5. chapter iti - shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf ·...
TRANSCRIPT
![Page 1: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/1.jpg)
5. CHAPTER ITI : Estrogen receptor subtype 0.- p- specificity of SERMs and CDR! 99/373 using recombinant ligand binding
domain of estrogen receptor
![Page 2: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/2.jpg)
Chapter III
5.1. Introduction
Estrogen receptors a (ERa) and ~ (ER~) are ligand-inducible transcription factors
that are involved in regulating cell growth, proliferation, differentiation and homeostasis in
various tissues. The two subtypes ofER differ in size, share modest sequence identity (47 %)
and are encoded by different genes (Enmark et al., 1997; Tremblay et ai., 1997) Ligand
binding domain (LBD), which shares second highest similarity (59%) after DNA binding
domain, is localized in the carboxy-terminal portion of the receptor and is considered to be
sufficient for ligand recognition and ligand-dependent transcriptional activation. The
transcriptional response to hormones or antihormones is rooted in conformational changes
induced by specifically bound ligands. The ligand-binding pockets of the subtypes are
similar, but not identical, ER~ being smaller (390 A3) than ERa (490 A3
) and differing in
two residues from ERa: Leu-384 and Met-421 in ERa are replaced by Met-336 and lle-373,
respectively in ER~ (Pike et ai., 1999) and these two substitutions give rise to the selectivity
of ligands for ERa or ER~. Both receptor subtypes are considered to have a similar affinity
for E2. However, many antiestrogens and phytoestrogens, like genistein, display receptor
selective affinity and biological character (Kuiper et ai., 1997). ERa and ER~ have distinct
functions and differential expression in certain tissues. These differences stimulated the
search for ER subtype-selective ligands. Therapeutically, such ligands offer the potential to
target specific tissues or pathways regulated by one receptor subtype without affecting the
other.
Being associated to a broad spectrum of diseases which includes breast cancer,
prostate cancer, endometrial carcinoma, osteoporosis and leukemia, ERa and ER~ are
considered to comprise a very important class of drug targets (Riggs and Hartmann, 2003).
Many of the ER ligands have formed the basis of the therapy for a number of endocrine
disorders. Raloxifene (Delmas et ai., 1997) and toremifene are therapeutically established
anti-estrogens, available for prevention of osteoporosis and treatment of advanced hormone
sensitive breast cancer. Tamoxifen (Jordan and Morrow, 1999) is preferrably used for the
treatment of breast carcinoma. Another SERM ormeloxifene is a well known anti-
91
![Page 3: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/3.jpg)
Chapter III
implantation agent (Blesson et aI., 2006) while clomifene serves as fertility inducing agent
(Jimenez et aI., 1997).
Traditional drug discovery programs for ER modulators often involve the use of a
receptor-binding assay as a primary screen to identify high-affinity ligands, followed by the
use of in vitro cell based assays, specifically the transcriptional activation assays with
reporter proteins and animal cell proliferation assays (Joyeux et aI., 1997), to determine the
functional activity of a given ligand (McDonnell, 2006). Relatively newer techniques
employed to study various aspects of receptor ligand interaction include hydrogen/deuterium
exchange, mass spectrometry (Yan et aI., 2006; Dai et aI., 2008), and Fluorescent Resonance
Energy Transfer (FRET) between fluorescent protein-tagged ERs in living cells (Bai and
Giguere, 2003; Kim et aI., 2005; Padron et aI., 2007). Tamrazi et aI., (2003) have
demonstrated the changes in protein dynamics during ER modulation These approaches,
however, are generally complex, time-consuming and expensive, and thus not preferred for
the construction of high-throughput screening systems.
The use of mammalian (Kumar and Chambon, 1988), bacterial, yeast (Metzger et
al., 1988) expression systems, vaccinia virus expression system (Mackett et aI., 1984) and
cell-free in vitro translation systems (Lees et aI., 1989a, 1989b; Kuiper et aI., 1997) in the
production of functional recombinant ERs is very well documented in the literature. Apart
from this, the baculovirus system for expression of heterologous proteins in insect cells is
also known to be employed (Obourn et aI., 1993), which utilizes gene transfer by infection
of host cells with a modified virus that acts as excellent tools for gene delivery.
Nevertheless, the use of viral delivery systems may suffer from lengthy construction time
requiring transfection steps, cloning of producer cell lines to generate virus stocks, stock
amplification and purification. It is well documented that many mechanisms involved in
adenovirus infection such as cell membrane adhesion and entry, viral genome replication,
translation and host inflammatory response modulate several host cell signaling pathways
which therefore may interfere with functional mechanisms in study (Suomalainen et al.,
2001).
