document

910 NATURE MEDICINE • VOLUME 6 • NUMBER 8 • AUGUST 2000

ARTICLES

Chronic morphine administration frequently leads to altered be-havioral responses (called sensitization), which are thought toresult from neuronal hyperactivity and accompanying changesto neural activity-dependent gene expression in the brain1. Inparticular, repeated administration progressively enhances mor-phine-induced stimulation of motor activity2,3. Locomotor sensi-tization is obtained more reliably with repeated intermittentadministration of morphine4, and is sustained for prolonged pe-riods even after cessation of drug administration5. Thus, locomo-tor sensitization may serve as a useful animal model of plasticityand neuroadaptation associated with repeated administration ofopiate drugs that have abuse potential6, although the underlyingmolecular mechanism remains unclear.

To gain further insight into this issue, we attempted to iden-tify the genes involved in locomotor sensitization to morphineby cloning differentially expressed cDNAs from amygdala nuclei.We selected these nuclei because morphine-induced locomotorsensitization is blocked by lesioned basolateral amygdala (BL)7,and changes in the activity of cAMP response element bindingactivity protein (CREB), through which morphine is likely to bemediated, are most profound in the BL during withdrawal afterchronic morphine administration8. We show that locomotor sen-sitization to morphine may involve prolonged elevation of theanti-adhesive secreted glycoprotein secreted protein acidic andrich in cysteine (SPARC) in the BL.

Cloning of genes induced by chronic morphine administrationWe prepared a cDNA library from the amygdalae of mice thathad received repeated injections of morphine until locomotorsensitization was established. We then enriched the library indifferentially expressed cDNAs by subtractive hybridization withan amygdala cDNA library from untreated mice. From approxi-mately 20,000 independent clones, we used differential hy-bridization to isolate six, whose expression seemed to beaugmented by repeated morphine administration. By using insitu hybridization, we confirmed significant transcriptional up-

regulation of two clones. One gene was identified as SPARC (ref.9)/osteonectin/BM-40 (ref. 11); (called SPARC here), and theother is now being characterized.

Upregulation of SPARC transcriptionUsing in situ hybridization and immunohistochemical staining,we showed that SPARC transcript and protein were both signifi-cantly upregulated in BL 16 hours after the final injection of thesensitization protocol (Figs. 1a and 2), but not in other amygdalanuclei (data not shown). Increased expression of SPARC mRNAwas absent when morphine was co-administered with naloxone,an opioid receptor antagonist (Figs. 1a and 2). In contrast, expres-sion of the cAMP response element binding protein (CREB) wasunaffected by repeated morphine injection (Figs. 1b and 2i–m).

Correlation of SPARC expression with locomotor sensitizationBy quantitative RT–PCR, we evaluated the time-dependentchanges in SPARC transcription induced by daily morphine injec-tions and subsequent withdrawal (Fig. 3a and b). A single injec-tion of morphine had no effect on expression of SPARC mRNA,measured 3 or 16 hours after injection (Fig. 3e, left), nor did dailyinjection for 6 days (Fig. 3b). However, after 7 days, levels ofSPARC mRNA in BL were significantly elevated in mice receivingmorphine alone (Fig. 3b and e, left), but not in mice co-injectedwith morphine plus naloxone (Fig. 3e, left). Mice given repeateddoses of morphine low enough to induce sensitization but nottolerance and dependence showed increased expression of SPARCmRNA in BL (Fig. 3e, right). Once increased SPARC expressionwas established, we withdrew the morphine and analyzed subse-quent changes in SPARC transcription (Fig. 3a and b). At with-drawal (hour 0), levels of SPARC mRNA were 224 ± 70% ofcontrol, increased to 469 ± 47% within 16 hours, then graduallydeclined (Fig. 3b). Still, SPARC mRNA levels persisted at abouttwice the control levels for 2 weeks after cessation of morphineadministration, returning to control levels after 4 weeks (Fig. 3b).It seems that chronic administration for at least 7 days is required

Increased sensitivity to the stimulant effects of morphineconferred by anti-adhesive glycoprotein SPARC in amygdala

MITSUSHI IKEMOTO1, MASATOSHI TAKITA2, TORU IMAMURA2 & KOUTAROU INOUE1

1Department of Biomolecular Engineering, 2Department of Biosignaling,National Institute of Bioscience and Human Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry

1-1 Higashi, Tsukuba, Ibaraki 305-8566, JapanCorrespondence should be addressed to M.I.; email: [email protected]

Repeated administration of morphine substantially increases its locomotor-enhancing activity, aphenomenon termed locomotor sensitization. Here we show that secreted protein acidic andrich in cysteine (SPARC), an anti-adhesive glycoprotein present in the basolateral amygdala, con-tributes to the establishment of locomotor sensitization. The morphine-induced increase inSPARC levels in the basolateral amygdala persisted after morphine withdrawal and coincidedwith the duration of locomotor sensitization. Moreover, a single injection of morphine afterSPARC infusion into the basolateral amygdala of previously uninjected mice substantially en-hanced locomotor activity. Thus, SPARC may be an important element for establishing locomo-tor sensitization to morphine.

