4543 (1): 001 036 articlemolevol.cmima.csic.es/ribera/pdfs/fresneda_etal2019_speonemadus.pdf ·...

ZOOTAXA

ISSN 1175-5326 (print edition)

ISSN 1175-5334 (online edition)Copyright © 2019 Magnolia Press

Zootaxa 4543 (1): 001–036

https://www.mapress.com/j/zt/Article

https://doi.org/10.11646/zootaxa.4543.1.1

http://zoobank.org/urn:lsid:zoobank.org:pub:31ABFA6E-6126-4603-B84F-4BEC7632D1E8

A molecular phylogeny of Speonemadus Jeannel, 1922 with description of

two new species from Morocco (Coleoptera: Leiodidae: Cholevinae: Anemadini)

JAVIER FRESNEDA1,4,5, ARNAUD FAILLE2,3, HANS FERY3, 4 & IGNACIO RIBERA2,4,5

1Ca de Massa, 25526 Llesp—El Pont de Suert, Lleida, Spain / Museu de Ciències Naturals (Zoologia), Passeig Picasso s/n, 08003

Barcelona, Spain. E-mail: [email protected] de Biologia Evolutiva (CSIC-Universitat Pompeu Fabra), Passeig Maritim de la Barceloneta 37-49, 08003 Barcelona, Spain.

E-mails: [email protected]; [email protected] State Museum of Natural History, Rosenstein 1, 70191 Stuttgart, Germany4Räuschstraße 73, D-13509 Berlin, Germany. E-mail: [email protected] authors

Abstract

The genus Speonemadus Jeannel, 1922 currently includes 12 species distributed in the Western Mediterranean (Iberian

Peninsula, North Africa, Sicily and continental Italy). Two new species are described from Morocco, S. brusteli sp. n. from

the Rif and S. comasi sp. n. from the High Atlas, the first in the S. vandalitiae-group of species and the second with an

isolated position within the genus. Two species are also resurrected from synonymy, S. pulchellus (Reitter, 1885) stat. rest.

(former synonym of S. orchesioides (Fairmaire, 1879)) and S. gracilis (Kraatz, 1870) stat. rest. (former synonym of S.

vandalitiae (Heyden, 1870)), raising the total number of species of the genus to 16. Lectotypes are designated for Ane-

madus pulchellus Reitter, 1885, and Anemadus tenuipes Peyerimhoff, 1917. A molecular phylogeny of the genus Speone-

madus is presented, based on a combination of mitochondrial and nuclear genes and including seven of the currently

recognised species, one of the newly described (S. brusteli sp. n.) and the two reinstated taxa. The genus is estimated to

have diversified from the late Miocene (Tortonian), with successive cladogenetic events related to the isolation of land-

masses between Iberia and North Africa, including the opening of the Strait of Gibraltar at the end of the Messinian. The

distribution of some of the species of Speonemadus remains still uncertain, due to their frequent misidentification and the

problems with their taxonomic status.

Key words: Speonemadus, Anemadini, Cholevinae, phylogeny, lectotype, new species, western Mediterranean

Introduction

The genus Speonemadus Jeannel, 1922 belongs to Anemadini, one of the most diverse tribes of subfamily Cholevinae, which is with ca. 1,900 species the most diverse subfamily of the staphylinoid family Leiodidae (Perreau 2000). Anemadini are currently divided into several subtribes, with an almost cosmopolitan distribution through the Holarctic, Neotropical, Oriental and Australian regions (Perreau 2000). The phylogeny of Anemadini has been rarely addressed with a comprehensive sampling, with usually only some of their genera being included in morphological or molecular phylogenies (Giachino & Vailati 1993; Fresneda et al. 2011), the most comprehensive being the recent morphological phylogeny of Antunes-Carvalho et al. (in press). While the monophyly of the tribe is not well established, that of some of the subtribes, such as Anemadina, is generally accepted (Antunes-Carvalho et al. in press). Anemadina includes two small genera in the Eastern Palearctic and Oriental regions, Anemadiola

Szymczakowski, 1963 (four species) and the monotypic Cholevodes Portevin, 1928, plus two more diverse Palaearctic genera, Anemadus Reitter, 1885 (33 species) and Speonemadus (12 species) (Perreau 2000, 2004; Reboleira et al. 2017).