The steroid receptors have been notoriously difficult proteins to express at high
levels in all expression systems (Srinivasan, 1992; Mossakowska, 1998). The ligand binding
pockets of ERs as well as the coactivator binding sites on the surface of LBDs have
significant hydrophobic character. As a result, theses receptors are prone to aggregate during
purification. Such proteins tend to be present in inclusion bodies and are not in their native,
functionally active conformation and biologically active proteins have to be recovered from
92
![Page 4: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/4.jpg)
Chapter III
these inclusion bodies by solubilization using detergents in chaotropic buffer systems,
followed by refolding under dilute protein concentration (Clark, 2001). Bacterial expression
systems utilizing multi-copy plasmids and strong, inducible promoters are most useful for
obtaining high yields of recombinant proteins. However the whole nuclear receptor proteins
cannot attain structural modifications required for structural integrity and functional activity
when expressed in prokaryotic system. The modular structure of these receptor allows the
use of LBD as a convenient model for studying the impact that ligand binding exerts upon
protein higher order structure (Hsieh et aI., 2006). Earlier, overexpressed ERLBD proteins
have been utilized to get the insight of the molecular mechanism of the hormone action and
also to deduce the basis of receptor agonism and antagonism (Brzozowski et aI., 1997).
Earlier other investigators have overexpressed the ER LBDs in E.coli and also confinfirmed
its structural integrity by mass spectroscopy as well as by determining the crystal structure of
expressed LBDs (Witkowska et aI., 1997; Eiler et aI., 2001; Nygaard and Harlow, 2001).
Based on these observations, the bacterially expressed LBDs, if obtained in solubilized form,
could be utilized to develop screening method for ER ligands
In the present study, we have overexpressed the LBDs of human ERa and human
ER~ in E. coli expression host and isolated the recombinant proteins in soluble form (-8-10%
of total cell protein) and the method does not require the use of detergent. Here, we have
developed this system as a method of screening with a view to identify the ERa and ERj3
specific ligands. Both the crude protein preparation as well as the purified protein were
assayed for the purpose. This method appears to be extremely useful in accelerating the lead
identification process by simple in vitro binding assays, and may also help to design and
synthesize the isoforms specific molecules, allowing new drugs to be identified more rapidly
and cost effectively.
5.2. Material and methods
Chemicals
All bacterial culture, cell culture and SDS-P AGE reagents were purchased from
Sigma, USA, unless otherwise stated. Anti-his antibody and vectors pET21b and pET28c
were obtained from Novagen, Germany. Gel extraction kit and miniprep kit was obtained
from QIAgen, USA. Reverse transcriptase PCR kit, PCR master mix, Restriction enzymes,
Prestained molecular weight markers and DNA ladders were purchased from Fermentas,
93
![Page 5: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/5.jpg)
Chapter III
USA. Reagents for western blot and Ni2+-NTA chelating sepharose were obtained from GE
healthcare" UK.
Primers were synthesized from GenoSys Bangalore, India
Raloxifene, 1, 3, 5-Tris (4-Hydroxyphenyl)-4-propyl-1H-pyrazole (PPT), 17~
Estardiol, Progesterone and Tamoxifen were purchased from Sigma, USA. ICI 182, 780 was
purchased from Tocris, Ellisville, MO, USA. Ormeloxifene was synthesized and kindly
provided by the medicinal chemists of C.D.R.I. Lucknow, India.
[2,4,6,7)H] Oestradiol (Specific activity-89 Cilrnmol) were obtained from GE
healthcare (Amersham), UK.
5.2.1. Cloning of the ligand binding domain of the human estrogen receptor a and P in the pET based bacterial expression vector
For the expression of the ligand binding domain (LBD) of human Estrogen receptor
a and ~, bacterial expression vectors pE121b and pE128c respectively were used. Both of
these vectors allow expression of the proteins and add a carboxy terminal 6XHis tag to them.
The cDNA used to amplify ERa was obtained by RT-PCR amplification of total RNA from
MCF-7 cell line. DNA fragment encoding the LBD of ERa (295 aa) or ER~ (288 aa) was
generated by PCR and were sub cloned into the pE121 b plasmid. PCR amplification was
done using the oligonucleotides with sequences 5' ATGGATCCT AAGAAGAACAGCCTG
3' and 5' TGAATTCTCAGACTGTGGCAGGGAA 3', containing BamHI (underlined
nucleotides) restriction site in forward primer and EcoRl site in reverse primer at their 5'
end. PCR parameters were 30 cycles of predenaturation at 95° C for 2 min, denaturation at
94° C for 1 min, annealing at 61 ° C for 30 sec, and extension at 72° C for 2 min; the last
cycle was delayed for 10 min. LBD of ER~ was sub cloned from the plasmid pSG5-ER~
(kindly gifted by Prof. M.G. Parker, Imperial Cancer Research Fund, London, UK),
encoding full length ER~. Specific primers for LBD were used which contained BamHI and
HindIII sites at 5' end in sense and antisense primers respectively for PCR amplification.
