76.129-041211
DESCRIPTION
The official student newspaper of the University of HoustonTRANSCRIPT
Anna GallegosTHE DAILY COUGAR
UH launched the new myUH system with features made to streamline the process of enrollment for students.
“March 31-April 5, 2011, the University of Houston System upgrad(ed) the current
PeopleSoft Campus Solutions 8.9, Student Administration, Student and Faculty Self-Service, Human Resources, software to ver-sion 9.0,” wrote Chris Cheatham, UH direc-tor of communications and marketing, in an e-mail. “Thus, ‘The NEW myUH,’ while there are no dramatic changes for student self-service in the 9.0 version, there are a few new features and enhanced functionality that students will be able to utilize after the April
Ashley EvansTHE DAILY COUGAR
Renowned astrophysicist Neil deGrasse Tyson, the man who demoted Pluto from its prior posi-tion of planetary power, will be hosted Wednesday as part of the 2011 Elizabeth D. Rockwell Lecture on Ethics and Leadership series .
The lecture will be held at the Cullen Performance Hall on Wednes-day from 7 to 8:30 p.m.
UH alumna Elizabeth D. Rockwell created and funded the series as a way to bring distinguished speakers to the University to discuss issues regarding leadership and ethics.
This year’s speaker is the young-est director ever to head the Hayden Planetarium at the American Museum of National History and current host of the PBS series NOVA scienceNOW.
Tyson has a passion for sharing his knowledge of star formations, exploding stars, dwarf galaxies, and the structure of the Milky Way with inquiring minds. His contributions have earned him the honor of having an astroid named after him by the International Astronomical Union,
Lauren MathisTHE DAILY COUGAR
UH’s Internet radio station named COOG Radio will be up and running in May for the UH community.
Founder and political sci-ence junior, Conner Clifton, talks about what the station will consist of and how stu-dents and others at UH can get involved.
“We are mostly going to play music, but we are not opposed to other types of program-ming,” Clifton said. “If you think you have an interesting idea, and that radio is a good medium for it, then suggest it. We are open to anything and everything.”
All that matters to Clifton and the other founders is pro-moting music and art, he said.
“We just want to use col-lege radio as a way to promote art in Houston,” Clifton said. “We are going to be playing a lot of local fl avor, so if you’re a
Houstonian with a band, come talk to us. We’d love to give you exposure.”
COOG Radio will bring ben-efi ts to the school.
“For one, it’ll give students a chance to be heard,” Clifton said. “It’ll allow them to try something they’ve never done before. As for UH, we are hop-ing that this will improve the community of the student body and that is always good for the University.”
Students should eventually have access to the radio station through iPod and Droid.
“In addition to being a folder in the UH system, we’re working on developing an app for both iPhones and Droids that will allow you to access the station on the go,” Clifton said.
Enabling students to have iPhone and Droid access to the station is a must have for COOG Radio since it is on the Internet, Clifton said.
“Nowadays, people can access the internet wher-ever they are thanks to their
THE DAILY COUGARTHE DAILY COUGAR®®
t h e o f f i c i a l s t u d e n t n e w s p a p e r o f t h e u n i v e r s i t y o f h o u s t o n s i n c e 1 9 3 4t h e o f f i c i a l s t u d e n t n e w s p a p e r o f t h e u n i v e r s i t y o f h o u s t o n s i n c e 1 9 3 4Issue 129, Volume 76
TuesdayApril 12, 2011
newslineCAMPUSSymposium celebrates African American culture in the media
Sponsored by the UH African American Studies Program, this free
event invites the public to celebrate the culture and images that defi ne
African Americans in media.
The symposium will feature a number of America’s foremost schol-
ars as they discuss the issues and challenges that African Americans face
both in the past and present. Planned workshops include topics such as
“Independent Film Production 101,” and “How To Get a Record Deal.”
For a full schedule of activities and events, visit http://www.uh.edu/
class/aas/.
— Julian Jimenez/The Daily Cougar
PARKING AND TRANSPORTATIONInformation sessions prepare students for upcomming issues
In order to prepare for the upcoming construction of new stadium
parking, Parking and Transportation Services will host an information
session to help students plan their parking plans for next year. The
meeting will be held on parking lot 15D on Wednesday and Thursday
from 9 a.m. – 11 a.m.
Construction is scheduled to begin on August 1, with an anticipated
completion date of May 1, 2012. The new parking garage will hold
2,300 cars, making it the largest on campus. The university will take
1,100 parking spaces out of lot 1D starting this summer in order to
facilitate the construction process.
PTS encourages all students and staff who use the parking lot to
attend the meeting to learn what options are available so they can de-
velop a plan prior to purchasing a parking permit for the upcoming year.
For more information, call PTS customer service at (713) 743-1097.
— Louis Casiano/The Daily Cougar
CORRECTIONSReport errors to [email protected]. Corrections will appear in
this space as needed.
thedailycougar.com @thedailycougar facebook.com/thedailycougar Sign up for daily e-mail alerts Read. Recycle. Repeat daily.
Cougars to battle it out against Bearkats
life+arts sports
Got news? E-mail [email protected] or call 713-743-5314
What's indie experimental?
RADIO continues on page 2
MYEDU continues on page 8PHYSICIST continues on page 8
EVENTSClaiming Victory Over Violence Members of the UH
Soka Peace Group and the UH-Clear Lake Soka Peace Group
are hosting the Victory Over Violence from 10 a.m. to 8 p.m.
in the University Center Arbor.
Instructor Led Training Class A class introducting web
design will be off ered to facutly, staff , students and alumni
in Room 110L of the Social Work Building from 2 p.m. to 4
p.m. Register online at http://www.uh.edu/ittraining.
HIHI 8833LO 59today
WED
82/69
WEWED
82////669
THU
85/59
THTHUU
855/////5599
FRI
83/62/
SAT
82/61
SASASAATTTT
8282///////6661611
Clear skies with a slight breeze....
FOR MORE EVENTS, CHECK OUTthedailycougar.com/calendar
Future accessibility on iPhone and Droid
Youngest director of Hayden Planetarium to headline event
Changes enhance website, students respond postively
LECTURE
PBS host,physicist to star at UH lecture
COMMUNITY
CAMPUS
Online portal upgrade open
COOG Radio makes debut
Treats for clarifi cations
The Muslim Students Association provided cotton candy, popcorn and snowcones to passersby to encourage them
to come by the information table Monday in the breezeway of Phillip Guthrie Hall. Ruben Ramirez, member of MSA and math sophomore, said they come out three days a week to clear up misconceptions and answer questions about Mus-lims and Islam among students. | Cristi Guerra/The Daily Cougar
the VAGINA
MONOLOGUESstudent feminist organization
presents
Friday, April 15 – 7pmSaturday, April 16 – 7pmSunday, April 17 – 5pm
Pacific Room – University Center
All proceeds benefit Houston Rescue & Restore. www.houstonrr.org
For more information: email: [email protected]
visit: www.vday.org
mm
m
enter
Tickets: $7.00 at door
$5.00 in advance Advance purchase in
Women’s Resource Center, 1-4pm279A University Center
EDITOR IN CHIEFof The Daily Cougar for Summer/Fall 2011
— AND —
EDITOR IN CHIEFof the 2011-12 Houstonian yearbook
APPLICATION DEADLINE:
5 P.M. APRIL 21
ELECTION:
4 P.M. THURSDAY, APRIL 28
TO REQUEST AN APPLICATION, VISIT ROOM 12,
UC SATELLITE OR CALL 713-743-5335.
