the risk of immunoreactions by recipient immune

system) and their small size, camelid nanobodies can be

used as a viable alternative for use as single-chain fragment

variable (scFv) in chimeric receptors [28]. In this study we

used nanobodies as the antigen binding domain. The util-

isation of nanobodies has several advantages; their mono-

meric behaviour, in combination with other biochemical

properties such as high solubility and high specificity and

affinity for the cognate antigen, makes single domain

antibodies ideal as novel reagents. So they can be used as

antibodies for targeting to human tumour markers [29]. The

demonstration of the ability of chimeric receptors, includ-

ing TAA specific nanobody-spacer-CD28-CD3f to induce

antigen-specific proliferation and effector function in

human T cells [12], led us to investigate whether similar

effects could be demonstrated in fusion receptors with the

OX40 co-stimulatory gene fragment, in Jurkat T cells [6].

Thus in this report, a chimeric receptor including OX40 (a

camelid nanobody specific for the human MUC1-extra-

cellular spacers-CD28 gene fragment-OX40 domain-CD3fsignaling region) was generated. All sequences were

human derived to limit as much as possible the potential

risk of immunogenicity in a clinical setting.

We have demonstrated that the inclusion of both the B7

receptor and TNFR family member co-stimulatory signal-

ing regions in series with the CD3f-spacer-nanobody

enhanced the level of specific antigen-induced IL-2 cyto-

kine production compared with the CD3f-CD28-spacer-

nanobody alone and that these receptors can elicit

enhanced antigen-specific cytokine production and facili-

tates the antigen-specific expansion of Jurkat T cells.

Similar studies showed that the inclusion of CD28 elicited

much higher levels of IL-2 production than ICOS, OX40,

or 4-1BB [30], and led to higher levels of IFNc, TNFa, and

GM-CSF than the inclusion of either OX40 or 4-1BB,

which is consistent with the known importance of CD28

for optimal cytokine production [9, 27, 31].

In this report, enhanced mRNA expression of chimeric

receptors via the co-stimolatory gene fragment (OX40) was

confirmed by both semi-quantitative RT-PCR and quanti-

tative real-time PCR. The quantitative real-time PCR

technique was developed in preference to semi-quantitative

Fig. 5 Results of MTT assay a 12 h, b 24 h, c 48 h and d 72 h after

adding dimerizer. The results are average of cell death% of each

transfectant. Error bars represent standard deviation of a triplicate

determination

b


123

RT-PCR, which we used for similar studies in stable cell

lines. Real-time PCR has become the gold standard for the

accurate, sensitive and rapid measurement of gene

expression.

The Pfaffl model combines gene quantification and

normalization into a single calculation. This model incor-

porates the amplification efficiencies of the target and

reference (normalization) genes to correct for differences

between the two assays [19, 32].

Cell surface expression of functional chimeric receptors

was determined 24 h after gene transfection to the Jurkat

cells. Inclusion of the OX40 co-stimulatory signaling

regions in series with the CAR receptors led to enhanced

antigen-induced IL-2 production in comparison with the

chimeric receptors without the OX40. The quantitative

real-time PCR results did not show a significant difference

between the mRNA expression of the pZOCHN and

pZOCHHN transfectants. On the contrary, the pZOCHHN

transfected cells produced more IL-2 than the pZOCHN

transfected cells. A possible explanation for this could be

that the pZOCHHN is more stable and better expressed

than pZOCHN. The higher flexibility of pZOCHHN could

better promote folding of the nanobody, and consequently

improve antigen binding.

With the aim of maintaining a high efficiency while

concomitantly guaranteeing a way to control any possible

in vivo unwanted T cell proliferation, a suicide gene sys-

tem was adopted and different combinations were tested in

this work [33]. Co-expression of the CAR with a suitable

suicide gene was thus envisioned.