The primers used were 5' TAGGATCCGCAAGGCCAAGAGAAG 3' and 5'
GCTAAGCTTTCACTG AGACTGTGG 3'. The PCR conditions used were: 30 cycles of
predenaturation at 95° C for 3 min, denaturation at 94°C for 1 min, annealing at 66° C for 45
sec, and extension at 72° C for 45 sec and the final extension was done for 10 min at 72° C.
Both sets of primers were designed using the software "oligo". The PCR products of 886 bp
94
![Page 6: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/6.jpg)
Chapter III
(ERa-LBD) and 866 bp (ER~LBD) respectively were subsequently visualized by ethidium
bromide staining. Restriction digestion of amplified PCR products of ERa-LBD and ERfJ-
LBD as well as vectors pET21 b and pET28c (Novagen) was done separately. The digested
products were run on 1 % agarose gel and the specific bands were excised and eluted out
from gel using QIAquick PCR purification kit (Qiagen). Digested ERaLBD and ER~LBD
PCR products were then ligated into pE121 b and pE128c vector respectively. All the
digestion and ligation reactions were carried out as per standard protocol (Sambrook 1989).
The resulting constructs were transformed into Escherichia coli DH5a competent cells and
the transformants were plated on luria bertani (LB) agar plates containing 100 Jlg/ml
ampicillin (for ERaLBD-pE121b) or 50 Jlg/ml kannamycin (ER~LBD-pE128c) and
incubated overnight at 37° C. Integrity of inserts was verified by restriction digestion as well
as by sequencing.
5.2.2. Over-expression of ERa-LBD and ERP-LBD
The recombinant plasmids, ERaLBD-pET21b and ERfJLBD-pET28c were sub cloned
into E. coli strains compatible for the T7-based expression plasmids i.e. C41 (DE3), BL21
(DE3) and Rosetta strain. Overnight cultures from a single colony grown at 37° C with
shaking at 180 rpm in Luria Bertani (LB) medium containing 100 Jlg/ml ampicillin
(ERaLBD) or 50J.Lg/ml kannamycin (ER~LBD) was diluted 1:100 into fresh broth and
growth was continued at 37°C with shaking to an A600 of 0.8. The protein was
overexpressed by adding ImM IPTG (isopropyl-~ -0 thiogalactopyranoside), and grown
for further 4-12 h at three different temperatures viz. 20° C, 30° C and 37° C. The level of
inductions in whole cell lysates were monitored on a 12 % SOS-polyacrylamide
gel(Laemmli et aI., 1976).
5.2.3. Solubility optimization of ERa-LBD and ERP-LBD
To optimize the protein solubility conditions, expression of recombinant proteins in
three different hosts i.e. C41 (OE3), BL21 (OE3) and Rosetta strains of E.coli, grown at
three different temperatures i.e. 20°, 30° and 37° C for 4 to 12 h after induction with
1 mM IPTG and sonicated in different buffers containing 50 mM Tris with varying pH
95
![Page 7: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/7.jpg)
Chapter III
conditions (7.0, 7.S, 8.0) and NaCI concentration (SO mM, ISO mM, 300 mM) and adding S
mM ~-mercaptoethanol was investigated. The IPTG induced cells were harvested, sonicated
in particular buffer and were centrifuged at 14,000 rpm for IS min at 4° C in Sigma
Centrifuge 3K30 (Sigma, USA). The supernatant thus separated was run on a 12% SDS
PAGE and the protein solubility was checked in different samples prepared and the
solubility conditions were also confirmed by immunoblotting.