The SPC meets monthly during the school year to hear updates from the department’s units, to give a forum for public comment and to elect the editors in chief of The Daily Cougar and Houstonian yearbook. For more
information, visit www.uh.edu/sp/committee
THE STUDENT PUBLICATIONS
COMMITTEE IS CURRENTLY ACCEPTING
APPLICATIONS FOR THE POSITION OF
2 ■ Tuesday, April 12, 2011 CRIME The Daily Cougar
ISSUE STAFF
ABOUT THE COUGAR The Daily Cougar is published Monday through Friday during the fall and spring semesters,
and Tuesday and Thursday during the summer, at the University of Houston Printing Plant and online at http://www.
thedailycougar.com. The University seeks to provide equal educational opportunities without regard to race, color,
religion, national origin, sex, age, disability or veteran status, or sexual orientation. The Daily Cougar is supported in part
by Student Service Fees. The fi rst copy of the Cougar is free; each additional copy is 25 cents.
SUBSCRIPTIONS Rates are $70 per year or $40 per semester. Mail subscription requests to: Mail Subscriptions, The
Daily Cougar, University of Houston, Houston, TX, 77204-4015.
NEWS TIPS Direct news tips and story ideas to the News Desk. Call (713) 743-5314, e-mail news@thedailycougar.
com or fax (713) 743-5384. A “Submit news item” form is also available online at thedailycougar.com.
COPYRIGHT No part of the newspaper in print or online may be reproduced without the written consent of the
director of the Student Publications Department.
Newsroom(713) 743-5360■ Editor in ChiefJack Wehman(713) [email protected]
■ Layout EditorChristopher [email protected]
■ Multimedia EditorNewton Liu(713) [email protected]
■ News EditorsJose AguilarCristi Guerra(713) [email protected]
■ Sports EditorsJohn BrannenJoshua Siegel(713) [email protected]
■ Life & Arts EditorMary Baak(713) [email protected]
■ Opinion EditorAndrew [email protected]
■ Web EditorMatthew [email protected]
Advertising(713) [email protected]
■ Classifi eds(713) 743-5356classifi [email protected]
Business Office■ Phone (713) 743-5350■ Fax (713) 743-5384■ Mailing addressRoom 7, UC SatelliteStudent PublicationsUniversity of HoustonHouston, TX 77204-4015
contact us:
crime log
Traffic Offense: 7:14 p.m. April 6, Lot 4A — A student reported that someone struck and damaged his unattended vehicle while it was legally parked in lot 4 A. The strik-ing driver failed to leave the infor-mation as required by Texas law.
Theft: 8:37 a.m. April 6, M.D. Anderson Librar y — A visitor reported that someone stole his backpack, containing his laptop computer and two prescriptions, from the library while he was in the restroom. There are no suspects.
Consumption of Alcohol by a Minor: 2:27 a.m. April 6, Entrance 5 — A UH DPS security officer observed a student under the influ-ence of alcohol outside Cougar Village. A UH DPS police officer issued the student a Harris County citation for Consumption of alcohol by a Minor and a Student Life Refer-rals for the incident. The incident occurred at 02:27 hrs 4/6/11. The case was Cleared by Citation.
Traffic Offense: 5:16 p.m. April 5, Lot 15D — A student reported that someone struck and damaged her vehicle in lot 15 D. The striking driver failed to leave the informa-tion required by Texas law.
Theft: 4:33 p.m. April 5, Philip G. Hoffman Hall — A visitor reported that someone stole her unattended and unsecured cell phone from a women’s restroom in PGH. There are no suspects.
Traffic Offense: 3:37 p.m. April 5, East Parking Garage — A student reported that someone struck and damaged her unattended and secured vehicle while it was parked in the East Parking Garage. The striking driver failed to leave the information required by Texas law.
Theft: 4:05 p.m. April 5, M.D. Anderson Library — A student reported that someone stole his unattended and unsecured cellular phone when he left the table to get some books.
Credit or Debit Card Abuse: 12:46 p.m. April 5, Armisterad Optometry Bldg. — An Optometry student reported that someone stole her unattended purse and its contents from an Optometry examination room. She reported the incident to her credit card companies and was advised the cards had been used.
Theft of Service: 10:45 a.m. April 5, University Hilton Hotel — A Hil-ton Hotel staff member reported that three vehicles drove out of the hotel parking garage without pay-ing the parking fee.
Criminal Mischief: 9:05 a.m. April 5, Lot 16F — A faculty member reported seeing a man drive a vehi-cle through and break the entrance access gate arm of lot 16 F.
Theft: 3:49 p.m. April 4, Science and Research 1 — A faculty member reported that someone stole a UH owned laptop computer from his Science and Research 1 office.
Harassment: 12:14 p.m. April 4, Lot 1A — A student reported that her ex-boyfriend has been sending her harassing texts.
Burglary of a Building or Habita-tion: 6:51 a.m. April 4, Lot 2B Optom-etry Construction Site — An outside contractor reported that someone broke into his secured tool storage container and stole owned and leased equipment.
For the complete report and to view past reports, go to www.uh.edu/police/home.html
Have information on these or other incidents of crime on campus? Call 713-743-0600
The following is a partial report of campus crime between April 4-6. All information is selected from the fi les of the UH Police Department. The informa-tion in bold indicates when the event was reported to UHPD and the event’s location. Information or questions regarding the cases below should be directed to UHPD at (713) 743-0600.
■ Copy editing Reesha Brown
■ Production Nine Nguyen
■ Closing editor Newton Liu
Rice University School of Architectureis pleased to announce a new summerprogram: LAUNCH
LAUNCH invites applications from undergraduate studentsin any institution and discipline who are curious aboutarchitectural design, building a portfolio for futureprofessional or academic work, or who simply want toengage the city around them.
APPLICATION DEADLINE:Friday, May 6, 2011 at 5:00 p.m.
APPLICATION INSTRUCTIONS:Go to arch.rice.edu.Navigate to AcademicPrograms and clickon the LAUNCH tab.
June 6 - July 1, 2011 | arch.rice.edu
Recycle this paper
The Daily Cougar NEWS Tuesday, April 12, 2011 ■ 3
phones,” Clifton said. “More and more people are plugging their iPods into their car and they just open the Pandora app. I believe that one day things will reach a point where that will be the way most people access music outside of their own library. We are not forerunners, but we are defi nitely jumping on this very early in the game.”
In the meantime, listeners can access the station through their website.
“We also own the domain http://coogradio.com. There is nothing there yet, but there will be soon, as in the end of spring semester,” Clif-ton said. “We’ll defi nitely be up in May, but it may be after classes are over. We are hoping to have a small launch party the week after fi nals, but that’s pretty ambitious.”