Thomis et al. reported a construct including two copies

of a FK506-binding protein (FKBP) and the Fas intracel-

lular domain. T cells transduced with this chimeric protein

undergo apoptosis when exposed to AP1903, a dimerizer

drug that binds FKBP and induces the Fas cross-linking

[34, 35]. Spencer et al. [36] reported that the expression of

Fas in transiently transfected cells induces apoptosis in the

absence of drug addition. Most likely this basal toxicity

(autotoxicity) is caused by the self-association of the death

domain. The drug used to trigger suicide in the Fas system

is AP1903, a small synthetic molecule that was specifically

designed to interact with the engineered F36V-FKBP but

not with endogenous FKBP12 [14, 17, 37]. The application

of this inducible system in human T lymphocytes has been

explored using Fas or the death effector domain (DED) of

the Fas-associated death domain-containing protein

(FADD) as pro-apoptotic molecules and caspase 1, 3, 7, 8,

9 [14, 17, 38].

Caspase 8 is an initiator caspase in the death receptor

pathway. Its position at the top of the caspase cascade

permits the triggering of both extrinsic and intrinsic

apoptosis pathways [39]. Following apoptotic stimulation,

inactive procaspase 8 is converted into active procaspase 8.

Fig. 6 Results of apoptosis assay (flow cytometry). a 12 h, b 24 h,

c 48 h and d 72 h after adding dimerizer. The results are average of

apoptosis% of each transfected cell. Error bars represent standard

deviation of a triplicate determination


123

It has been clearly shown that membrane oligomerization

is a crucial step for caspase 8 autoactivation [36] through

induced proximity. The homodimerization-regulated chi-

mera FKC8 acts as a conditional apoptotic factor and

controls the dimerization of a membrane-bound caspase 8

protein through the addition of a small synthetic ligand,

AP20187. Pognonec et al. used a membrane bound form

of caspase 8 that includes sequences required for mem-

brane anchoring such as the myristoylation signal. They

evaluated the efficiency of the inducible caspase 8 con-

struct that relies on the homodimerization system derived

from the human FKBP12 protein (FK506-binding protein)

for the induction of apoptosis. Their results showed the

lowest apoptotic activity under repressed conditions, while

maintaining a potent apoptotic activity in the presence of

the AP20187 inducer used at nanomolar concentrations.

The homodimerization-regulated caspase 8 is derived

from human proteins, and is thus less likely to trigger any

significant immune response [17]. FKC8 is also an

attractive alternative to the widely used HSV-tk/ganci-

clovir suicide system [34]. In addition, controlled suicide

of slow or non-dividing cells, which are refractory to

HSV-tk/ganciclovir treatment, would be possible with

FKC8, since caspase 8-induced apoptosis does not rely on

DNA replication [38].

One of the aims of this study was to evaluate a virus-free

system for inducing apoptosis in CAR grafted Jurkat cells

in a controllable manner. We evaluated the potential of

caspase 8 as a therapeutic gene to this end. In the study, the

pFKC8 and CAR constructs were co-transfected into Jurkat

T cells and the apoptosis was assessed by the level of

phosphatidylserine (PS) externalization by the Annexin-V

coupled to FITC, 12, 24, 48 and 72 h after the addition of

AP20187. 24 h after addition of the dimerizer, more than a

90% decrease in the number of Jurkat T cells was observed

by flow cytometry. The programmed cell death percentage

after 12 h was still modest, which we hypothesis could be

due to a low level of the expression of FKC8. At 48 and

72 h after drug addition, the percentage of apoptosis

remained similar to that seen after 24 h of treatment,

possibly because of dimerizer degradation.

Characteristics such as the ability of these engineered T

cells to traffic to tumour sites, expand, survive, and gen-

erate memory in vivo need now to be studied with the

chimeric receptors, which provide signaling and co-stim-

ulatory signals.

Acknowledgments We are grateful to Dr. Oliver Jey Broom

(KIPA—Krahbichler Intellectual Property Advisors AB, SE-251 10

Helsingborg, Sweden) for his critical language revision of the man-

uscript. This work was supported by Faculty of Medical Sciences and

the Biotechnology committee of Tarbiat Modares University (TMU-

88-8-67), Tehran, Iran.

References

1. June CH. Adoptive T cell therapy for cancer in the clinic. J Clin

Invest. 2007;117:1466–76.

2. Leen AM, Rooney CM, Foster AE. Improving T cell therapy for

cancer. Annu Rev Immunol. 2007;25:243–65.

3. Biagi E, Marin V, Giordano Attianese GMP, Dander E, D’Amico

G, Biondi A. Chimeric T-cell receptors: new challenges for tar-

geted immunotherapy in hematologic malignancies. Haemato-

logica. 2007;92:381–8.