5.2.4. Purification of ERa-LBD and ERP-LBD
For purification, 1 L of culture induced with ImM IPTG and grown for additional 12
h, was harvested by centrifugation at 7,000 rpm for 10 min at 4° C, resuspended in the lysis
buffer A (SOmM Tris pH 7.S, SOmM NaCl, IOmM Imidazole, SmM ~-mercaptoethanol) or B
(SOmM Tris pH 7.2, ISOmM NaCl, 10mM Imidazole, S mM ~-mercaptoethanol), and was
sonicated on ice for 8 cycles with a medium-size probe (22 mm) at 20% output power, SO%
pulsar duty cycle for a pulse time of 8 min. Before lysis, protease inhibitor cocktail and 1
mM of the protease inhibitor PMSF was added to the culture. The lysate was cleared from
the cellular debris by centrifugation at 14,000 rpm for 20 min at 4°C. The supernatant was
used for the purification and was applied to a Ni2+-NTA chelating sepharose column (GE
Healthcare) pre-equilibrated with equilibration buffer. The protein was eluted using same
buffer supplemented with a linear gradient of imidazole in a stepwise manner. Fractions
containing protein were pooled after SDS-PAGE (12%) analysis and buffer exchange was
done using a Superdex S-200 (GE Healthcare, UK) gel-filtration column equilibrated with
buffer A or B supplemented with S mM EDTA. The collected protein was then concentrated
using 10 kDa cutoff centricon (Ami con) and the protein concentration was determined using
the Bradford reagent (Bradford, 1976) with bovine serum albumin as a standard. Proteins
remained stable at 4°C without degradation upto 30 days.
5.2.5. Preparation of crude protein extract
Crude cell paste containing the soluble recombinant proteins ERaLBO and ER~LBD
was prepared by culturing the ERaLBO and ER~LBD transformants under optimized
conditions and harvesting them at 7,000 rpm for 10 min at 4° C in centrifuge (Sigma, 3K30).
The cell pellets were subsequently suspended in the binding buffer C (SOmM Tris pH 7.5,
96
![Page 8: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/8.jpg)
Chapter III
10% glycerol, O.lmM butylated hydroxyanisole, 10mM ~-mercaptoethanol) at lOmI buffer/g
of cell paste, as described by (Carlson et al., 1997). ImM PM SF and protease inhibitor
cocktail was added just before use and the cell paste was sonicated on ice in the same
manner as is described above. The lysate was then centrifuged at 30,000 x g for 30 min at 4°
C to remove cellular debris and the supernatant was collected and used as ER LBD source.
5.2.6. Characterization of LBD of human ERa and ERP:
The recombinant proteins were characterized by assessing their ability to bind to
their natural ligand 17~-Estradiol, and also by investigating the binding specificity of these
proteins for different molecules. In addition, saturation ligand binding analysis was done and
the association and dissociation constants of the proteins were determined. All these assays
were conducted using crude as well as purified recombinant protein and the receptor activity
with both forms were compared.
5.2.7. Determination of dissociation constant
The recombinant proteins were over-expressed and purified as described in the
previous section. The protein concentrations in the supernatant were determined using the
Bradford reagent.. Briefly, different concentrations of eH]-E2 (0.5 nM, 1 nM, 2 nM, 4 nM, 8
nM and 16 nM) were incubated with 20 ng of purified ERaLBO or ER~LBD for 16 h at 4°C
after vortexing. Bound and free ligands were separated by adding chilled dextran coated
charcoal (DCC) and centrifuging 3,000 rpm for 15 min at 4° C. The radioactivity was
determined in the bound fraction with a Multi Purpose Scintillation Counter, (Beckman
Coulter, USA). All the incubations were performed in duplicates. Reactions for determining
non-specific binding were also set by adding 100 times unlabelled estradiol in excess.
Specific bound radioligand was calculated by subtracting nonspecifically bound cpm from
total bound cpm. Bound and free radioactivity was estimated and the total eH]-E2 added
versus specifically bound 3H-E2 was plotted to get the saturation curve. Saturation curve was
plotted with the crude protein preparation (10 Ilg/ reaction) as well. The dissociation constant
(Kd) of each purified protein was calculated from the Scatchard plot of specific binding data
by determining the slope (Scatchard G 1949).
97
![Page 9: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/9.jpg)
Chapter III
5.2.8. Assessment of ligand binding specificity
The ligand specificity of the recombinant proteins, both in purified as well as crude
extract was determined using competitive binding method. 3H-E2 was allowed to compete
with the unlabelled ligands in the presence of either the crude protein preparation or purified
proteins Compounds viz. raloxifene, tamoxifen, ormeloxifene, PPT (ERa agonist), ICI 182,
780 and progesterone were included in the reaction to test their affinity towards specific
subtype of ER. The compounds were dissolved in dimethyl formamide (DMF) for making
stock solution of ImM and a series of dilutions were prepared in TEAB (10 mM Tris-HCl,
pH 7.2,1.5 mM EDTA, 0.02 % sodium azide, 0.01 % BSA): DMF (1:1) of each compound.
100 Jll of protein prepearation (containing O.IJlg protein) was incubated with 3.5 nM of 3H
E2 in the absence or presence of various concentrations of compounds, for 18 h at 4° C.