To improve the community and
give students the chance to be heard through this radio station, KUHF lent a hand to COOG for technical and moral support, according to Clifton.
Though COOG Radio is not affi li-ated with KUHF, Clifton said, they are still lending a hand to the new Internet radio station.
“KUHF has been more than help-ful in providing technical advice, equipment and training,” Clifton said. “They’ve already offered to train members of our radio station on all of the equipment we will be using.”
To gain a better understanding about COOG Radio, Clifton explains how the Internet radio station was created.
The idea for a radio station like this started on a parking garage roof-top on campus, Clifton said.
“In April of 2010, Markley Rogers, Matt Womack (other founders of COOG Radio), we decided we wanted to start a radio station,” Clifton said.
“The day before we had just watched Pirate Radio (A movie about a radio station), so we were enthusiastic about being DJs. The next thing you know, I was standing outside of Renu Khator’s (Chancellor and presi-dent of UH) offi ce waiting for her to come outside so I could ask her who I needed to talk to about starting a radio station.”
Though Clifton and the other founders Matt and Markley came up with COOG Radio, they still feel this wouldn’t have happened without the help from KUHF and UH.
“John Profi tt, Dayton Smith and John Steele (all from KUHF) have been incredibly helpful,” Clifton said. “From UH, I have to give a shout out to Prince Wilson, Daniel Gray, Carrie Miller, Keith Kowalka, Ed Hugetz and Ellwyn Lee. Without their efforts and enthusiasm for what we are doing, COOG Radio would never have made it past the paperwork station.”
RADIOcontinued from page 1
STUDENTS
Help choosing majors availableElize NajmTHE DAILY COUGAR
Historically, choosing a major was choosing your future. You were committing to studying an area with the intent of entering that fi eld and working in it for the remainder of your life. In today’s society and the ever-changing economy, that is not always the case.
Students struggle with the deci-sion on what to study depending on the current state of the economy, which fi eld they might want to work in, or those unsure whether to study something broad and fl exible.
Thirty-five percent of students enter college at UH “Undecided” about what major they want to focus on. Students must declare a major by 30 credit hours. Even when students enter UH with a declared major, about 25 percent change it at least once before graduation, as of May 2010.
The most popular majors at UH include: Psychology, Biology and Business. The College of Liberal Arts and Social Sciences is the largest department on campus, followed by University Scholars and the Business School.
The attractions to these schools vary from student to student. Some wish to enter that fi eld while others see a degree in business as a gateway to a related, but different career.
“I am studying Electrical Engi-neering with the hope of one day incorporating that knowledge and education into a career in the music field,” said electrical engineering sophomore Pedro Berrizbeitia.
Adding a minor is a tool some-times used by students to supple-ment a major. Minors can specialize a chosen major, for example choos-ing a major in business with a minor in accounting.
In other instances, adding a minor could serve to diversify a stu-dent’s knowledge base. For example, if a student hopes to one day own an art gallery and decides to major in art but also wants to know how to
manage the business side of owning and operating the gallery, he or she might want to add a minor in busi-ness administration.
Some students wishing to enter law school upon graduation, major in political science and choose a writing or research intensive minor.
When deciding upon a minor, many students do not begin to con-sider until their senior year whether they wish to continue their education with an advanced d e g re e. Ma n y degrees, such as biology or psy-chology, are cho-sen as stepping-stones to careers requiring further education, while other majors such as architecture or media stud-ies tend to fulfill the educational necessities of their given fi elds.
The majors leading students to graduate school are typically science related, education, and business. Within the College of Liberal Arts and Social Sciences, for example, “the department with the highest percentage of students continuing on to graduate school would be Com-munication Science and Disorders, where 54 percent of those getting a bachelor’s had been accepted and were planning to attend graduate school in the Fall,” said Amy O’Neal, director of assessment and accredita-tion services.
The University offers free coun-seling for students who are unsure of what they want to major in or have doubts about the major they have already declared.
“The UH University Career Ser-vices office has career-matching exercises that can assist a student in choosing a major. I do suggest connecting with their office,” said Jeffrey Fuller, director of student recruitment.
The economy has been one of the most prominent focal points in today’s society and students are
beginning to wonder if they should chose a major or career path based upon the current job market.
According to the Chicago Tribune, career experts say students should major in whatever area most inter-ests them, even if it’s a less special-ized liberal arts fi eld, such as English or sociology. In a national survey, communication, followed closely by a strong work ethic and team-work skills, were rated as the most
important attri-butes sought by employers.
“The College of Technology and Bauer Col-lege of Business have some of the highest employ-ment after grad-uation, but all majors continue to show high rates of employ-
ment after graduation,” Fuller said. According to a study done by
‘Ebay Classifieds” in March 2011, the career fi eld with the highest pro-jected rate of growth is Biomedical Engineering, followed by careers in the health care fi eld.
A similar study done by the US Bureau of Labor Statistics reported that the fi eld of Computer Network Systems and Data Communication Analysis has the largest projected area of growth by 2016. Computer Software Engineering and Account-ing also appeared at the top of that list.
CNN reported that the job in the highest demand with the highest pay is that of the Medical Science Liai-son. The position requires knowledge in both the medical field and the legal fi eld, as it consists of relaying information to providers, potential clients, insurance companies, and doctors.
“Choose a major that is most aligned with your passion and desire to make a difference in your pursued major,” Fuller said.
Choose a major
that is most
aligned with your
passion and desire to make
a diff erence in your pursued
major.”
Jeff FullerDirector of Student Recruitment
Click on it: www.thedailycougar.com
4 ■ Tuesday, April 12, 2011 The Daily Cougar
STAFF EDITORIAL
Nine-time Olympic gold medal-ist and former UH athlete Carl Lewis announced his bid to run
for the Legislature in his home state of New Jersey yesterday.
Lewis will run as a Democrat, but regardless of what his campaign points will be, The Daily Cougar staff would like to applaud Lewis for making an effort to branch outside of his comfort zone. For Lewis, he is entering a new kind of competition that he is not accustomed to and attempting to make a difference.
Venturing into the world of politics after a career in sports is not an easy transition, and in some cases, can become more of a media circus instead of a legitimate campaign or term.
“I’ll be an independent thinker all the way through,” Lewis said after his announcement. “I will do what I think is right; I’m going to always look at the issues and vote that way.”
Before announcing his run, Lewis was involved with a variety of causes and responsi-bilities. He established a website, fitforever.com, that encourages people to engage in physical activities and live healthier. He is a volunteer assistant track coach at both of his alma maters, UH and Willingboro High School. He has even appeared in a number of Hollywood films and television shows.
One of the many mottos of the UH athletics department is “building champions for life.” Lewis has embodied that phrase long before it was used as a catchy mission statement. Current students should follow in the path of Lewis, and let their own voices be heard. If you feel as if you could bring about positive change to a particular institution, you should follow through with it.
Lewis has demonstrated a spirit that the right attitude can allow you to take on a multitude of different obstacles in your career. He is not cocky, but sure of himself. Receiving an educa-tion at UH should give all current and former students the confidence that they are capable of living out bold career goals. So go out there and make whatever you aspire to achieve happen.