Jeannel (1922) established Speonemadus for a group of five Iberian species of Anemadus with a particularly slender body shape and modifications of the male protibiae, as well as other secondary sexual characters.

Accepted by W. Hall: 8 Nov. 2018; published: 4 Jan. 2019 1

Subsequently, Jeannel (1936) erected a second genus, Hormosacus, for some species of Anemadus with two series of denticles into the endophallus. Giachino & Vailati (1993) synonymised Hormosacus with Speonemadus, dividing its members in four species groups: (1) the S. vandalitiae-group (three species in Iberia, Sicily and North Africa); (2) the S. clathratus-group (three species in Iberia and North Africa); (3) the S. transversostriatus-group, with a single Iberian species; (4) the three species originally included in Speonemadus by Jeannel (1922) forming the S. escalerai-group (Table 1). The genus Speonemadus was then defined by the presence of two series of sclerified denticles in the endophallus—in some species with a median denticle in ventral position—and the male protibia simple or with a carina. Subsequently to the revision of Giachino & Vailati (1993) an additional Iberian species of the S. escalerai-group was described by Reboleira et al. (2017) from Portugal. The authors also rehabilitated one Iberian species in the same group, S. breuili (Jeannel, 1922), considered to be a synonym of S.

angusticollis (Kraatz, 1870) by Giachino & Vailati (1993). The genus thus currently includes 12 species (Perreau 2004; Reboleira et al. 2017) (Table 1), and almost as many synonyms (Perreau 2004), most of them established by Giachino & Vailati (1993).

In this work we describe two new species of Speonemadus from Morocco, and present the first comprehensive molecular phylogeny of the genus including seven of the 12 known species plus one of the newly described ones. For the completion of our study we examined the types of several species of Speonemadus to clarify their identity. Molecular and morphological data led us to reinstate two species as valid currently under synonymy. The number of species of Speonemadus is thus raised to 16, of which we obtained molecular data of ten. We also designate lectotypes for Anemadus pulchellus Reitter, 1885 and Anemadus tenuipes Peyerimhoff, 1917 to fix their identity and support the stability of the nomenclature.

TABLE 1. Species recognised in the genus Speonemadus, with the morphological species groups sensu Giachino &

Vailati (1993) and Reboleira et al. (2017), and their phylogenetic placement (see Fig. 44). With question marks, species

with no molecular data, which phylogenetic placement is hypothesised based on morphological similarities.

Material and methods

Specimen sampling and morphological study. Specimens used in the study were collected by hand or by means of pitfall traps containing water saturated in salt or propylene glycol, known to preserve DNA (Rubink et al. 2003; López & Oromí 2010) (Table 2). After collection, specimens were transferred into vials containing either 70% (for morphological studies) or 96% ethanol (for DNA extraction and sequencing). Afterwards all specimens were

No species species group clade original genus

1 S. angusticollis (Kraatz, 1870) escalerai A1 Choleva

2 S. bolivari (Jeannel, 1922) escalerai A1 Anemadus

3 S. breuili (Jeannel, 1922) escalerai A1 Anemadus

4 S. algarvensis Reboleira et al. 2017 escalerai A1? Speonemadus

5 S. escalerai (Uhagón, 1898) escalerai A1? Anemadus

6 S. transversostriatus (Murray, 1856) transversostriatus A1? Catops

7 S. clathratus (Perris, 1864) clathratus A1 Catops

8 S. maroccanus (Jeannel, 1936) clathratus A2 Hormosacus

9 S. subcostatus (Reiche, 1864) clathratus A2? Choleva

10 S. brusteli sp. n. vandalitiae A2

11 S. orchesioides (Fairmaire, 1879) vandalitiae A2? Choleva

12 S. gracilis (Kraatz, 1870) stat. rest. vandalitiae B1 Choleva

13 S. tenuipes (Peyerimhoff, 1917) vandalitiae B1 Anemadus

14 S. pulchellus (Reitter, 1885) stat. rest. vandalitiae B2 Anemadus

15 S. vandalitiae (Heyden, 1870) vandalitiae B2 Catops

16 S. comasi sp. n. comasi C?

FRESNEDA ET AL.2 · Zootaxa 4543 (1) © 2019 Magnolia Press

mounted on cards for subsequent study. We dissected their genitalia and either mounted them directly in water-soluble dimethyl hydantoin formaldehyde resin (DMHF) on a transparent card or treated them with a 10% aqueous solution of KOH for six hours. After this treatment genitalia were dehydrated in a series of baths of increased ethanol concentration (60%–96%) for ca. 15', and finally let in xylene for ca. 12 hours. Genitalia were then mounted in Canada balsam on a transparent acetate card, and the card pinned together with the specimen.