Different concentrations of various compounds were incubated with either ERaLBO or
ER~LBD for 18 h at 4° C. The bound and unbound 3H-E2 were separated using DCC at 4° C
as described above. The radioactivity was determined in the bound fraction with a Multi
Purpose Scintillation Counter, (Beckman Coulter, USA). All the incubations were performed
in duplicates. Percent 3H-E2 binding activity was plotted against log values of molar
concentrations of competitor. The relative binding affinity (RBA) was then calculated as the
ratio of concentration of unlabelled estradiol required for 50% 3H -E2 binding to the
concentration of test compound required for 50% 3H-E2 binding and expressed as percentage
of estradiol-17~.
5.3. Results
5.3.1. Cloning and over-expression of ERaLBD and ERPLBD:
ERaLBD and ER~LBD were cloned in vector pE121b and pE128c respectively,
both of which add a hexahistidine tag at the carboxy terminal (Fig. 5.1A and B). Of the
gradient of IPTG concentration used (0.3 mM to 1 mM) for induction, at 1 mM IPTG
concentration expression of both ERaLBD and ER~LBD was highest (Fig. 5.2A and
B) irrespective of the expression host (C41, BL21 and Rosetta) and temperature (20°
C, 30° C and 37° C) examined.
98
![Page 10: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/10.jpg)
Chapter III
A B M 1 2 3 4 Mil 2 3 4 56M2
Fig.5.l. Cloning of ERaLBD (A) and ER~LBD (B) in pET expression vectors. 1% agarose gel stained with ethedium bromide is shown. (A) Lane l-BamHI and EeaR! digested vector pET21 b, Lane 2- BamHI and EeaR! digested amplified insert ERaLBD and Lane 3, 4- BamHI and EeaR! digested ERaLBD-pET21b (B) Lane I-Amplified insert ER~LBD, Lane 2- BamHI and HindIII digested vector pET28e, Lane 3-BamHI and HindIII digested vector pET28c, Lane 4-undigested vector pET28e, Lane 5-BamHI and HindIII digested ERfJLBD-pET28c, Lane 6- BamHI and HindIII digested ERfJLBD-pET28e. MI-IOO bp DNA ladder, M2-lkb DNA ladder.
A B UI I M(kDa) UI M (kDa)
.~= ~ .-~= 7lkDa
'~
_ 4S1<Da
t1';{t 35kDa
---
Fig. 5.2. SDS-PAGE analysis of over-expressed LBD peptides of ERa and ER~. A 12% polyacrylamide gel stained with Coomassie Blue is shown: Lyastes of whole cells from an overnight culture of E. eali harboring ERaLBD-pET21 b (A) and ERfJLBD-pET28e (B) expression plasmid were run on gel; UI-Uninduced whole cell lysate from an overnight culture, 1- whole cell lysate from an overnight culture following induction with 1 mM isopropyl-l-thio-~-D-galactopyranoside (IPTG); M- Prestained protein molecular weight marker.
99
![Page 11: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/11.jpg)
Chapter III
5.3.2. Solubility of ERa-LBD and ERP-LBD:
ERa-LBD and ER~-LBD were found to be most soluble when transformed into the
BL21 (DES) strain of E. coli and grown for 12 h after induction with 1 mM IPTG at 20° C.
ERaLBD was optimally soluble (-10%) in buffer A under these conditions and a prominent ~
38 kDa polypeptide was detected by SDS-P AGE in soluble fraction of IPTG induced bacteria
The solubility ofER~LBD was found to be optimum (~1O%) in the buffer B (Fig. 5.3). These
polypeptides were not detected in uninduced samples or when bacteria transformed with
plasmids (PET21 b or pET2 Be) alone were induced with IPTG.
2 3 4 5 6
ERaLBD
ER~LBD .-.~~~.~~ 37kDa
Fig. 5.3. Solubility analysis of over-expressed peptides of ERaLBD and ER~LBD as determined by immunoblotting. E.coli BL21 cells expressing either ERaLBD or ER~LBD peptides were grown for 12 h at 20° C (Lanes 1,2),30° C (Lanes 3, 4) or 37 0 C (Lanes 5,6) after induction with 1 mM IPTG. Respective pellets (Lanes 2, 4, 6) and supernatants (Lanes 1, 3, 5) were separately analyzed by western blotting using anti-his antibody.