Learn a thing or two from this former UH star
STAFF EDITORIAL The Staff Editorial refl ects the opinions of The Daily Cougar Editorial Board (the members of which are listed above the editorial). All other opinions, commentaries and cartoons refl ect only the opinion of the author. Opinions expressed in The Daily Cougar do not necessarily refl ect those of the University of Houston or the students as a whole.
LETTERS TO THE EDITOR The Daily Cougar welcomes letters to the editor from any member of the UH community. Letters should be no more than 250 words and signed, including the author’s full name, phone number or e-mail address and affi liation with the University, including classifi cation and major. Anonymous letters will not be published. Deliver letters to Room 7, University Center Satellite; e-mail them to [email protected]; send them via campus mail to STP 4015; or fax them to (713) 743-5384. Letters are subject to editing.
ADVERTISEMENTS Advertisements published in The Daily Cougar do not necessarily refl ect the views and opinions of the University or the students as a whole.
GUEST COMMENTARY Submissions are accepted from any member of the UH community and must be signed with the author’s name, phone number or e-mail address and affi liation with the University, including classifi cation and major. Commentary should be kept to less than 500 words. Guest commentaries should not be written as replies to material already printed in the Cougar, but rather should present independent points of view. Rebuttals should be sent as letters. Deliver submissions to Room 7, University Center Satellite; e-mail them to [email protected]; or fax them to (713) 743-5384. All submissions are subject to editing.
THE DAILY COUGARE D I T O R I A L B O A R D
EDITOR IN CHIEF Jack WehmanMANAGING EDITORS Newton Liu, Christopher LoseeNEWS EDITORS Jose Aguilar, Cristi GuerraSPORTS EDITORS John Brannen, Joshua SiegelLIFE & ARTS EDITOR Mary BaakOPINION EDITOR Andrew Taylor
E D I TO R I A L P O L I C I E S
opinion EDITOR Andrew TaylorE-MAIL [email protected] www.thedailycougar.com/opinion
Protests have erupted in Syria calling for democracy and an end to exploitation, largely infl uenced
by revolutions taking place in other Arab countries. Although the fi rst protests saw few participants, eventually Syrians
stepped forward in large numbers, courageously demanding their rights and putting their lives at risk. Protests have taken over all major cities including Damascus, Aleppo and Daraa.
Security forces have fi red on peaceful protestors, already killing dozens including children as young as 11 years old.
Protests such as these are truly unprec-edented for Syria under Bashar al-Assad’s regime, the current president. Both Bashar and his father, Hafez al-Assad, have a his-tory of crack downs on all types of peaceful protestors. In fact, the Assad dynasty was responsible for the single deadliest act an Arab government has committed against its own people: the 1982 massacre in Hama.
The government attacked all opposition parties, both on the left and the right. Between 20,000 and 30,000 innocent civil-ians were killed by the regime’s forces on that day.
So when these protests continued despite the regime’s initial attacks, Assad faced a diffi cult decision. Either he could use disproportionate force to destroy the democracy movement once and for all (as his father did before him), or he could try to appease at least some of their demands in hopes of dampening their enthusiasm.
Assad has opted for the second option, at least up to this point in time. He has fi red government offi cials known for rampant corruption, granted long overdue citizenship to the Kurdish minority in the East, and released some political prisoners.
The Syrian president has also invoked nationalistic arguments, proclaiming his regime the only resistance to Israel and the West.
Of course, this ignores that Assad’s regime has targeted Palestinians involved in political action and has recently detained many activists involved in the
Egyptian revolution. The argument that Assad should maintain control for the sake of all Arabs only serves to highlight the man’s delusion or his unabashed deception.
Syrians of all ethnic and religious backgrounds have united in opposition to Assad, and are fi rm in their refusal of his paltry appeasement. Habib Ibrahim, head of the Democratic Unity Kurdish Party, summed up this sentiment: “Our cause is democracy for the whole of Syria. It is not a favor. It is not the right of anyone to grant.”
Assad, and every corrupt head of state in the region, has to understand that no matter what rights they fi nally decide to give to the people, their authority still has no legitimacy. The Syrian president was not democratically elected; he only succeeded his father who himself gained control through a military coup.
Nothing short of regime change and democratization will appease the Syrian and Arab masses.
Dana El Kurd is a political science junior and may be reached at [email protected].
R emember the days of school lunches that treated many of us so well during grade school? The
school district which served up countless Sysco based lunches to my childhood peers had one particularly popular lunch item, the chicken fried steak. Chicken fried steak day,
or Wednesday to everyone who wasn’t salivating over that extremely sad meal, was the most popular meal among my childhood peers. To those who didn’t like it, they could freely bring their lunch from home. This freedom however, is non-existent for some children who attend a certain public school in Chicago.
Little Village Academy, a school located
on the west side of Chicago, has a policy that prohibits children from bringing a lunch from home. The policy is apparently designed to increase the nutrition of what school children are eating for lunch.
Principal Elsa Carmona said “her inten-tion is to protect students from their own unhealthful food choices,” according to an article published in The Chicago Tribune written by Monica Eng and Joel Hood.
“Nutrition wise, it is better for the children to eat at the school,” Carmona said. “It’s about the nutrition and the excellent quality food that they are able to serve (in the lunchroom). It’s milk versus a Coke. But with allergies and any medical issue, of course, we would make an exception.”
According to the article, this policy isn’t all too unheard of. No other schools were mentioned in the article, but according to
the principal of Little Village Academy, the practice was pretty common.
There are so many things wrong with this policy that it’s hard to fi gure out where to begin. No parent should have to follow a school policy that forces them to buy a lunch from the school cafeteria. The deci-sion of what to feed a child is not the job of the state unless the parents are in some way incapable.
The nutrition of a child is something that should be left up to the parent, not the school or state. Polices like the one being used at Little Village Academy are nothing more than an overstretched use of state power disguised as a well-intentioned attempt to make kids healthier.
Andrew Taylor is an economics senior and may be reached at [email protected].
Syrian people protest for democracy
Get your hands off my packed lunch!
DanaEl Kurd
AndrewTaylor
YES WE CAN! by Felipe Campos
The Daily Cougar Tuesday, April 12, 2011 ■ 5
sports EDITORS John Brannen, Joshua SiegelE-MAIL [email protected] www.thedailycougar.com/sports
overtimeTRACK AND FIELDCougars get a break after Texas Relays; Lewis to run for offi ce
In most events, UH was in the middle of the pack, but had
a few standout performances sprinkled in at the 84th annual
Clyde Littlefield Texas Relays.
Wesley Ruttoh won the 3,000-meter steeplechase clock-
ing in at 9 minutes, 3 seconds. Chris Carter notched fifth
place in the long jump with a leap of more than 52 feet, his
best mark of the season.
In two special relay events, the Cougars had a pair of
fourth-place finishes. In the 4x200-meter relay the lineup
of Kalyn Floyd, Whitney Harris, Tai’Shea Reese and Grecia
Bolton finished in 1:33. The distance medley relay finished
in 12:06 with Erica Hannemann, Ciera Johnson, Eryn Barroso,
and Kathryn Ducommun as the participants.