Photographs of the habitus or other external structures were made with an Olympus SZX16 stereomicroscope (Olympus, Tokyo, Japan); photographs of the aedeagi were made with an Olympus CH transmission microscope. For both we used an Olympus C5060WZ digital camera to obtain serial photographs, which were subsequently stacked with CombineZP (Informer Technologies Inc., Dominica) and processed with Adobe Photoshop CS (Adobe, San José, California). Body lengths were measured between the anterior margin of the labrum and the apex of the elytra.

DNA extraction and sequencing. For DNA extraction and sequencing we used the procedure described in e.g. Ribera et al. (2010), Faille et al. (2010a, b) or Fresneda et al. (2011). Extractions of single specimens were non-destructive, using the DNeasy Tissue Kit (Qiagen GmbH, Hilden, Germany). Vouchers and DNA samples are kept in the collections of the Staatlichen Museum für Naturkunde Stuttgart (SMNS), the Institut de Biologia Evolutiva (IBE), the Muséum National d'Histoire Naturelle (MNHN) and the authors's collections.

We amplified fragments of four mitochondrial and two nuclear genes in six PCR reactions. Mitochondrial genes were 5' and 3' ends of cytochrome c oxidase subunit (cox1-5 and cox1-3 respectively); a single fragment including the 3' end of the large ribosomal unit (rrnL), the whole tRNA–Leu gene (trnL) and the 5' end of the NADH dehydrogenase 1 (nad1); an internal fragment of the cytochrome b gene (cob). The nuclear genes were internal fragments of the large and small ribosomal units (LSU and SSU respectively) (see Table 3 for details on the primers used). Sequences were assembled and edited using Sequencher TM 4.8 (Gene Codes, Inc., Ann Arbor, Michigan). New sequences (a total of 44) have been deposited in the European Molecular Biology Laboratory (EMBL) database with Accession Numbers LS999457- LS999500 (Table 2).

Phylogenetic analyses. We included in the analyses seven of the 12 described species of Speonemadus

(Perreau 2004; Reboleira et al. 2017), plus one of the two new species described here and specimens of S. gracilis

(Kraatz, 1870) and S. pulchellus (Reitter, 1885), currently considered synonyms of S. vandalitiae (Heyden, 1870) and S. orchesioides (Fairmaire, 1879) respectively (Tables 1, 2). Missing species are: (1) S. escalerai (Uhagón, 1898) (Spain), closely related to S. bolivari (Jeannel, 1922) (see Reboleira et al. 2017); (2) S. subcostatus (Reiche, 1864) (Sicily, Algeria and Tunisia), closely related to S. maroccanus (Jeannel, 1936); (3) S. algarvensis Reboleira, Fresneda & Salgado, 2017 (Portugal), closely related to S. angusticollis (see Reboleira et al. 2017); (4) S.

transversostriatus (Murray, 1856), placed in its own species group by Giachino & Vailati (1993); (5) S.

orchesioides (known with certainty from Algeria, see below), closely related to S. brusteli sp. n.; (6) the newly described S. comasi sp. n. As outgroups, and to root the tree, we used a species of Anemadus (A. hajeki Růžička & Perreau, 2017), found to be the sister genus of Speonemadus both based on morphological and molecular characters (Giachino & Vailati 1993; Fresneda et al. 2011; Antunes-Carvalho et al. in press).

We aligned the sequences using the MAFFT online v.6 and the Q–INS–i algorithm (Katoh & Toh 2008). We analysed the sequence matrix with Maximum Likelihood as implemented in the on-line version of RAxML (Stamatakis et al. 2008), using GTR+G as the evolutionary model and three partitions corresponding to the mitochondrial protein coding genes (cox1+cob+nad1), mitochondrial ribosomal (rrnL+trnL) and nuclear ribosomal (SSU and LSU). We also estimated a time calibrated tree with Bayesian probabilities in BEAST v.1.8 (Drummond & Rambaut 2007), using the same partitions and evolutionary models as in RAxML and a Yule speciation process as the tree prior. Preliminary analyses with the GTR+G models showed poor convergence due to the lack of data for some parameters, so we used a simpler HKY+G model for all partitions. Analyses were run for 100 MY generations, ensuring that the number of generations after convergence were sufficient as assessed with Tracer v1.6 (Drummond & Rambaut 2007) and after removal of the burn-in fraction. To obtain an absolute calibration we used the rates estimated in Cieslak et al. (2014) for the same subfamily (Cholevinae) and the same gene combination based on the tectonic separation of the Sardinian plate. We set uncorrelated relaxed clocks for all three partitions, with priors for evolutionary rates a normal distribution with average 0.015 substitutions/site/Myr for the mitochondrial protein genes, 0.006 for the mitochondrial ribosomal genes, and 0.004 for the nuclear ribosomal genes, all with a standard deviation of 0.001 Myr.