4. Grossi JA, Raulet DH, Allison JP. CD28-mediated signalling co-

stimulates murine T cells and prevents induction of anergy in

T-cell clones. Nature. 1992;356:607–9.

5. Liebowitz DN, Lee KP, June CH. Costimulatory approaches to

adoptive immunotherapy. Curr Opin Oncol. 1998;10:533–41.

6. Finney HM, Akbar AN, Lawson ADG. Activation of resting

human primary T cells with chimeric receptors: costimulation

from CD28, inducible costimulator, CD134, and CD137 in series

with signals from the TCR chain. J Immunol. 2004;172:104–13.

7. Hombach A, Sent D, Schneider C, Heuser C, Koch D, Pohl C,

et al. T-cell activation by recombinant receptors: CD28 costi-

mulation is required for interleukin 2 secretion and receptor-

mediated T-cell proliferation but does not affect receptor-medi-

ated target cell lysis. Cancer Res. 2001;61:1976–82.

8. Watts TH, DeBenedettet MA. T cell co-stimulatory molecules

other than CD28. Curr Opin Immunol. 1999;11:286–93.

9. Hombach A, Abken H. Costimulation tunes tumor-specific acti-

vation of redirected T cells in adoptive immunotherapy. Cancer

Immunol Immunother. 2007;56:731–7.

10. Gramaglia I, Jember A, Pippig SD, Weinberg AD, Killeen N,

Croft M. The OX40 costimulatory receptor determines the

development of CD4 memory by regulating primary clonal

expansion. J Immunol. 2000;165:3043–50.

11. Pule MA, Straathof KC, Dotti G, Heslop HE, Rooney CM,

Brenner MK. A chimeric T cell antigen receptor that augments

cytokine release and supports clonal expansion of primary human

T cells. Mol Ther. 2005;12:933–41.

12. Iri-Sofla FJ, Rahbarizadeh F, Ahmadvand D, Rasaee MJ. Nano-

body-based chimeric receptor gene integration in Jurkat cells

mediated by PhiC31 integrase. Exp Cell Res. 2011;317:2630–41.

13. Casucci M, Bondanza A. Suicide gene therapy to increase the

safety of chimeric antigen receptor-redirected T lymphocytes.

J Cancer. 2011;2:378–82.

14. Straathof KC, Pule MA, Yotnda P, Dotti G, Vanin EF, Brenner

MK, et al. An inducible caspase 9 safety switch for T-cell ther-

apy. Blood. 2005;105:4247–54.

15. Cai X, Zhou J, Chang Y, Sun X, Li P, Lin J. Targeting gene

therapy for hepatocarcinoma cells with the E. coli purine nucle-

oside phosphorylase suicide gene system directed by a chimeric

[alpha]-fetoprotein promoter. Cancer Lett. 2008;264:71–82.

16. Bonini C, Ferrari G, Verzeletti S, Servida P, Zappone E, Ruggieri

L, et al. HSV-TK gene transfer into donor lymphocytes for

control of allogeneic graft-versus-leukemia. Science.

1997;276:1719–24.

17. Carlotti F, Zaldumbide A, Martin P, Boulukos KE, Hoeben RC,

Pognonec P. Development of an inducible suicide gene system

based on human caspase 8. Cancer Gene Ther. 2005;12:627–39.

18. Grutter MG. Caspases: key players in programmed cell death.

Curr Opin Struct Biol. 2000;10:649–55.

19. Wong ML, Medrano JF. Real-time PCR for mRNA quantitation.

Biotechniques. 2005;39:75–85.

20. Park JH, Brentjens RJ. Adoptive immunotherapy for B-cell

malignancies with autologous chimeric antigen receptor modified

tumor targeted T cells. Discov Med. 2010;9:277–88.


123

21. Tey SK, Bollard CM, Heslop HE. Adoptive T-cell transfer in

cancer immunotherapy. Immunol Cell Biol. 2006;84:281–9.

22. Lo ASY, Ma Q, Liu DL, Junghans RP. Anti-GD3 chimeric sFv-

CD28/T-cell receptor designer T cells for treatment of metastatic

melanoma and other neuroectodermal tumors. Clin Cancer Res.

2010;16:2769–80.