The Cougars will get more than a week of rest as they
prepare for the LSU Alumni Gold Invitational on April 23 in
Baton Rouge, La.
Former UH track and field legend Carl Lewis announced
his bid to run for the New Jersey legislature. He will run as a
Democrat and seek to represent his home town of Willing-
boro.
“When I run — as you see from my record — I run to
win,” Lewis said during his announcement.
— Cougar Sports Services
GOLFFreshmen spark improvement in second day of tournament
After sitting in 15th place out of 16 teams after the fi rst day,
the Cougars jumped up four spots at day two of the Jim West
Intercollegiate in Victoria. As a team, UH hit a 314 Sunday. They
boosted their performance Monday by shooting a 297.
Through two rounds, freshman Jesse Droemer has been the
Cougars’ top performer, and is in a tie for 19th place. After shoot-
ing a 79 Sunday, his score of 70 yesterday has him at a total of
149. Curtis Reed is tied for 34th with an overall score of 151.
Bryn Flanagan and Eric Adler are tied in 57th place with an
overall score of 156.
Louisiana Tech is the top team with a score of 576, but South-
eastern Louisiana is in close pursuit with 578.The tournament
will end today.
— Cougar Sports Services
SOFTBALLUH claims weekly awards
Amanda Crabtree is making a habit of earning Conference
USA honors. Crabtree and shortstop Brooke Lathan were named
C-USA Pitcher and Hitter of the Week on Monday.
It is Crabtree’s fourth selection of the season, and Lathan’s
fi rst. It is the second instance this season that the Cougars have
swept both awards.
Crabtree improved to 15-6 last week, pitching 12 scoreless
innings and striking out 24 batters. Crabtree leads C-USA in
punchouts with 254 strikeouts in 145 2/3 innings and also in
batting average against with a .109 mark.
Lathan mashed at the plate, going 7-for10 for the week
with three home runs and 10 RBI and an OPS of 2.650. Lathan
is in the top fi ve in C-USA in home runs (10) and RBI (29) and is
second in the conference in total bases (79).
The Cougars (28-12, 11-4) will put their winning streak to
the test when they host No. 17 Baylor (30-7, 4-3 Big 12) for a
double-header at 3 p.m. today at Cougar Softball Stadium.
The conference schedule will resume on Saturday when Tulsa
comes to town for a three-game series.
— Cougar Sports Services
BASEBALL
PLAYER PROFILE
UH gears for brief trip up I-45
Mannisto balances kicking, throwing
Gilbert RequenaTHE DAILY COUGAR
The Cougars will take a break from conference play as they hit the road to take on Sam Houston State in Huntsville.
Head coach Todd Whitting will stick with a new lineup that produced runs and propelled the Cougars to a come-from-behind win Sunday.
“Sometimes you have to mix things up a little bit to get the results you want,” Whitting said. “I was really proud of the guys that we put in the lineup. I thought that we got after it really well. They came out swinging the bats, put up a few runs and helped us win the game.
“I’ll stay with this lineup against Sam Houston for sure.”
The Cougars have had a problem with playing up or down to the level of competition this season. They hope not to see a repeat performance of last week’s game against Lamar where they admittedly did not bring its best effort.
“I don’t think that looking past Sam Houston will be an issue,” Whitting said. “We can’t look past them. They are as good as or better than we are.”
Whitting said that he likes the Cou-gars’ chances of being successful this week, but he knows that the Bearkats will prove to be a worthy adversary.
“We have to show up with our A game,” Whitting said. “That program up in Huntsville is really good.”
The Cougars (17-17, 4-2 Conference USA) have struggled recently, but they are still among the four teams tied for first place in C-USA.
“We’re where we want to be,” Whit-ting said. “It’s a long road, but I’m happy with where we are at right now.”
Sam Houston (22-12, 8-7 Southland Conference) has won five of its last seven games and is tied for fifth place in its conference.
The Bearkats are led offensively by designated hitter Chris Andreas who
leads the team with six home runs, 13 doubles, 36 RBI and a .637 slugging percentage.
Codey Morehouse will take the mound as the Cougars’ starter. In his last appearance, Morehouse lasted 7 2/3 innings, and assisted in the defeat then No. 5-ranked Texas A&M.
The Cougars took the all-time series
lead, 75-74, with their 9-3 victory over Sam Houston earlier this season.
The game begins at 6:30 p.m. at Don Sanders Stadium. UH will resume conference play when it travels to Huntington, W. Va. on Friday to face Marshall in a three-game series.
Joachim ClarkeTHE DAILY COUGAR
UH football fans might remember Jordan Mannisto for the 50-yard fi eld goal he made that gave the Cougars pre-cious points in their one-point victory over Texas Tech on September 26, 2009.
It turns out the kicker has a strong arm as well as a leg.
Mannisto is now a part of the pitching staff for the baseball team. In his fi rst season with the team, the right hander sports a 3.33 ERA and a 2-1 record including a win against Texas A&M on April 5.
Mannisto said that playing baseball in the spring is benefi cial since he gets the opportunity to keep in shape before football season begins.
“The football coaches have been really cool about it since the workouts fi t
a kicker’s schedule,” Mannisto said. “We really don’t need heavy lifting, and in
baseball we run a lot so it actually benefi ts you in the weight room.”
Mannisto was recruited out of Westlake, Calif. by UH to play football exclusively. In high school he played football, baseball and soccer but ultimately decided to focus on
football for college. It was through recognition of his
abilities on the baseball fi eld in high school that he was approached by assis-tant coach Trip Couch and asked to try out for the team.
“I didn’t know all the coaches, but
coach Couch found me during football season since he had recruited people from my high school team,” Mannisto said.
Mannisto has one season remaining for football, but will have three more years of eligibility for baseball. In 2010, Mannisto’s football duties consisted of kickoffs and some punting.
Although he insists that he does not prefer one sport over another, Mannisto said that the highlight of his athletic career was the UH victory over Texas Tech in 2009.
“For the school, that was one of the biggest games we’ve had on campus,” he said.
“I had never seen our school like that. Walking in Monday morning and seeing people lined up for tickets was crazy.”
Cougars try to sweep season series from Sam Houston after March 15 win
Today’s matchup against Sam Houston State marks the fi rst contest of a four-game road trip for the Cougars. Away games have been unkind to the Cougars so far this season, as they have mustered up just six wins out of 14 tries. | Aaron Cisneros/The Daily Cougar
Junior Jordan Mannisto has more
on his plate than
most UH athletes.
classifieds jobs, housing, services & more 713-743-5356 [email protected] thedailycougar.com/classifieds
BLOG DEVELOPER NEEDED Experienced blogger needed for
technical set up and administration of an exciting new blog using Wordpress called “Why do I Have Problems using Fish Oil?” Must know how to generate
traffic in all phases of operation. All content/articles are written.
A great ongoing job.
Prof Brian Peskin, 713-298-8783
òô
òô
RIVER OAKS COUNTRY CLUB is accepting applications
for the following job openings: Certified
Lifeguards, Experienced Dining Room Servers,
Experienced Baker, Accounts Payable and Accounts Receivables.