© 2000 Nature America Inc. • http://medicine.nature.com©

200

0 N

atu

re A

mer

ica

Inc.

• h

ttp

://m

edic

ine.

nat

ure

.co

m

NATURE MEDICINE • VOLUME 6 • NUMBER 8 • AUGUST 2000 911

ARTICLES

to augment SPARC expression in BL through this opioid-receptorpathway. Once established, the increased expression persists for aprolonged period after morphine withdrawal.

Using the same sensitization and withdrawal protocol, we as-sessed augmentation of locomotor activity after single doses ofmorphine were administered to mice on withdrawal days 7, 14or 28 (Fig. 3a). Whereas significant locomotor sensitization tomorphine remained on days 7 and 14 (Fig. 3c, left and middle), itdisappeared by withdrawal day 28 (Fig. 3c, right, and d).

We then examined correlation between SPARC expression andlocomotor sensitization by measuring levels of SPARC mRNA inthe BL of three mouse strains with differing locomotor sensitivi-

ties to morphine. In strains with sensitivity to morphine (ddYand C57BL/6), repeated morphine injections increased expres-sion of SPARC mRNA in BL (Fig. 3f). In contrast, the same treat-ment had no effect on SPARC expression in a non-sensitive strain(DBA/2; Fig. 3f).

Increased sensitivity to morphine after SPARC infusionTo further characterize the function of SPARC in locomotor-en-hancing activity to morphine, we investigated the effect of mi-croinfusing SPARC protein into BL nuclei. SPARC protein wasexpressed in Escherichia coli AD494 (DE3) cells as a fusion proteinwith thioredoxin (Trx-SPARC). Once purified, we microinfusedTrx-SPARC bilaterally into the BL of ddY mice 2 days before a sin-gle injection of morphine, which elicited significant increases inlocomotor activity and persisted for 3 hours (Fig. 4a and c). Theincreased sensitivity of mice to an acute injection of morphineoccurred only when the active form of SPARC was infused. Micereceiving either Trx alone (Trx-Tag) or heat-denatured Trx-SPARC showed no increase in locomotor activity in response tomorphine; instead, their behavior was indistinguishable fromthat of mice injected with saline (Fig. 4a and c). Furthermore,saline injected into mice that had received intact Trx-SPARC hadno effect on locomotor activity (Fig. 4b and d), indicating thatboth morphine-induced stimulation of locomotor activity andits enhancement by previous infusion of Trx-SPARC were dose-dependent (Fig. 4e). We determined that the minimally activedose of morphine was 10 mg/kg, and prior microinfusion of atleast 5 pmol SPARC was required (Fig. 4f).

Anti-adhesive property of SPARC fusion proteinSPARC exerts an anti-adhesive effect on bovine aortic endothe-

Fig. 1 Expression profile of SPARC protein in mouse brain after challenge.Brain sections from mice (n = 4) were evaluated for immunoreactivity withSPARC protein (a) and CREB protein (b) after repeated administration ofsaline (�), morphine (�), morphine plus naloxone (�), or acute administra-

Fig. 2 Histology of morphine-induced alterations in BL SPARC mRNA lev-els. In situ hybridization signals of SPARC mRNA (left), SPARC immunoreac-tivity (middle) and CREB immunoreactivity (right) after repeatedadministration of saline (Chr-S; a, f and k), morphine (Chr-M; b, g and l),morphine plus naloxone (Chr-M+N; c, h and m), and specificity controls(Sense or Negative control; d, i and n). Scale bars: left column, 250 µm;middle and right columns, 100 µm. e, j and o, Percent expression ofSPARC mRNA (n = 3), SPARC protein (n = 4) and CREB protein (n = 4) in BL(means ± s.e.m.). *, significant increases in SPARC mRNA (F2,6 = 0.003; *, P< 0.05; one-way ANOVA) and SPARC protein (F2,9 = 0.1037; **, P < 0.05;one-way ANOVA).

b

n

l

m

k

i

h

g

f

d

c

b

a

e j o

tion of morphine (�). Upregulation of SPARC protein by repeated morphinewas only detected in BL (F3,12 = 0.1428; *, P < 0.05; one-way ANOVA). BL, ba-solateral amygdala nucleus; CPu, caudate putamen; NAc, nucleus accum-bens; VTA, ventral tegmental area; LC, locus coeruleus.

a


200

0 N

atu

re A

mer

ica

Inc.