23. Maher J, Brentjens RJ, Gunset G, Riviere I, Sadelain M. Human

T-lymphocyte cytotoxicity and proliferation directed by a single

chimeric TCR/CD28 receptor. Nat Biotechnol. 2002;20:70–5.

24. Chmielewski M, Hombach AA, Abken H. CD28 cosignalling

does not affect the activation threshold in a chimeric antigen

receptor-redirected T-cell attack. Gene Ther. 2010;18:62–72.

25. Savoldo B, Ramos CA, Liu E, Mims MP, Keating MJ, Carrum G,

et al. CD28 costimulation improves expansion and persistence of

chimeric antigen receptor–modified T cells in lymphoma patients.

J Clin Invest. 2011;121:1822–6.

26. Rahbarizadeh F, Rasaee MJ, Forouzandeh M, Allameh A, Sar-

rami R, Nasiry H, et al. The production and characterization of

novel heavy-chain antibodies against the tandem repeat region of

MUC1 mucin. Immunol Invest. 2005;34:431–52.

27. Rahbarizadeh F, Rasaee MJ, Forouzandeh-Moghadam M, Al-

lameh AA. High expression and purification of the recombinant

camelid anti-MUC1 single domain antibodies in Escherichia coli.

Protein Expr Purif. 2005;44:32–8.

28. Song DG, Ye Q, Carpenito C, Poussin M, Wang LP, Ji C, et al.

In vivo persistence, tumor localization, and antitumor activity of

car-engineered T cells is enhanced by costimulatory signaling

through CD137 (4–1BB). Cancer Res. 2011;71:4617–27.

29. Ramos CA, Savoldo B, Liu E, Bollard CM, Carrum G, Kamble

RT, et al. Effect of a co-stimulatory endodomain on the perfor-

mance of T cells expressing a chimeric antigen receptor directed

at CD19 in patients with relapsed/refractory B-cell malignancies.

Biol Blood Marrow TR. 2011;17:213–4.

30. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the

comparative CT method. Nat Protoc. 2008;3:1101–8.

31. Buning H, Uckert W, Cichutek K, Hawkins RE, Abken H. Do

CARs need a driver license? Adoptive cell therapy with chimeric

antigen receptor-redirected T cells caused serious adverse events.

Hum Gene Ther. 2010;9:1039–42.

32. Thomis DC, Marktel S, Bonini C, Traversari C, Gilman M, Bordi-

gnon C, et al. A Fas-based suicide switch in human T cells for the

treatment of graft-versus-host disease. Blood. 2001;97:1249.

33. Spencer DM, Belshaw PJ, Chen L, Ho SN, Randazzo F, Crabtree

GR, et al. Functional analysis of Fas signaling in vivo using

synthetic inducers of dimerization. Curr Biol. 1996;6:839–47.

34. Clackson T, Yang W, Rozamus LW, Hatada M, Amara JF,

Rollins CT, et al. Redesigning an FKBP-ligand interface to

generate chemical dimerizers with novel specificity. Proc Natl

Acad Sci USA. 1998;95:10437.

35. MacCorkle RA, Freeman KW, Spencer DM. Synthetic activation

of caspases: artificial death switches. Proc Natl Acad Sci USA.

1998;95:3655.

36. Pajvani UB, Trujillo ME, Combs TP, Iyengar P, Jelicks L, Roth

KA, et al. Fat apoptosis through targeted activation of caspase 8:

a new mouse model of inducible and reversible lipoatrophy. Nat

Med. 2005;11:797–804.

37. Martin DA, Siegel RM, Zheng L, Lenardo MJ. Membrane olig-

omerization and cleavage activates the caspase-8 (FLICE/MACH

1) death signal. J Biol Chem. 1998;273:4345–9.

38. Traversari C, Marktel S, Magnani Z, Mangia P, Russo V, Ciceri

F, et al. The potential immunogenicity of the TK suicide gene

does not prevent full clinical benefit associated with the use of

TK-transduced donor lymphocytes in HSCT for hematologic

malignancies. Blood. 2007;109:4708–15.

39. Portsmouth D, Hlavaty J, Renner M. Suicide genes for cancer

therapy. Mol Aspects Med. 2007;28:4–41.


123

a caspase 8-based suicide switch induces apoptosis in nanobody-directed chimeric receptor expressing...

Documents