To apply email [email protected]
fax 713-529-2579
Egg Donors Needed. Ages 21-32. Earn $5,000+, High demand for Asians.
Surrogate Mothers Needed. Earn $25,000+, Ages 21-39.
(713) 771-9771 www.cooperinstitutearm.com
email : [email protected]
LOW COST INSURANCE
Liability from 38, auto*, home, business. Buy and Pay by phone
Call today for Great student discount: 281-498-3133,
713-484-7707
PART TIME HELPWANTED
10$/hr, 30 hrs/week, [email protected]
or fax 713-862-2218
PART TIME CAREGIVER NEEDEDFemale needed to assist partially disabled wife during the mornings
and some weekends. Days off to be arranged. Must be able to assist with showering, dressing, driving to store, moving from
wheelchair to seat etc.Galleria area apartment.
Call Brian 713 298 8783
HELP WANTEDHELP WANTED HELP WANTED HELP WANTED HELP WANTEDBULLETIN BOARD
THE DAILY COUGAR®
classifieds
You saw it in the Cougar. Remember that. MONTESSORI SCHOOL in Museum dis-
trict. Looking for Subs/Assts. Flex hrs. Excellent for child dev, Education or Psy majors! Call 713-520-0738
*STUDENTPAYOUTS.COM* PAID survey takers needed in Houston. 100 percent FREE to join! Click on Surveys.
FOR SALE
EYE CARE PRIVATE PRACTICE FOR SALE 25K. 713-816-1443
CHECK OUT PHOTOS AND DOWNLOAD AN ORDER FORM AT HOUSTONIANYEARBOOK.COM
6 ■ Tuesday, April 12, 2011 LIFE&ARTS The Daily Cougar
MOORES
Opera has something for everyoneDaniel RenfrowTHE DAILY COUGAR
Moores School of Music hosted Daniel Catan’s “Il Postino” this past weekend, much to the plea-sure of opera goers in Houston.
Performed in Spanish with English subtitles, the opera focuses on the friendship of the poet Pablo Neruda and the love-struck postman, Mario Ruoppola. The opera takes place in the 1950s and is set primarily on Cala di Sotto, a small Italian island.
According to the program notes, “Il Postino” had its premier with the Los Angeles Opera in September of 2010. This means that UH’s production of the opera will be completed before the initial round of professional productions of the opera is completed.
The composer of the opera, Daniel Catan, even traveled to UH for several rehearsals with students and was at the Saturday and Sunday performances of the opera.
After being fortunate enough to watch the Friday night perfor-mance, it is not surprising that Catan took the time to do this.
The cast and crew of this pro-duction are excellent at what they
do. Galeano Salas, who played the postman Mario Ruoppolo in the Friday and Sunday cast, was particularly thrilling to watch.
He held the entire audience captive throughout his perfor-mance with his golden voice and perfect comedic timing. Salas really knows how to project.
The chemistry between Salas and Joseph Evans, who portrays the real life poet, Pablo Neruda, was evident throughout the performance.
A particularly humorous scene in the opera happens when Neruda tries to teach Mario what a metaphor is. Mario’s innocent excitement of his new discovery had the audience chuckling, laughing, and then applauding.
Jared Guest was convincing as the corrupt politician, Di Cosimo. And, Sarah Lysiak was a pleasure to watch as Naruda’s wife, Matilde. Lysiak imbued her character with the quirkiness and sensuality befi tting the wife of a poet.
Jessica Jones, who played Mario’s love interest, Beatrice Russo, gave another excellent performance. In addition to her beautiful voice, Jones seemed quite comfortable on the stage. Towards the end of the opera she sings a chilling piece that certainly prompted the tear ducts of quite a
few audience members to fi ll.Carrie Reid-Knox, who plays
Beatrice’s aunt, Donna Rosa, gave another great performance. Rosa is one of the funniest characters in the opera, and Knox defi nitely helps to make that happen.
In addition to having a great cast, the production also clearly has a very talented set design team.
Many of the backdrops used in the production look like moving impressionist paintings. This helps to create a somewhat dreamy effect in many of the scenes and helps transport the audience from their seats in the Moores Opera House onto the beaches of Cala di Sotto.
The highly talented orchestra also plays a prominent role in this transportation.
This is a modern opera that anyone can enjoy — it’s not one of those shows where you count and tally the amount of songs left until you can sneak out during the intermission.
In fact, you will likely fi nd yourself absent-mindedly hum-ming melodies from the opera after the performance is over, and speaking in metaphors to your friends.
Get your event listed. www.thedailycougar.com/calendar
Paul de Jong (left) and Nick Zammuto (right) form the collage music duo The Books. They played at Fitzgerald’s on Thursday night. | Tomlab
MUSIC
Band’s performance was one for The BooksMary BaakTHE DAILY COUGAR
Most of Houston’s bearded, Wayfarer-wearing, American Spirit-smoking crowd gathered to see The Books perform at Fitzgerald’s this weekend.
For those who aren’t familiar with the duo, guitarist Nick Zammuto and cellist Paul de Jong use samples of home videos and other record-ings that have been picked up in thrift stores and add folk cello, viola and guitar melodies on top of the recordings.
The Books attracts an incred-ibly niche audience — it was only comprised of about 150 people, all of whom were almost completely silent during the performance.
The live performance was entirely unique. Behind the musi-cians was a screen that played
their music videos, which have a strong emphasis on opening the mind, exploring imagination and relaxation.
Most of the people in the crowd focused more on watching the vid-eos, laughing and whispering quietly to each other while the band played on the stage.
The audience was particularly pleased with their performance of the “Smells Like Content,” off the Lost and Safe album and “Take Time” off The Lemon of Pink which encorporates both the cello and the acoustic guitar on top of tribal beats.
It isn’t to be debated; The Books puts on a show that is unlike that of any other band. There has yet to be another group of musicians that has mastered the art of making music out of obscurity.
Thursdays at
BRING THE AD, AND GET IN THE GAME!Thursday Nights. Beer, BYOB, and Bingo Bash at... Bingo Paradise
1520 College Ave South Houston, TX 77587 Facebook.com/houstonbingoDrink responsibly, and always designate a driver. Bring in this ad!
A QUARTER BUYS A PITHCER OF BEER!BINGOPARADISEHOUSTON.COM
THIS AIN’T YOUR GRANNY’SBINGO HALL!
Paradise
$ 0 . 2 5PITCHER OF BEER!!
TTTTTHHHHHEEEEE DDDDDAAAAAIIIIILLLLLYYYYY CCCCCOOOOOUUUUUGGGGGAAAAARRRRR®®
t h e o f f i c i a l s t u d e n t n e w s p a p e r o f t h e u n i v e r s i t y o f h o u s t o n s i n c e 1 9 3 4
years
Men’s basketball rolls on with
dominant win over ECU SPORTS »Google has plans to revolutionize phone industry LIFE & ARTS »
HI 72 LO 61
Issue 74, Volume 75
Tuesday, January 19, 2010thedailycougar.com
WEATHER »
Forecast, Page 2
THEDAILYCOUGAR.COM
Speaking up
ZUHAIR SIDDIQUI THE DAILY COUGAR
Alumna leaves legacy in artsBy Amenah Khalil
THE DAILY COUGAR
Prominent alumna and
philanthropist Cynthia Woods
Mitchell, died Dec. 27 at age 87,
after almost a decade of living with
Alzheimer’s disease.