• h

ttp

://m

edic

ine.

nat

ure

.co

m


ARTICLES

lial cells. Therefore, we examined whether Trx-SPARCwould exert such an effect on cultured neural(N18TG-2 and NG108-15) or glial (C6Bu-1) cells.Before exposure to Trx-SPARC, the cells showed a flat-tened, spread-out appearance on the surface of plasticculture plates (Fig. 5a, d and g). When exposed to pu-rified Trx-SPARC (2 µM), the cells became roundwithin 24 hours (Fig. 5b, e and h); similar anti-adhe-sive activity occurred with exposure to 1 µM Trx-SPARC (Fig. 5k).We determined that the median effective dose of the anti-adhe-sive effect of the Trx-SPARC preparation was about 1.5 µM, andthat the effect was specifically and dose-dependently inhibitedby heat-denaturation or preabsorption with antibody againstSPARC (Fig. 5j). Trx-Tag solution (2 µM) had no anti-adhesive ef-fect (Fig. 5c, f, i and k). Furthermore, endotoxin levels in the Trx-SPARC and Trx-Tag preparations were 98 pg/ml and 93 pg/ml,respectively, confirming that the rounding up of cells was notdue to endotoxin. In all experiments, the cells remained at-tached to the plastic dishes, and trypan blue exclusion tests con-firmed that the rounded cells were alive (data not shown).

DiscussionVarious components of the cAMP signaling cascade are associ-ated with the long-term effects of morphine treatment andwithdrawal1. For example, the µ-opioid receptor is enriched inamygdala nuclei12,13 and is the main in vivo target of mor-phine14,15, mediating morphine-induced modulation of adeny-late cyclase activity and intracellular cAMP levels16. Morphinealso affects the phosphorylation state of transcription factorCREB, by which opiates induce changes in gene expression17.That several cAMP-responsive elements were found in the

SPARC gene and its transcription was activated in response todibutyryl cAMP and retinoic acid in F9 teratocarcinoma9, is con-sistent with the upregulation of SPARC in BL by repeated mor-phine administration.

Our in situ hybridization and immunohistochemical analysesindicate that expression of both SPARC mRNA and protein areupregulated in BL after repeated injection of morphine, and thatthe effect occurs through an opioid-receptor pathway. Changesin SPARC transcription after either single or repeated administra-tions of morphine were not detected in areas of the mesolimbicdopamine system or in the locus coeruleus (Fig. 1), indicatingthat morphine-induced upregulation of SPARC was specific toBL. Furthermore, Nissl staining showed no signs of anatomicalabnormality or changes in the size or density of neurons in anybrain region, including the amygdala nuclei (data not shown),indicating that upregulation of SPARC was not a consequence ofneuronal cell death or damage.

Our genetic and behavioral analyses showed that expression ofSPARC mRNA in BL correlates with the degree of locomotor sen-sitization. Moreover, infusion experiments showed that elevat-ing SPARC levels in the BL enhances the locomotor sensitizationeffect of single morphine injections into previously uninjectedmice. SPARC alone does not exert this effect, nor is increased lo-

Fig. 3 Morphine-induced locomotor sensitization and up-regulation of SPARC transcription. a, Protocol for repeatedmorphine injections and quantitative RT–PCR analysis. b,Time-dependent changes in BL SPARC mRNA levels duringand after chronic morphine administration (n = 4). Boldlines, daily morphine injections; arrowheads (W7, W14 andW28), days on which locomotor activity was evaluated. c,Time course of locomotor activity induced by a single mor-phine injection (100 mg/kg) after chronic saline (�) andmorphine (�) treatment on withdrawal days 7 (n = 14), 14(n = 19) or 28 (n = 14). *, significant increases in locomotoractivity (*, P < 0.01, unpaired t-test). d, Overall locomotor ac-tivity induced by a single morphine injection (100 mg/kg)after chronic administration of saline (�) or morphine (�).There was significant locomotor sensitization on withdrawaldays 7 (n = 14) and 14 (n = 19), but not on withdrawal day28 (n = 14). *, P < 0.05 and #, P < 0.01, unpaired t-test. e,SPARC mRNA levels in mouse BL (n = 4) after repeated ad-ministration of saline (Chr-S 16 h), morphine (Chr-M 16 h),morphine plus naloxone (Chr-M+N 16 h) or acute morphineinjection (Acu-M 3 and 16 h). Left, morphine was injected athigh dose as for experiments in b, c, d and f. Right, morphinewas injected at low dose (10 mg/kg). Upregulation of SPARCmRNA is a specific response to chronic morphine administra-tion. Left, F4,15 = 57.65; *, P < 0.001; one-way ANOVA. Right,#, P < 0.01, unpaired t-test. f, Analysis of SPARC mRNA ex-pression in BL using mouse strains showing varying degreesof locomotor sensitization to chronic morphine administra-tion. Expression of SPARC mRNA is significantly increased inthe C57BL/6 (n = 3) and ddY (n = 4) strains, but not in theDBA/2 strain (n = 4). Data represent means ± s.e.m. F2,8 =29.8; #, P < 0.01, one-way ANOVA.

a

b c

d e

f

Quantitative RT–PCR


200

0 N

atu

re A

mer

ica

Inc.