Zootaxa 4543 (1) © 2019 Magnolia Press · 3SYSTEMATICS OF SPEONEMADUS (LEIODIDAE)

2

umbers (in bold, newly obtained sequences).

rrnL+trnL+nad1 cob SSU LSU

HE576718 LS999499 LS999477 LS999486

GU356787 GU356836 GU356933 GU356980

LS999470 - LS999478 LS999487

LS999471 LS999496 LS999479 LS999488

LS999473 LS999500 LS999482 LS999491

LS999472 LS999494 LS999481 LS999490

HE576715 HE572886 - -

LS999474 - LS999484 LS999493

HE576699 - HE572830 HE572852

LS999476 LS999498 LS999480 LS999489

LS999475 LS999495 LS999483 LS999492

- LS999497 LS999485 -

FR

ES

NE

DA

ET

AL

.4

· Zoota

xa 4

54

3 (1

) © 2

019

Mag

nolia P

ress

TABLE 2. Material used in the molecular phylogeny of Speonemadus, with locality data and EMBL accession n No. species voucher locality cox1-5' cox1-3

1 Anemadus hajeki IBE-RA187 China: Yunnan, East slope Cangshan at Dali 19.v.2010 V.V. Grebennikov leg.

- HE572819

2 S. angusticollis MNCN-AI551 Spain: Jaén, Siles, Cueva Nacimiento de San Blas 7.vii.2002 M. Baena leg.

- GU356889

3 S. bolivari IBE-AF34 Spain: Málaga, Antequera, Cueva del Yeso III 29.iii.2008 GEV leg.

- LS999468

4 S. breuili IBE-AN464 Spain: Cádiz, Jerez-Cortes de la Frontera, Cueva Motilla Parralejo 13.ix.2009 GIEX leg.

LS999460 LS999465

5 S. brusteli IBE-AN489 Morocco: Rif, Talembote, Talassemtane 13.xi.2015 H. Brustel leg.

LS999459 LS999464

6 S. brusteli IBE-AN523 Morocco: Rif, Talembote, Talassemtane 13.xi.2015 H. Brustel leg.

LS999458 LS999463

7 S. clathratus MNCN-HI21 Spain: Jaén, Sierra de Cazorla, Linarejos 1.xi.2006 M. Baena leg.

- HE572815

8 S. gracilis IBE-RA638 Spain: Jaén, Hornos, Sima de la Tubería 28.viii.2011 GEV leg.

LS999461 LS999462

9 S. maroccanus IBE-AF215 Morocco: Taza, Ghar Chiker 4.ix.2009 A. Faille leg.

- HE572796

10 S. pulchellus IBE-AN306 Italy: Sicily, Ficuzza 25.v.2013 C. Bourdeau, A. Faille, J. Fresneda & I. Ribera leg.

LS999457 LS999466

11 S. tenuipes IBE-AN671 Algeria: Aït Abd El Ali, Ifri Semedane 23.v.2012 S. Aït-Mouloud & A. Faille leg.

- LS999467

12 S. vandalitiae IBE-AC110 Spain: Huesca, Villanúa, Cueva de Esjamundo 28.ix.2009 C. Bourdeau, A. Faille & J. Fresneda leg.

- LS999469

TABLE 3. Primers used in the amplification and sequencing reactions.