Mitchell was a valued donor to
various projects and causes, most of
which involved her love for the arts.
“She was a visionary
philanthropist whose dedication
to the arts was apparent in the
founding of the Cynthia Woods
Mitchell Center,” Karen Farber,
director of UH’s Cynthia Woods
Mitchell Center for the Arts, said in
an e-mail.
Mitchell was an enthusiastic
supporter of the arts and believed
that everyone, not just the wealthy,
should be able to enjoy musical
performances. This desire became
a reality when the Cynthia Woods
Mitchell Pavilion was created in The
Woodlands.
Mitchell’s philanthropy extends
throughout Houston, Galveston
and College Station.
For UH, the Cynthia Woods
Mitchell Center for the Arts remains
her greatest legacy.
With a $20 million donation from
Mitchell, the center has been able
to cultivate collaborations between
performing, visual and literary arts.
“Just as she lived a productive
and creative life with extraordinary
commitment to our community,
she has left a legacy that will fuel
creativity for future generations in
our community and far beyond,”
UH President Renu Khator said in a
release. The Cynthia Woods Mitchell
Center for the Arts went through
renovations in 2005 and 2006 and
was renamed in October 2006 to
honor Mitchell’s long-standing
support for the arts.
“Mrs. Mitchell’s and the
Mitchell family’s commitment to
create the Cynthia Woods Mitchell
Center for the Arts — a center that
celebrates the arts and encourages
collaboration — has helped to
position UH arts as one of the
University’s key priorities,” Khator
said.Mitchell was also a generous
donor to UH’s Texas Music Festival
and the Gerald D. Hines College of
Architecture. She also created UH’s
Distinguished Authors Program.
“Mrs. Mitchell and her family’s
generosity has made dozens of
significant new artworks possible
and left a lasting legacy that will
continue to infuse the entire
University and City of Houston with
creativity and innovation. On behalf
of the Mitchell Center board and
staff, I extend the deepest sympathy
and gratitude to the Mitchell
family,” Faber said in an e-mail.
d tFraternity to help
id i Haiti reliefsee MITCHELL, page 3
A group of local and national pro-
life advocates gathered to protest
the opening of a new Planned
Parenthood facility. The 78,000-sq. ft. facility
will be the largest Planned Parenthood
building in the nation and will be located at
4600 Gulf Freeway. Keith Fry, right, traveled
from Abilene to be among the thousands of
participants in the demonstrations, which
occurred Sunday and Monday.
TTTTTHHHHHEEEEE DDDDDAAAAAIIIIILLLLLYYYYY CCCCCOOOOOUUUUUGGGGGAAAAARRRRR®®t h e o f f i c i a l s t u d e n t n e w s p a p e r o f t h e u n i v e r s i t y o f h o u s t o n s i n c e 1 9 3 4
years
Men’s basketball rolls on with
dominant win over ECU SPORTS »Google has plans to
revolutionize phone
industry LIFE & ARTS »
HI 72 LO 61
Issue 74, Volume 75
Tuesday, January 19, 2010
thedailycougar.com
WEATHER »
Forecast, Page 2
UH rewards football coach Kevin Sumlin with new six-year contract
THEDAILYCOUGAR.COM
Speaking up
ZUHAIR SIDDIQUI THE DAILY COUGAR
Alumna leaves
legacy in artsBy Amenah Khalil
THE DAILY COUGAR
Prominent alumna and
philanthropist Cynthia Woods
Mitchell, died Dec. 27 at age 87,
after almost a decade of living with
Alzheimer’s disease.
Mitchell was a valued donor to
various projects and causes, most of
which involved her love for the arts.
“She was a visionary
philanthropist whose dedication
to the arts was apparent in the
founding of the Cynthia Woods
Mitchell Center,” Karen Farber,
director of UH’s Cynthia Woods
Mitchell Center for the Arts, said in
an e-mail.
Mitchell was an enthusiastic
supporter of the arts and believed
that everyone, not just the wealthy,
should be able to enjoy musical
performances. This desire became
a reality when the Cynthia Woods
Mitchell Pavilion was created in The
Woodlands.
Mitchell’s philanthropy extends
throughout Houston, Galveston
and College Station.
For UH, the Cynthia Woods
Mitchell Center for the Arts remains
her greatest legacy.
With a $20 million donation from
Mitchell, the center has been able
to cultivate collaborations between
performing, visual and literary arts.
“Just as she lived a productive
and creative life with extraordinary
commitment to our community,
she has left a legacy that will fuel
creativity for future generations in
our community and far beyond,”
UH President Renu Khator said in a
release.
The Cynthia Woods Mitchell
Center for the Arts went through
renovations in 2005 and 2006 and
was renamed in October 2006 to
honor Mitchell’s long-standing
support for the arts.
“Mrs. Mitchell’s and the
Mitchell family’s commitment to
create the Cynthia Woods Mitchell
Center for the Arts — a center that
celebrates the arts and encourages
collaboration — has helped to
position UH arts as one of the
University’s key priorities,” Khator
said.Mitchell was also a generous
donor to UH’s Texas Music Festival
and the Gerald D. Hines College of
Architecture. She also created UH’s
Distinguished Authors Program.
“Mrs. Mitchell and her family’s
generosity has made dozens of
significant new artworks possible
and left a lasting legacy that will
continue to infuse the entire
University and City of Houston with
creativity and innovation. On behalf
of the Mitchell Center board and
staff, I extend the deepest sympathy
and gratitude to the Mitchell
family,” Faber said in an e-mail.
d ntsFraternity to help
aid in Haiti reliefsee MITCHELL, page 3
A group of local and national pro-
life advocates gathered to protest
the opening of a new Planned
Parenthood facility. The 78,000-sq. ft. facility
will be the largest Planned Parenthood
building in the nation and will be located at
4600 Gulf Freeway. Keith Fry, right, traveled
from Abilene to be among the thousands of
participants in the demonstrations, which
occurred Sunday and Monday.
OOOOOUUUUUOOOOOUUUOUo fo f
witPOR
AAAAARRRRAARRe ee
OOOUUUUUUUUGGGGGAAAAAOOOUUUUUUUUGGGGUUUGGGGGAAAGAAAAAf h o u s t o n f h o u sh o uo u h o uo uuh o uh oh o uh
s i n c ef hhhhhh oooooooo uuuuuuu s t o ns s i nss t o n s i n ec e
ith RTS »
Missed a print edition?
You can now browse
recent publications in
our virtual newsstand @
thedailycougar.com/print-edition
The Daily Cougar COMICS & MORE Tuesday, April 12, 2011 ■ 7
crosswordcomics
sudokuHow to play Each row must contain the numbers 1 to 9; each column must contain the numbers 1 to 9; and each set of 3-by-3 boxes must also contain the numbers 1 to 9.