• h

ttp

://m

edic

ine.

nat

ure

.co

m


ARTICLES

comotor activity a nonspecific reaction to surgery orinfusion. In addition, SPARC microinfusion had no ef-fect on naloxone-precipitated jumping tests, open fieldtests, cliff reflex tests or elevated cross-armed mazetests (data not shown). These results indicate that in-creased SPARC expression in BL does not participate inthe emotional and physical dependence characteristicof chronic morphine usage. Instead, SPARC seems tobe specifically involved in establishing locomotor sen-sitization.

SPARC is a secreted extracellular matrix glycoproteinbelonging to a class of anti-adhesive proteins18. In part,SPARC modulates the interaction between extracellu-lar matrix proteins and growth factors, which is knownto affect neurite outgrowth and synaptic stabiliza-tion19,20. SPARC also affects the synthesis of extracellular matrixmolecules and inhibits adhesion of some endothelial cells tosubstrata21. In adult brain, SPARC is expressed in synapse en-riched regions19 and shows structural similarity to the mouseneural adhesion molecule SC1 (ref. 22). SC1 is a secreted glyco-protein expressed during neuronal development and in theadult brain23 and is involved in synapse formation and extensionof filopodia24; therefore, it is possible that SPARC shares some ofthe functional characteristics of SC1. Indeed, SPARC exerts ananti-adhesive effect on glial and neuronal cell lines (Fig. 5) andcauses differentiated PC12 cells to retract their neurites (M.I., un-published observation). These data indicate that SPARC maymodulate synaptic structure via a process entailing alteration ofsynaptic spine architecture and reorganization of synaptic con-nections. Thus, it seems reasonable to hypothesize that mor-phine-induced elevation of SPARC affects cell-cell adhesions inBL, thereby eliciting long-lasting changes in synaptic activity.

In our infusion experiments, the dose of Trx-SPARC requiredto establish increased sensitivity to an acute injection of mor-phine was rather high compared with that required to cause cellrounding in vitro. However, as the infused fluid would be ex-pected to rapidly diffuse into surrounding areas, the actual con-centration of SPARC at the BL may be roughly the same as thatused in the in vitro test. In addition, the median effective dose for

the anti-adhesive effect of Trx-SPARC on cultured neuronal cellswas about 1.5 µM (Fig. 5k), which is of the same order of magni-tude as that for inhibition of bovine aortic endothelial cell adhe-sion (0.6 µM) (ref. 25).

Individual nuclei within amygdala are functionally uniqueand mediate differing fear-conditioned behaviours26. BL neu-rons, which are especially plastic and discriminative with re-spect to positive and negative unconditioned and conditionedstimuli27, are involved in pavlovian second-order conditioningand reinforcer devaluation effects28. The BL also shows long-term depression at lateral-BL synapses29 and long-term potentia-tion at BL-dentate gyrus synapses30. Whereas the BL is involvedin establishing locomotor sensitization to morphine, opiate-me-diated transmission through the mesolimbic dopaminergic sys-tem also seems necessary4,31,32. BL neurons project to the centralnucleus of the amygdala33, which projects to the ventraltegmental area34,35 and the nucleus accumbens36,37, indicatingthat neural circuits involving both the amygdala7 and themesolimbic dopaminergic system7,38,39,40 may contribute to sensi-tization. It is possible that the anti-adhesive properties of SPARCsuppress the function of inhibitory neurons in the amygdala, orthat SPARC may stimulate excitatory neurons by an as yet un-characterized mechanism. At present, these possibilities remainhypothetical and warrant further investigation. It is also unclear

Fig. 4 Locomotor-enhancing response to acute morphine in-jection after microinfusion of SPARC. a, Time course of locomo-tor activity in response to a single injection of morphine aftermicroinfusion of SPARC. Serial locomotor activity is significantlyincreased (F72, 504 = 27.04; P < 0.001; repeated ANOVA) in miceinfused with Trx-SPARC (�; n = 8) compared with that in micereceiving saline (�; n = 8), Trx-Tag (�, n = 8), or heat-denaturedTrx-SPARC (�; n = 8). Locomotor activity at several individualtime points is also augmented (*, P < 0.05 and #, P < 0.01, one-way ANOVA). b, Time course of locomotor activity elicited bysingle injection of saline after microinfusion of saline (�; n = 8),Trx-Tag (�; n = 8), or Trx-SPARC (�; n = 8). F36, 378 = 1.06; P >0.05; repeated ANOVA. c, Overall locomotor activity after mi-croinfusion of indicated substances and single morphine injec-tion (F3,28 = 9.60; #, P < 0.001; one-way ANOVA). d, Overalllocomotor activity after microinfusion of indicated substancesand single saline injection (F2,21 = 0.061; P > 0.05; one-wayANOVA). e, Dose-dependent effects of acute injection of mor-phine on locomotor-enhancing response in mice microinfusedwith Trx-SPARC (�) compared with Trx-Tag (�). *, P < 0.05 and#, P < 0.001, unpaired t-test. f, Dose-dependent effects of mi-croinfused SPARC on locomotor-enhancing response induced bysingle dose of morphine. Data represent means ± s.e.m. n = 8;F3,28 = 9.09; *, P < 0.05 and #, P < 0.001; one-way ANOVA.

d

a b

c

e f

Veh

icle

Trx-

tag


200

0 N

atu

re A

mer

ica

Inc.