5.3.3. Purification of ERa-LBD and ERp-LBD
Purification of the over-expressed proteins was done by the Ni affinity
chromatography and gel filtration chromatography. A linear gradient of imidazole was used
to elute protein from the Ni2+-NTA chelating sepharose column. 300 mM imidazole was
optimized for elution of ERaLBD while ER~LBD was eluted at 400 mM imidazole. Size
exclusion chromatography depicted the presence of both the proteins in dimeric form when
compared with the standards. Purity of proteins was confirmed by 12% SDS-P AGE which
showed that the preparation was essentially homogenous with respect to the ~ 38 kDa
(ERaLBD) and ~ 37 kDa (ER~LBD) polypeptide (Fig. 5.4). A single intact signal was
detected in case of both the recombinant proteins by western blot analysis using anti-his
antibody.
The recombinant proteins ERaLBD and ER~LBD were also looked for their expression
in soluble form and use of these proteins as crude preparation. Prominent presence of the
recombinant proteins ERaLBQ and ER~LBD was detected on SDS-PAGE analysis of the
100
![Page 12: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/12.jpg)
Chapter III
(crude) supernatant. (Fig. 5.5 A and B) Protein was diluted with the dilution buffer F (Buffer
C + 0.05 % yeast extract) to the required concentration used for the activity assay.
Fig. 5.4. SDS-PAGE analysis of purified ERaLBD and ER~LBD peptides. A 12% polyacrylamide gel stained with Coomassie Blue is shown. E.coli BL21 cells expressing either ERaLBD or ER~LBD peptides were grown for 12 h at 20° C after induction with 1 mM IPTG. The soluble proteins were purified by Ni NT A column and subsequently were subjected to size exclusion chromatography. Lane 1-Ni affinity purified ERaLBD, Lane 2-Ni affinity purified ER~LBD, Lane 3-ERaLBD after size exclusion chromatography, Lane 4-ER~LBD after size exclusion chromatography, M- Prestained protein molecular weight marker.
A
til I
-
M(kDa)
~124 ~ I~n
-. 35
- to
B
55
+-30
20
Fig. 5.5. SDS-PAGE analysis of crude preparation of ERaLBD and ER~LBD peptides. A 12% polyacrylamide gel stained with Coomassie Blue is shown. E.coli BL21 cells expressing individual LBD peptide were grown for 12 h at 20° C after induction with 1 mM IPTG. Protein was isolated as
described in Materials and Methods, ERaLBD (A) and ERPLBD (B) peptide samples were separated on 12 % gel and stained. UI-Soluble protein from uninduced culture, 1- Soluble protein from culture following induction with 1 mM IPTG; M- Prestained protein molecular weight marker.
101
![Page 13: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/13.jpg)
Chapter III
5.3.4. Characterization of LBD of human ERa and ERP
The functional integrity of the ligand binding domain was confirmed by investigating
its binding affinity towards 17~-Estradiol, its natural ligand. Measurements of the
equilibrium binding of the radio ligand in the presence of different concentrations of
unlabeled competitors provide readily interpretable information about the affinities of the
latter.
Linear transformation of saturation data (Fig. 5.6 and 5.7) revealed a single
population of binding sites for 17~-estradiol with a K.d (dissociation constant) of 4.20xlO-9
molesll for the ERaLBD and of 2.2xlO-9 molesll for ER~LBD, values comparable to as
described by (Parker et aI., 2000). These constants for ERaLBD and ER~LBD proteins did
not differ much when the saturation binding analyses were done using crude protein
preparations (data not shown).
4 -T8 -NS8 -S8
10 15 20
3HE2 concentration (nM)
Fig. 5.6. Scatchard analysis for estradiol binding to the purified ERaLBD peptide. A radioreceptor assay was perfonned using a range of concentration of 3HE217~-Estradiol in the presence of purified ERaLBD peptides and incubated in the presence of 100-fold excess of Ez for 18 h at 4° C. Unbound radio ligand was removed and specific bound radio ligand was calculated by subtracting nonspecific bound cpm from total bound cpm. Details given in 'Materials and Methods' section. Inset, Scatchard plot analysis of specific binding giving a Kd of 4.2 nM for ERaLBD protein.