Acronyms. Institutes and collections:

CAF coll. A. Faille (France, Paris)CDO coll. Dodero (Museo Civico di Storia Naturale "G. Doria", Italy, Genova)CFL coll. J. Fresneda–A. Lagar (Spain, Llesp)CHB coll. H. Brustel (France, Toulouse)CHF coll. H. Fery (Germany, Berlin)CJMS coll. J.M. Salgado (Spain, Vigo)CMB coll. M. Blas (Spain, Barcelona)CPMG coll. P.M. Giachino (Italy, Torino)CZULE Colección de Zoología de la Universidad de León (Spain, León).GEV Grupo de Espeleología de Villacarrillo (Spain, Villacarrillo)HNHM Hungarian Natural History Museum (Hungary, Budapest)IBE Institut de Biologia Evolutiva (Spain, Barcelona)MCNA Museo de Ciencias Naturales de Álava (Spain, Vitoria).MCSNG Museo Civico di Storia Naturale "G. Doria" (Italy, Genova)MHNG Muséum d'Histoire Naturelle (Switzerland, Genève)MNCN Museo Nacional de Ciencias Naturales (Spain, Madrid)MNHN Muséum National d'Histoire Naturelle (France, Paris)MRSN Museo Regionale di Scienze Naturali (Italy, Torino)MZB Museu de Ciències Naturals (Spain, Barcelona)SDEI Senckenberg Deutsches Entomologisches Institut (Germany, Müncheberg)SMNS Staatlichen Museum für Naturkunde (Germany, Stuttgart)

Other abbreviations used in the literal transcription of the labels: [hw]: handwritten.

Gene Name Sense Sequence Reference

cox1-3 Jerry (M202) F CAACATTTATTTTGATTTTTTGG Simon et al. (1994)

Pat (M70) R TCCATGCACTAATCTGCCATATTA Simon et al. (1994)

Chy F T(A/T)GTAGCCCA(T/C)TTTCATTA(T/C)GT Ribera et al. (2010)

Tom R AC(A/G)TAATGAAA(A/G)TGGGCTAC(T/A)A Ribera et al. (2010)

Tom-2 R A(A/G)GGGAATCATTGAATAAA(A/T)CC Ribera et al. (2010)

cox1-5 LCO 1490 F GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994)

HCO 2198 R TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994)

Uni LepF1b F TAATACGACTCACTATAGGGATTCAACCAATCATAAAGATATTGGAAC

Hebert et al. (2004)

Uni LepR1 R ATTAACCCTCACTAAAGTAAACTTCTGGATGTCCAAAAAATCA

Hebert et al. (2004)

cob CB3 F GAGGAGCAACTGTAATTACTAA Barraclough et al. (1999)

CB4 R AAAAGAAA(AG)TATCATTCAGGTTGAAT Barraclough et al. (1999)

rrnL-nad1

16saR (M14) F CGCCTGTTTA(A/T)CAAAAACAT Simon et al. (1994)

16Sa R ATGTTTTTGTTAAACAGGCG Simon et al. (1994)

16Sb R CCGGTCTGAACTCAGATCATGT Simon et al. (1994)

16SAlf1 R GCATCACAAAAAGGCTGAGG Vogler et al. (1993)

ND1A (M223)

R GGTCCCTTACGAATTTGAATATATCCT Simon et al. (1994)

SSU 5' F GACAACCTGGTTGATCCTGCCAGT Shull et al. (2001)

b5.0 R TAACCGCAACAACTTTAAT Shull et al. (2001)

LSU Ka F ACACGGACCAAGGAGTCTAGCATG Ribera et al. (2010)

Kb R CGTCCTGCTGTCTTAAGTTAC Ribera et al. (2010)


Taxonomy

Speonemadus brusteli sp. n.

Figs 1, 6, 14

Type locality: Morocco, Talembote, Moroccan fir (Abies marocana) forest of Talassemtane, 35°5'N 5°8'W, 1400 m.

Type series: Holotype: ♂: "Hervé Brustel leg. / MO Rif Talembote / (Sapinière) Talassemtane / 10/13 XI 2015" [printed], "HOLOTYPUS / Speonemadus / brusteli sp. n. / JF-AF-HF-IR det. 2016" [red label, hw]; aedeagus mounted in Canada balsam on a transparent microslide pinned with the specimen (MNHN). Paratypes: 15 exs, same labels as holotype, except "PARATYPUS" instead of "HOLOTYPUS" (CAF, CFL, CHB, CHF; IBE). Two paratypes were used for DNA extraction and sequencing, with voucher numbers IBE-AN489 and IBE-AN523 respectively. Extracted specimens and DNA aliquots deposited in the IBE.