• h

ttp

://m

edic

ine.

nat

ure

.co

m


ARTICLES

whether psychostimulants such as cocaine and amphetamine,which also affect locomotor sensitization through dopaminer-gic and other monoaminergic systems41,42 after changes in thetranscription of certain genes43,44,45, share the same mechanismas morphine.

MethodsAnimals. All animals received humane care in accordance with NationalInstitute of Bioscience and Human Technology guidelines. Except for thestrain comparison experiment, a ddY strain with moderate sensitivity tomorphine was used in all the experiments. Male mice (6 weeks old; 25–30 gin body weight) were maintained on a 12-hour light–dark cycle at a con-stant temperature. Mice were habituated in separate cages for 15 min be-fore measuring locomotor activity. For ‘acute’ experiments, mice weregiven a single subcutaneous injection of morphine hydrochloride (100mg/kg). For ‘chronic’ experiments, mice were subjected to a 7-day regimenin which increasing doses of morphine hydrochloride (10, 20, 40, 80, 100,100 and 100 mg/kg) were injected subcutaneously twice a day (9:00 and21:00) (ref. 46). Control mice were injected with saline in the same condi-tions. For ‘low-dose’ experiments, mice were injected subcutaneously with10 mg/kg morphine hydrochloride once a day for 7 d at intervals of 24 h.

Subtractive cloning. cDNA libraries were constructed using 5-µg aliquotsof mRNA prepared from the amygdala nuclei of five chronically injectedmale ddY mice 16 h after the last injection of either saline or morphine.Subtractive cloning was done as described47.

Quantitative RT–PCR. Quantitative RT–PCR was carried out as described48.First-strand cDNA was synthesized with mRNA extracted from BL usingSuperscript II reverse transcriptase (200 U/µl; Life Technologies) and randompriming. Amplification entailed 18–26 cycles in a DNA thermal cycler (PJ2000; Perkin-Elmer, Foster, California) using the following protocols: SPARC,94 °C for 30 s, 55 °C for 45 s and 72 °C for 90 s; GAPDH, 94 °C for 30 s, 50 °Cfor 45 s and 72 °C for 90 s. The primers for SPARC (437 bp) were 5′–CCGA-GAGTTCCCAGCATCAT–3′ and 5′–AGCTTGTGGCCCTTCTTGGT–3′. Theprimers for GAPDH (443 bp) were 5′–TTCATTGACCTCAACTACATG–3′ and5′–GTGGCAGTGATGGCATGGACT–3′.

Preparation of recombinant SPARC fusion protein. A 1.5-kbp mouseSPARC cDNA fragment (90–1592) was amplified by PCR and inserted intothe BamHI and XhoI sites of the pET 32a (+) expression vector, which alsoencodes Trx. The primers were 5′–GGATCCATGAGGGCCTG-GATCTTCTTT–3′ and 5′–CTCGAGGGAGGGGTGACACATCAGAGG–3′,which contained BamHI and XhoI restriction sites at their respective 5′ ends.E. coli AD494 (DE3) bacteria were transformed with the Trx-SPARC expres-sion vector and incubated first for 3 h at 37 °C with shaking, then for 6 h at20 °C in the presence of 1 mM IPTG. Thereafter, the cells were sonicated,the soluble fraction was collected, and His-Bind resin (Novagen, Madison,Wisconsin) was added under non-denaturing conditions, following manu-facturer’s protocol. The eluted proteins were further fractionated by size ex-clusion chromatography using a Hiload Superdex 75 column (Amersham),which yielded a single band on 10% SDS–PAGE with CBB staining. The con-centrations of recombinant proteins were determined using a BCA proteinassay kit (Pierce, Rockford, Illinois). Endotoxin levels among recombinantproteins were evaluated by Limulus amebocyte lysate assay using a QCL-1000 kit (BioWhittaker, Walkersville, Maryland).

Evaluation of anti-adhesive properties of recombinant SPARC fusionprotein. The anti-adhesive properties of SPARC were assessed as de-scribed21. Freshly dissociated cells were washed with PBS, suspended with10% FCS in DMEM at a density of 2 × 105 cells/ml, and 100 µl of the cellsuspension was added to each well of 96-well culture plates (Falcon,Heidelberg, Germany) and incubated at 37 °C for 48 h. After wells werewashed twice with PBS, 90 µl 5% FCS in DMEM plus 10 µl Trx-SPARC orTrx-Tag solution were added to each well and incubated at 37 °C for an ad-ditional 24 h. The morphology of cells was evaluated by counting the num-bers of rounded and flattened, spread-out cells present inphotomicrographs of representative fields from each well.