102
![Page 14: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/14.jpg)
0.15 -:iii c: - 0.10
0.05
0.00 -----• •
o 5 10 15
3HE2 Concentration (nM)
-TB -NSB -SB
I':~) ~ lU'j • ",.] . tJ ~ • t~¥-"'·--.--.--·,.. 4.1' tJ .. U U 1 --""' 20
Chapter III
Fig. 5.7. Scatchard analysis for estradiol binding to the purified ER~LBD peptide. A radioreceptor assay was performed using a range of concentration of 3HE2l7~-Estradiol in the presence of purified peptides ER~LBD and incubated in the presence of lOO-fold excess of~ for 18 hat 4° C. Unbound radio ligand was removed and specific bound radio ligand was calculated by subtracting nonspecific bound cpm from total bound cpm. Details given in 'Materials and Methods' section. Inset, Scatchard plot analysis of specific binding giving a Kd of 2.22 nM for ER~LBD protein
Another relevant aspect of the receptor, the ligand binding specificity, was perfonned
and expressed as the relative binding affinity (RBA) with relation to 17~-Estradiol. RBA of
five anti estrogenic molecules were detennined and it was observed that both the proteins
displayed excellent ligand specificity and were comparable to that of reported previously
(Fig. 5.8A and 5.9A). RBA of a pure anti estrogen leI 182, 780 was also very high,
comparable with 17~-Estradiol, with both the ER subtypes it showed RBA of 76% and 83%
for ERaLBD and ER~LBD respectiVely. Raloxifene, a SERM showed high RBA of 66 with
ERaLBD but 10 with ER~LBD which is in agreement with the previous values as reported
(Kuiper et aI., 1998; Sibonga et aI., 1998). Onneloxifene showed almost same binding
affinity with both receptor subtypes. PPT, which is a well known ERa- specific ligand,
showed excellent binding affinity with ERaLBD, its RBA being near to 52 %. Its affinity
towards ERaLBD was more than 50 folds as compared to that with ER~. The Ki for PPT for
ERaLBD was 35 times less as compared to that for ER~LBD. Progesterone serving as a
negative control did not bind to any of the over-expressed proteins. RBA values were
determined using crude protein preparations and no significant difference was observed with
the purified peptides (Fig. 5.8B and 5.9B).
103
![Page 15: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/15.jpg)
Chapter III
A B --E2 150 150 --Rat
--ICI182.780
~ 7 --PPT ~ --Onn .... .... -- Progesterone
0) 0) C 100 c 100 ;; ;; c c iii iii tfi 50 N 50 W 1: 1:
f'J f'J
0 100 10' 1()2 105 1()4 1Q$ 10' 10-1 10° 101 1()2 10~ 10' 10! 10'
Concentration (nM) Concentration (nM)
Fig. 5.8. Competitive binding curves for the ERaLBD peptide. Competitors in a range of concentration were incubated with purified (A) or crude preparation (B) of ERaLBD in the presence
of 3.5 oM 3HEzI7~-Estradiol for 18 h at 4° C. Bound and unbound radioligand was separated and radioactivity was determined in bound fraction. Details given in 'Materials and Methods' section. The data shown represent the average of two experiments performed in duplicate.
A
-'/. .... CD c :r; c iii N W J:
I')
150
10{}
50
{}+-~--.-.--.~~~~ 10-' 1~ 1~ 102 1~ 1~ 1~ 1~
Concentration (nM)
B 150 --E2
--Ral ~
---ICl182,780 --PPT 0 -<>-Onn 0) ---Progesterone c 100 :r;
c iii N W 50 J:
f'J
Concentration (nM)
Fig. 5.9. Competitive binding curves for the ER~LBD peptide. Competitors in a range of
concentration were incubated with purified (A) or crude preparation (B) of ER~LBD in the presence
of 3.5 oM 3HEzI7~-Estradiol for 18 h at 4° C. Bound and unbound radioligand was separated and radioactivity was determined in bound fraction. Details given in 'Materials and Methods' section. The data shown represent the average of two experiments performed in duplicate.
104
![Page 16: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/16.jpg)
Chapter III
The relative binding affinity and the Ki values of various competitors for ERLBD and
ERLBD are tabulated in Table 5.1
Table 5.1. ICso and Kj values of compounds for purified estrogen receptor subtypes a and P LBDs:
ERa-LBD ERfJ-LBD Competitor
ICso RBAa Kt ICso (nM) RBAa Kjb(nM)
(nM) (nM)
l7~-Estradiol 50 100 50 100 Raloxifene 75 66 13 500 10 60
Ormeloxifene 5000 1 892 10000 0.5 1200 PPT 98 52 17 5000 1 600 ICI182,780 65 76 11 60 83 1 Progesterone ND ND ND ND ND ND
a-RBA is expressed as percent of estradiol-17P b-Ki was calculated by (Cheng and Prusoff, 1973) formula modified for receptor-mediated response by (Craig, 1993). ND-Not Detectable
5.4. Discussion
The existence of two ER subtypes provides, at least in part, an explanation for the
selective actions of estrogens in different target tissues. In fact, the high degree of
interspecies conservation of the individual ER subtypes throughout vertebrate evolution
could suggest that the basis for the selective effects of estrogens resides in the control of
different subsets of estrogen-responsive promoters by the two ER subtypes. This would
implicate differential expression of the ER subtypes in target tissues. The two subtypes have
distinct functions and are differentially expressed in certain tissues. These differences have
prompted the search for subtype-specific ligands that can elicit tissue- or cell-specific ER
activity. In particular, the dominance of ERa expression in the breast and uterus suggests
that ERp-selective ligands may offer some of the benefits of hormone replacement therapy
such as a decrease in the risk of colorectal cancer without increasing the risk of breast or
uterine cancer.