Description of the holotype: Habitus as in Fig. 1. Body length 2.3 mm. Body shape elongate; colouration of body reddish-brownish, somewhat depigmented. Head. Eyes well developed; surface with dense punctation; suture between epistome and frons visible; antennomeres VII–XI forming a lose club, antennomeres VIII–X clearly transverse. Pronotum transverse (maximum width 0.9 mm; maximum length 0.6 mm); sides more arcuate posteriad; base straight, slightly wider than base of elytra; surface with dense, rough punctation. Elytra. Elongate, broadening posteriad in first third of length, then regularly tapering towards apex; with parasutural striae. Transverse striola on elytra broad and widely spaced. Legs. All tarsi pentamerous; protibiae simple; pro- and mesotibia slightly dilated; first three protarsomeres and first two mesotarsomeres dilated. Male genitalia (Fig. 6). Aedeagus slightly curved towards ventral side; basal lamina of median lobe longer than apical part; parameres much longer than median lobe, with straight basal part, but apical third bent inwards with strong angle; apical third broader in middle region, tapering towards apex, here provided with a triangular expansion on external side; apex of parameres with three setae, without conical spine (Fig. 14). Median lobe in dorsal view with broad, short apex. Endophallus with two series of sclerotised denticles, not joined in apical part, forming an apical dent.

Females similar to males except for pro- and mesotibiae, which are thinner; pro- and mesotarsi not dilated.Etymology. The species is dedicated to our friend and colleague Hervé Brustel, from l'Ecole d'Ingénieurs de

PURPAN (France, Toulouse). The species name is a noun in the genitive case.Remarks. According to the morphology and in particular to the aedeagus, Speonemadus brusteli sp. n. is

included in the S. vandalitiae-group of Giachino & Vailati (1993), near S. orchesioides. This group is characterised by: transverse pronotum, with dense to rugose punctation; transverse striola on the elytra either fine and dense or thick and sparse; protibiae simple; sutural angle of elytra rounded in both sexes; parameres much longer than median lobe, with 3–5 apical setae and without conical spine (Figs 13, 15–18); endophallus with two series of sclerotised denticles, without apical indentation. The species of the group are externally very homogeneous, and can only be separated by the study of the aedeagus (Giachino & Vailati 1993). The general structure of the aedeagus is similar to that of S. orchesioides (Fig. 5). However, the dilated apex of the parameres with a triangular expansion on the external side clearly separates S. brusteli sp. n. from this species, which has simple parameres (Fig. 13). The expansion on the apex of the median lobe is also regularly arched in S. brusteli sp. n. (Fig. 6), but roughly pentagonal in S. orchesioides (Fig. 5). Molecular data place S. brusteli sp. n. as sister to S. maroccanus, with a considerably different aedeagus and included in the clathratus-group sensu Giachino & Vailati (1993).

Distribution (Fig. 38). So far only known from the type locality in the Rif chain, Morocco.

Speonemadus comasi sp. n.

Figs 2, 3, 12, 27

Type locality: Morocco, Tagelft, Iri Adar Nyighil, 32°10'N 5°57'W, 2250 m (Fig. 45).


FIGURES 1–2. Habitus of the holotypes of: (1) Speonemadus brusteli sp. n.; (2) S. comasi sp. n.

Holotype: ♂, "Iri Adar Nyighil / -Tagelft- Marroc / 9-VII-2005 / Fadrique- [hw] / Auroux-Comas Leg." [printed], "HOLOTYPUS / Speonemadus / comasi sp. n. / JF-AF-HF-IR det. 2017" [red label, hw] (MZB).

Description of the holotype: Habitus as in Fig. 2. Body length 3.6 mm. Body shape elongate, colour brown-reddish, darker on head and pronotal disk. Head with eyes well developed, with visible suture between epistome and frons; surface with coarse, dense punctation; antennomeres VII–XI forming a loose club, antennomere X as long as wide. Pronotum transverse (maximum width 1.3 mm; maximum length 0.8 mm), sides strongly arched, still more strongly posteriorly; base of pronotum sinuate, as wide as base of elytra; surface with coarse, dense and rough punctation. Elytra very elongate, wider in basal third, regularly tapered towards apex; with parasutural stria; surface with fine and sparse transverse striolae. Legs with pentamerous tarsi; protibiae sinuate, more strongly on inner side (Fig. 3); mesotibiae less sinuate, more regularly curved; first three tarsomeres of protarsi and first two


tarsomeres of mesotarsi dilated. Male genitalia (Fig. 12). Basal lamina of aedeagus as long as apical part; parameres about as long as median lobe; median lobe in dorsal view with sides slightly sinuate, regularly tapering towards apex; apex with small, rounded extension; basal 2/3 of parameres straight, apical third with external side strongly dilated, narrowing towards apex; apex with triangular expansion on external side, with four fine setae and without conical spine (Fig. 27); endophallus entirely covered with scales and spines, with two dark parallel longitudinal bands scarcely noticeable.