Microinfusion of SPARC. Male ddY mice (7 weeks old; 25-30 g in bodyweight) were anesthetized with sodium pentobarbital (5 mg/ml, 250 µl,intraperitoneally) and placed in a stereotaxic apparatus (Narishige, Tokyo,Japan). A pair of metal guide cannuli (24-gauge) were bilaterally andstereotaxically implanted into the BL (bregma, –1.6 mm; lateral, ± 3.0 mm;ventral, 3.0 mm under the dura), and the mice were allowed to recover for7 d. On day 7, infusion cannuli were inserted through the guide cannuliuntil they protruded 500 µm beyond the respective inner ends. Mice weremicroinfused at a rate of 0.1 µl/min for 5 min (final volume, 0.5 µl) with ei-ther vehicle (saline containing 0.004% Nonidet P-40), 10 pmol Trx-Tag,10 pmol Trx-SPARC or 10 pmol heat-denatured (100 °C for 30 min) Trx-SPARC. On day 9, locomotor activity was automatically measured for 3 husing a Scanet SV-10 (Toyo Industry, Toyama, Japan). Infusion into BL wasconfirmed by immunohistochemical labeling in coronal sections.

Fig. 5 The anti-adhesive effect of recombinant SPARC on neuronal celllines. a–i, Attached and spreading C6Bu-1 (a–c), NG108-15 (d–f) andN18TG-2 (g–i) cells were treated with PBS (a, d and g), Trx-SPARC (b, e andh) or Trx-Tag (c, f and i). Magnification, ×150. j, Specificity of the anti-ad-hesive action of recombinant SPARC. Cell lines (C6Bu-1, �; N18TG-2, �;NG108-15, �) were exposed to PBS, (PBS), Trx-SPARC (Trx-SPARC), Trx-SPARC preabsorbed with IgG antibody against SPARC (Trx-SPARC + Ab), orheat-denatured Trx-SPARC (Trx-SPARC + Heat). k, Dose-dependent effectsof recombinant SPARC. C6Bu-1, �; N18TG-2, �; NG108-15, �; Trx-SPARCtreatment, closed symbols; Trx-Tag treatment, open symbols.

a b c

d e f

g h i

j k


200

0 N

atu

re A

mer

ica

Inc.

• h

ttp

://m

edic

ine.

nat

ure

.co

m


ARTICLES

Histological analysis. Frozen mouse brain sections (16 µm in thickness)were fixed with 4% paraformaldehyde in PBS. For in situ hybridization, sec-tions were hybridized with digoxygenin-labeled SPARC cRNA probesovernight at 55 °C, then visualized using 5- bromo -4- chloro - 3-indolylphosphate and Nitoro blue tetrazolium chloride (BCIP/NBT) solution, as de-scribed49. An Elite ABC kit (Vector Laboratories, Burlingame, California) wasused according to manufacturer’s protocol for immunohistochemical label-ing: Frozen sections were incubated with rabbit polyclonal IgG antibodyagainst SPARC (total protein 36 mg/ml; 1:2,000 dilution; LSL, Tokyo,Japan) or a rabbit polyclonal IgG antibody against CREB-1 (240) (100µg/ml; 1:100 dilution; Santa Cruz Biotechnology, Santa Cruz, California)and visualized using 3,3′ diaminobenzidine (DAB) solution. Western blotanalysis confirmed that the antibody against SPARC did not cross-react withSC1/hevin or other proteins.

AcknowledgmentsWe thank N. Ishida for discussion and comments; M. Ohtomi, H. Miyazaki, M.Matsui, S. Oka, K. Nakagomi, S. Akiduki, Y. Kobayashi, T. Inoue and D. Yoshiifor their assistance; and W. F. Goldman (MST Editing Company) for reviewingthe manuscript. This work was supported by a grant from AIST, Ministry ofInternational Trade and Industry, Japan.

RECEIVED 7 JANUARY; ACCEPTED 20 JUNE 2000

1. Nestler, E.J., Hope, B.T. & Widnell, K.L. Drug addiction: a model for the molecularbasis of neural plasticity. Neuron 11, 995-1006 (1993).

2. Kuribara, H. & Tadokoro, S. Reverse tolerance to ambulation-increasing effects ofmethamphetamine and morphine in 6 mouse strains. Jpn. J. Pharmacol. 49, 197-203 (1989).

3. Brady, L.S. & Holtzman, S.G. Locomotor activity in morphine-dependent andpost-dependent rats. Pharmacol. Biochem. Behav. 14, 361-370 (1981).

4. Vezina, P., Kalivas, P.W. & Stewart, J. Sensitization occurs to the locomotor effectsof morphine and the specific mu opioid receptor agonist, DAGO, administered re-peatedly to the ventral tegmental area but not to the nucleus accumbens. BrainRes. 417, 51-58 (1987).

5. Nakamura, H., Ishii, K. & Shimizu, M. Some altered responses in rats formerly de-pendent on morphine. Psychopharmacology (Berl) 56, 269-277 (1978).