105
![Page 17: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/17.jpg)
Chapter III
Due to strong hydrophobicity in the ligand binding pockets, the proteins tend to form
aggregates (Clark, 2001) and can be recovered only using detergents which may interfere
with the receptor activity. In our study, the yield of soluble LBD peptide obtained (~ 6-8
mglliter of culture) is significantly greater than previously reported (Wooge et aI., 1992),
that can be used for a variety of biophysical studies. Although some of the hormone-binding
domains from steroid receptors have been expressed to adequate levels in E. coli, most of
these have been expressed the as inclusion bodies (Seielstad et aI., 1995). There are only a
few reports of ligand-binding domains being expressed as soluble proteins or soluble fusion
proteins in the literature (Vasina and Baneyx, 1997; Mossakowska, 1998). Our method is
especially useful as no detergent was used in order to get protein in soluble fraction. The
solubility of the over-expressed protein was also confirmed by performing the western blot
using anti-his antibody directed against the hexahistidine tag present at the carboxy terminal
of both the recombinant proteins which revealed the presence of single band in both the cell
pellet and the soluble form (Fig. 5.3A and B). Size exclusion data depicted the presence of
both LBD peptides in dimeric state. This finding has been reported by Brandt and Vickery,
(1997) who suggested that the dimer formation in isolated LBD does not require ligand
binding. In addition, RXR-a HBD peptide crystallized as a dimer (Bourguet et aI., 1995).
In this report, we have used LBD of ER subtypes, overexpressed in bacteria, for
examining the ligand binding affinity and to check whether the isolated LBD could be used
for the purpose. We observed that the LBD preparations were able to bind the ER ligands
specifically and displayed the binding affinity with different ligands comparable to that with
the previous reports (Kuiper et al., 1997; Kuiper et aI., 1998). This observation is in
accordance with the study done by Eilers et aI., (1989) who described that the chimeric
constructs containing ER fragments display hormonal regulation suggesting that, even when
removed from its normal environment, the LBD is" not only capable of specific ligand
binding, but may also retain the capacity to undergo the conformational changes that
normally regulate the function of the receptor. Both the proteins showed high affinity low
capacity binding to estradiol. In competitive binding assay, ICI 182, 780 showed maximum
RBA followed by raloxifene by both ERaLBD and ER~LBD peptides. High affinity binding
of ERa specific ligand, PPT was observed with ERaLBD which showed almost 50 times
less affinity with ER~LBD. Our receptor binding data correlated well with that reported in
literature, thereby validating the structural integrity and functionality of the recombinant
106
![Page 18: 5. CHAPTER ITI - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/13536/9/09_chapter 5.pdf · Another SERM ormeloxifene is a well known anti-91 . Chapter III implantation agent](https://reader033.vdocuments.mx/reader033/viewer/2022050314/5f761dd153c2b4446c03b7bf/html5/thumbnails/18.jpg)
Chapter III
proteins being expressed (Kuiper et aI., 1997; Kuiper et aI., 1998; Sibonga et aI., 1998;
Parker et aI., 2000).
In conclusion, we have demonstrated a method in which the LBDs of ER were
produced in E.coli where they were present in the soluble fraction. Since, both the crude
protein preparation as well as the purified protein was examined for any difference in
activity and no significant difference was observed between the two, it is possible to conduct
the screening procedure with the crude protein preparation also, thereby saving time. After
harvesting, the cells over-expressing the recombinant proteins can be stored at _200 C for
about a month and at _800 C for much longer period without loss in activity of the protein.
Purified recombinant protein can also be stored frozen in -800 C without any detectable
alterations in in vitro assays. For storage particularly at _200 C, stabilizing excipient like
glycerol was included in the buffer. These excipients provide protection against damage to
the protein that can occur during freeze-thaw cycles. The isolated protein was also stable at
these temperatures for a month. Furthermore, this procedure does not require the use of
denaturants. We suggest the use of these proteins for routine screening of novel molecules
and is well suited for the purpose as both purification as well as the assay can be performed
in two days. The final product is active in in vitro assays which confirms that the process is
capable of preserving the receptor integrity.
107