FIGURES 3–4. Protibia of: (3) holotype of Speonemadus comasi sp. n.; (4) S. angusticollis (Rute, Spain).

Females unknown.Etymology. The species is dedicated to our friend and colleague Jordi Comas (Spain, Barcelona), one of the

collectors of the only known specimen of this most interesting species. The specific name is a substantive in the genitive case.

Remarks. Speonemadus comasi sp. n. is a peculiar species, with characters similar to both Speonemadus and Anemadus. The general slender habitus and the modified protibiae are similar to the species of the escalerai-group (e.g. S. angusticollis, Fig. 4), and the shape of the parameres with their triangular apical expansion is similar to that of S. brusteli sp. n. of the vandalitiae-group. However, the endophallus is similar to that of the species of Anemadus, without well defined groups of spines, such as those to the loebli-group (e.g. A. loebli Giachino & Vailati, 1993, from Turkey) or the strigosus-group (e.g. A. strigosus (Kraatz, 1852) from Czech Republic, Austria, Italy, Romania, Croatia, Bosnia-Herzegovina, Montenegro and Greece, A. bianchii Reitter, 1906 from Italy or A.


arcadius Reitter, 1885 from Greece). In addition to the morphological characters, the distribution of the species supports its inclusion in Speonemadus, as species of Anemadus are found from Italy (including Sicily) and southern France to the East, reaching China (Perreau 2004). In fact, this is one of the westernmost species of Speonemadus, with other species of the genus distributed further east except for some dubious records of S. tenuipes in the High Atlas (see below).

Distribution (Fig. 38). So far only known from the type locality in Morocco.

FIGURES 5–6. Aedeagi in ventral view of: (5) Speonemadus. orchesioides (Ammi-Moussa, Algeria); (6) holotype of S.

brusteli sp. n. (Talembote, Morocco).


FIGURES 7–9. Aedeagi in ventral view of: (7) S. gracilis (Hornos, Spain); (8) Lectotype of S. tenuipes (Zaccar, Algeria); (9)S. tenuipes (Djurdjura, Algeria).


FIGURES 10–11. Aedeagi in ventral view of: (10) S. vandalitiae (Villanúa, Spain); (11) S. pulchellus (Ficuzza, Sicily).

Speonemadus gracilis (Kraatz, 1870) stat. rest.

Figs 7, 15, 29

Choleva gracilis Kraatz, 1870: 99.Anemadus vandalitiae (Heyden); Reitter 1885: 60 (partim)

Type locality: "bei Cordova" [= near Córdoba], Spain (Kraatz 1870).Type series: Lectotype (Fig. 29): ♂, "Cordoba Dieck" [hw ?], "Syntypus" [red label], "gracilis Kraatz 1870,

Cordoba Dieck" [hw Kraatz], "(Anemadus), Hormosacus, vandalitiae Heyd., det K. Sokolowski" [first and last line


printed, second and third line hw Sokolowski], "Coll. Kraatz", "DEI Eberswalde", "Lectotypus ♂, Choleva gracilis Kraatz, P. M. Giachino & D. Vailati des. 1992" [red label, printed] (SDEI). Aedeagus dissected and mounted on the same card. Originally only the median lobe of the lectotype was dissected and glued on the card behind the specimen. A detailed observation revealed that a large part of the abdomen was detached from the body, so that most likely the median lobe was extracted through the anterior opening of the abdomen, leaving the parameres inside the apex. The inspection of the apex of the abdomen revealed that effectively the parameres were still in place, so they were dissected and mounted separately.

FIGURE 12. Aedeagus in ventral view of: the holotype of S. comasi sp. n.