6. Spanagel, R. Modulation of drug-induced sensitization processes by endogenousopioid systems. Behav. Brain Res. 70, 37-49 (1995).

7. Wolf, M.E., Dahlin, S.L., Hu, X.T., Xue, C.J. & White, K. Effects of lesions of pre-frontal cortex, amygdala, or fornix on behavioral sensitization to amphetamine:comparison with N-methyl-D-aspartate antagonists. Neuroscience 69, 417-439(1995).

8. Ikemoto, M. et al. Decrease in CRE binding activity by chronic morphine adminis-tration in mouse brain. NeuroReport 6, 262-264 (1995).

9. Mason, I.J., Taylor, A., Williams, J.G., Sage, H. & Hogan, B.L. Evidence from mole-cular cloning that SPARC, a major product of mouse embryo parietal endoderm, isrelated to an endothelial cell ‘culture shock’ glycoprotein of Mr 43,000. EMBO J. 5,1465-1472 (1986).

10. Termine, J.D. et al. Osteonectin, a bone-specific protein linking mineral to colla-gen. Cell 26, 99-105 (1981).

11. Mann, K., Deutzmann, R., Paulsson, M. & Timpl, R. Solubilization of protein BM-40 from a basement membrane tumor with chelating agents and evidence for itsidentity with osteonectin and SPARC. FEBS Lett. 218, 167-172 (1987).

12. Mansour, A., Fox, C.A., Burke, S., Akil, H. & Watson, S.J. Immunohistochemical lo-calization of the cloned mu opioid receptor in the rat CNS. J. Chem. Neuroanat. 8,283-305 (1995).

13. Ding, Y.Q., Kaneko, T., Nomura, S. & Mizuno, N. Immunohistochemical localiza-tion of mu-opioid receptors in the central nervous system of the rat. J. Comp.Neurol. 367, 375-402 (1996).

14. Matthes, H.W. et al. Loss of morphine-induced analgesia, reward effect and with-drawal symptoms in mice lacking the mu-opioid-receptor gene. Nature 383, 819-823 (1996).

15. Sora, I. et al. Opiate receptor knockout mice define mu receptor roles in endoge-nous nociceptive responses and morphine-induced analgesia. Proc. Natl Acad. Sci.USA 94, 1544-1549 (1997).

16. Sharma, S.K., Klee, W.A. & Nirenberg, M. Dual regulation of adenylate cyclase ac-counts for narcotic dependence and tolerance. Proc. Natl Acad. Sci. USA 72, 3092-3096 (1975).

17. Guitart, X., Thompson, M.A., Mirante, C.K., Greenberg, M.E. & Nestler, E.J.Regulation of cyclic AMP response element-binding protein (CREB) phosphoryla-tion by acute and chronic morphine in the rat locus coeruleus. J. Neurochem. 58,1168-1171 (1992).

18. Sage, E.H. & Bornstein, P. Extracellular proteins that modulate cell-matrix interac-tions. SPARC, tenascin, and thrombospondin. J. Biol. Chem. 266, 14831-14834(1991).

19. Mendis, D.B., Malaval, L. & Brown, I.R. SPARC, an extracellular matrix glycopro-tein containing the follistatin module, is expressed by astrocytes in synaptic en-riched regions of the adult brain. Brain Res. 676, 69-79 (1995).

20. Dou, C.L. & Levine, J.M. Inhibition of neurite growth by the NG2 chondroitin sul-fate proteoglycan. J. Neurosci. 14, 7616-7628 (1994).

21. Sage, H., Vernon, R.B., Funk, S.E., Everitt, E.A. & Angello, J. SPARC, a secreted pro-tein associated with cellular proliferation, inhibits cell spreading in vitro and showsCa+2-dependent binding to the extracellular matrix. J. Cell Biol. 109, 341-356(1989).

22. Soderling, J.A., Reed, M.J., Corsa, A. & Sage, E.H. Cloning and expression ofmurine SC1, a gene product homologous to SPARC. J. Histochem. Cytochem. 45,823-835 (1997).

23. Mendis, D.B., Shahin, S., Gurd, J.W. & Brown, I.R. SC1, a SPARC-related glycopro-tein, shows features of an ECM component in the developing and adult brain.Brain Res. 713, 53-63 (1996).

24. Johnston, I.G., Paladino, T., Gurd, J.W. & Brown, I.R. Molecular cloning of SC1: aputative brain extracellular matrix glycoprotein showing partial similarity to os-teonectin/BM40/SPARC. Neuron 4, 165-176 (1990).

25. Bassuk, J.A., Baneyx, F., Vernon, R.B., Funk, S.E. & Sage, E.H. Expression of biolog-ically active human SPARC in Escherichia coli. Arch. Biochem. Biophys. 325, 8-19(1996).

26. Killcross, S., Robbins, T.W. & Everitt, B.J. Different types of fear-conditioned be-haviour mediated by separate nuclei within amygdala. Nature 388, 377-380(1997).