Robbie + Bobby by Jason Poland
Chili Fingers by Nam Nguyen
ACROSS 1 Ocean sighting 5 Afts. 8 Newborn 12 Kind of squash 14 Got off the plane 15 Cosmetics brand 16 High-born 17 Meditation
guide 18 Ascend 19 Dears 21 Bland writing 23 QB objectives 24 Evergreen 25 Whichever 26 Deer feet 30 Shelf 32 Pulled up stakes 33 Restyled (2 wds.) 36 Receptive 37 Soothsayer 38 Glacial ridges 40 Spring fl ower 42 Aquarium
denizen 43 Breeding horses 44 Metamorphic
rock 45 Sox sets 48 19, to Livy 49 Untruth 50 Michael’s sis 52 In bad faith (2
wds.) 57 Frankfurt’s river 58 Durable wood 60 Fermented milk 61 Ike Turner’s ex 62 — dixit 63 Bank vaults 64 Life sci. 65 House pet 66 Actress Daly
DOWN 1 Fleming et al. 2 Barge 3 Ear part 4 Whodunit name 5 Positive sign 6 Earth orbiter of
yore 7 More idiotic 8 Fishhook part 9 Teresa’s town 10 Warrant offi cer 11 Foe
13 Earned after taxes
14 Mellows 20 Visa and passport 22 Medea sailed on
her 24 Disgusted
(2 wds.) 26 MD employer 27 Fumbler’s
mumble 28 Pizzeria must 29 Snake juice 30 Nigeria’s capital 31 Call to mind 33 Source of royal
purple 34 Morales
of “La Bamba” 35 Dock denizens 37 Arm of the
Mediterranean 39 Home tel. 41 Like crayons
42 Skulks about 44 “— Blas” 45 Faint dead away 46 Deejay’s
medium 47 Old offi ce
worker 49 Summer-camp
site 51 Kind of surgeon 52 Sail support 53 Mighty deed 54 Chancy 55 — Bien Phu 56 Gaelic
language 59 Envir. monitor
© 2010 UNITED FEATURE SYNDICATE INC.
Previous puzzle solved
Previous puzzle solved
1 2 3 4 5 6 7 8 9 10 11
12 13 14 15
16 17 18
19 20 21 22
23 24 25
26 27 28 29 30 31
32 33 34 35
36 37 38 39
40 41 42
43 44
45 46 47 48 49
50 51 52 53 54 55 56
57 58 59 60
61 62 63
64 65 66
R I N S E A D D S R I C EA D I E U V I A L I N I TS O N A R A S H E G U S HP L A T O N I C E R O I C A
P A L E P A R T O NC R A T E D R I S KR U S E I N N O E N N U IE N S N A R E T I D I E S TW E N D S I V A N B A D E
O K L A C O S T A RH A V A N A C O A LE N E R G Y A B S I N T H EA E R O A U T O V O W E LR A G S K N E E E M I R ST R E E S A S S R E N E E
Earn a Top-Ranked Tulane Master of Finance degree in
Houston on weekends in just 14 months.
Confidence in the world of finance. Change your world. Change your future.
Attend an Information Session
Thursday April 14, 7:00 - 8:30 pm
RSVP to www.Houston.Tulane.edu/rsvp
www.Houston.Tulane.edu
West Loop at San Fe l ipe near the Ga l leria713-586-6400 or 1-866-Tu laneMBA
emai l Houston@Tu lane.edu
H O U S T O N C A M P U S
Top-ranked f inance curricu lumC lasses begin in JanuaryA lternate weekends for 14 monthsFriday evening & Saturday schedu leInnovative f inance curricu lumTu lane’s top f inance facu ltyStrong quantitative sk i l ls requiredFinance prerequisites not required
*14-month Tu lane Master of Finance degree a lso offered at the New Or leans Campus
8 ■ Tuesday, Aprili 12, 2011 NEWS The Daily Cougar
the “1323 Tyson.” Past speakers include Pulitzer-
prize winner Thomas L. Friedman, founder and director of the Global Viral Forecasting Initiative Nathan Wolfe and then-director of the National Human Genome Research Institute Francis S. Collins.
Tyson authored six books in total, including his memoir, “The Sky is Not the Limit: Adventures of an Urban Astrophysicist,” and New York Times bestseller, “Death By
Black Hole and Other Cosmic Quan-daries,” and his highly controversial account of Pluto’s status as the ninth planet titled, “The Pluto Files: The Rise and Fall of America’s Favorite Planet”.
Tyson earned a bachelor’s degree in physics from Harvard, a Ph.D. in astrophysics from Columbia, and 12 other honorary doctorates.
He is the recipient of the NASA Distinguished Public Service Medal and was appointed by former Presi-dent George W. Bush to serve on two separate committees, one in 2001 and one in 2004, to research United States aerospace industries and
space exploration policies. But don’t be fooled by all his
accolades, Tyson isn’t all brains and no brawn, he was also voted “Sexi-est Astrophysicist Alive” by People Magazine in 2004.
The lecture is free and open to the public.
Interested individuals should bring their universal inquiries and an open mind.
Tyson is one of many distin-guished guests invited to speak at the Rockwell Lecture series since its inception in 2004.
PHYSICISTcontinued from page 1
5 ‘launch’.”The new system features launched
April 5 are “My Academics” and “My Academics – Planner.” Both features can be found under the “Student Center” link located on the myUH main page.
The system was offline only to add these features.
“There were no issues with the previous 8.9 version that necessitated the upgrade to 9.0,” Cheatham said. “The purpose for upgrading to the 9.0 version is solely to enhance current student self-service academic and enrollment functions, thereby, con-tinuing to foster student success.”
Each feature works together to assist students in adding future
classes and reviewing current credits. “My Academics” provides students with a complete break down of required core classes and designated in-major courses in an advisement report. Upon opening, students are shown unfulfi lled required courses.
The functions also allow students a chance to save needed courses in a shopping cart and plan future course schedules in advance.
Kelly Sanchez said sees the benefi t of the new features.
“It is a useful tool that helps you keep up with the courses you have taken and need to take for your degree plan,” said Sanchez, a hotel and restaurant management major. “This tool will definitely benefit students because it shows all the classes you’ve taken and the grades you received, and it breaks it down from transfer credits, electives and
required courses.”The only ones who are able to
take advantage of the new features are undergraduates seeking their fi rst degree.
Because the upgraded system has only been live for a week, it is still undergoing changes.
“With any software application, there is always a need for upgrades to enhance current functionality and customer service,” Cheatham said.
The system was taken down on the evening of April 5 and again on April 7 for a few hours.
For students who are having diffi culties with the system or need assistance when the system is offl ine, can call the Welcome Center at (713) 743-1010 during designated business hours.
MYEDUcontinued from page 1
www.thedailycougar.comStay in touch.
Because your words matter.Have you been misquoted? Though The Daily Cougar strives for accuracy and fairness in its reporting, mistakes happen. Please report any errors you see in the paper to the editorial staff. Corrections will run on Page 2 as needed to amend the record. To report a correction, e-mail [email protected] or call (713) 743-5362.