27. Muramoto, K., Ono, T., Nishijo, H. & Fukuda, M. Rat amygdaloid neuron re-sponses during auditory discrimination. Neuroscience 52, 621-636 (1993).

28. Hatfield, T., Han, J.S., Conley, M., Gallagher, M. & Holland, P. Neurotoxic lesionsof basolateral, but not central, amygdala interfere with Pavlovian second-orderconditioning and reinforcer devaluation effects. J. Neurosci. 16, 5256-5265(1996).

29. Wang, S.J. & Gean, P.W. Long-term depression of excitatory synaptic transmissionin the rat amygdala. J. Neurosci. 19, 10656-10663 (1999).

30. Akirav, I. & Richter-Levin, G. Priming stimulation in the basolateral amygdala mod-ulates synaptic plasticity in the rat dentate gyrus. Neurosci. Lett. 270, 83-86(1999).

31. Carlezon, W.A. Jr et al. Sensitization to morphine induced by viral-mediated genetransfer. Science 277, 812-814 (1997).

32. Bunney, W.C., Massari, V.J. & Pert, A. Chronic morphine-induced hyperactivity inrats is altered by nucleus accumbens and ventral tegmental lesions.Psychopharmacology 82, 318-321 (1984).

33. Collins, D.R. & Pare, D. Reciprocal changes in the firing probability of lateral andcentral medial amygdala neurons. J. Neurosci. 19, 836-844 (1999).

34. Phillipson, O.T. Afferent projections to the ventral tegmental area of Tsai and in-terfascicular nucleus: a horseradish peroxidase study in the rat. J. Comp. Neurol.187, 117-143 (1979).

35. Wallace, D.M., Magnuson, D.J. & Gray, T.S. Organization of amygdaloid projec-tions to brainstem dopaminergic, noradrenergic, and adrenergic cell groups in therat. Brain Res. Bull. 28, 447-454 (1992).

36. Shinonaga, Y., Takada, M. & Mizuno, N. Topographic organization of collateralprojections from the basolateral amygdaloid nucleus to both the prefrontal cortexand nucleus accumbens in the rat. Neuroscience 58, 389-397 (1994).

37. Kelley, A.E., Domesick, V.B. & Nauta, W.J. The amygdalostriatal projection in therat, an anatomical study by anterograde and retrograde tracing methods.Neuroscience 7, 615-630 (1982).

38. Trujillo, K.A. & Akil, H. Inhibition of morphine tolerance and dependence by theNMDA receptor antagonist MK-801. Science 251, 85-87 (1991).

39. Criswell, H.E., Mueller, R.A. & Breese, G.R. Long-term D1-dopamine receptor sen-sitization in neonatal 6-OHDA-lesioned rats is blocked by an NMDA antagonist.Brain Res. 512, 284-290 (1990).

40. Karler, R., Calder, L.D., Chaudhry, I.A. & Turkanis, S.A. Blockade of reverse toler-ance to cocaine and amphetamine by MK-801. Life Sci. 45, 599-606 (1989).

41. Ellinwood, E.H. & Cohen, S. Amphetamine abuse. Science 171, 420-421 (1971).42. Post, R.M. & Rose, H. Increasing effects of repetitive cocaine administration in the

rat. Nature 260, 731-732 (1976).43. Karler, R., Finnegan, K.T. & Calder, L.D. Blockade of behavioral sensitization to co-

caine and amphetamine by inhibitors of protein synthesis. Brain Res. 603, 19-24(1993).

44. Sorg, B.A. & Ulibarri, C. Application of a protein synthesis inhibitor into the ventraltegmental area, but not the nucleus accumbens, prevents behavioral sensitizationto cocaine. Synapse 20, 217-224 (1995).

45. Wang, X.B. et al. rGfl1: a psychostimulant-regulated gene essential for establishingcocaine sensitization. J. Neurosci. 17, 5993-6000 (1997).

46. Kaneto, H., Koida, M., Nakanishi, H. & Sasano, H. A scoring system for abstinencesyndrome in morphine dependent mice and application to evaluate morphinetype dependence liability of drugs. Jpn. J. Pharmacol. 23, 701-707 (1973).

47. Yamagata, K., Andreasson, K.I., Kaufmann, W.E., Barnes, C.A. & Worley, P.F.Expression of a mitogen-inducible cyclooxygenase in brain neurons: regulation bysynaptic activity and glucocorticoids. Neuron 11, 371-386 (1993).

48. Nakayama, H., Yokoi, H. & Fujita, J. Quantification of mRNA by non-radioactiveRT-PCR and CCD imaging system. Nucleic Acids Res. 20, 4939 [ONLY ONE PAGE?](1992).

49. Matsui, M., Mitsui, Y. & Ishida, N. A DIG in situ hybridization method for newcom-ers: application of the method to paraffin brain sections. Neuroscience Protocols 20,1-13 (1996).


200

0 N

atu

re A

mer

ica

Inc.

• h

ttp

://m

edic

ine.

nat

ure

.co

m

document

Documents