FIGURES 13–28. Apex of the parameres of: (13) Speonemadus orchesioides (Ammi-Moussa, Algeria); (14) holotype of S.

brusteli sp. n. (Talembote, Morocco); (15) S. gracilis (Hornos, Spain); (16) S. tenuipes (Ifri Semedane, Algeria); (17) S.

vandalitiae (Villanúa, Spain); (18) S. pulchellus (Ficuzza, Sicily); (19) holotype of S. algarvensis (Gruta do Vale Telheiro, Portugal); (20) S. angusticollis (Rute, Spain); (21) S. bolivari (Ardales, Spain); (22) S. breuili (Motillas, Spain); (23) S.

escalerai (Jumilla, Spain); (24) S. transversostriatus (La Bastida, Spain); (25) S. clathratus (Linarejos, Spain); (26) S.

maroccanus (Taza, Morocco); (27) holotype of S. comasi sp. n. (Tagelft, Morocco); (28) Anemadus hajeki (Yunnan, China).


FIGURE 29. Lectotype of Choleva gracilis (scale bar: specimen, 2 mm; aedeagus, 0.6 mm).


FIGURE 30. Lectotype of Choleva orchesioides (scale bar: 2 mm).

FIGURES 31–33. Labels of the paralectotypes of Choleva orchesioides.


FIGURE 34. Lectotype of Anemadus pulchellus (scale bar: specimen, 2 mm; aedeagus, 0.3 mm).

Remarks. Since Reitter (1885: 60) the species was considered to be a synonym of S. vandalitiae, but, in addition to the differences revealed by the molecular data (see below), there are also some clear morphological differences based on the study of the lectotype of S. vandalitiae: (1) in S. gracilis the external side of the protibiae has no nodules and the setae are inserted directly on the tegument; in S. vandalitiae the external side of the protibiae has a series of minute nodules with setae inserted on them; (2) in S. gracilis the antennomeres VIII–XI are longer than wide, while in S. vandalitiae they are transverse, almost as wide as long; (3) in S. gracilis the apex of the parameres is more pointed than in S. vandalitiae (compare Figs 15, 17). In both species the parameres are slender and much longer than the median lobe (compare Figs 7, 10). In S. gracilis the apex of the median lobe is also more elongate, with subparallel margins, while in S. vandalitiae it is shorter and with obtuse margins. Molecular data place S. gracilis as sister to S. tenuipes and not to S. vandalitiae.

Distribution (Fig. 39; Appendix). Iberian endemic. The only published data under the name S. gracilis was the


type locality (near Córdoba) in the original description (Kraatz 1870). All subsequent records were published under S. vandalitiae (e.g. Ribera 1970; Blas 1976, 1977, 1979; Tinaut 1998; Pérez & Tinaut 2005; Pérez & Pérez 2006; Fresneda et al. 2007; Sáez & Blanco 2010; Pérez 2015; Fresneda & Salgado 2017). We have seen material from Albacete, Badajoz, Córdoba, Cuenca, Jaén, Madrid, Málaga, Murcia and Valencia, through the Betic Sierras, Sierra Morena, the Iberian System, the Tajo basin, and the Central System (Guadarrama). Its precise distribution is still unknown, as some records under S. vandalitiae may correspond to this species. Thus, there are unchecked records of S. vandalitiae or S. gracilis from Álava, Asturias, Ávila, Badajoz, Cádiz, Cantabria, Córdoba, La Coruña, Cuenca, Granada, Jaén, León, Lugo, Madrid, Orense, Palencia, Rioja, Segovia, Soria, Tarragona, Teruel, Valencia and from the Balearic Islands (Mallorca); from Portugal in Beira Alta, Beira Litoral and Trás-os-Montes (Heyden 1881; Reitter 1885; Uhagón 1890, 1898; Fuente 1925; Martínez de la Escalera 1927; Jeannel 1936; Seabra 1943; Cobos 1954; Coiffait 1954; Ribera 1970; Blas 1976, 1977, 1979, 1981a, 1981b, 1984, 1985, 1992; Salgado 1985, 1996; Tizado et al. 1995; Salgado & Fernández 1998; Tinaut 1998; Tizado & Salgado 2000; Pérez & Tinaut 2005; Pérez & Pérez 2006; Agirre & Blas 2009; Sáez & Blanco 2010; Fresneda et al. 2007, 2011; Fresneda 2013; Pérez et al. 2013; Faria e Silva et al. 2013; Pérez 2015; Fresneda & Salgado 2017) (see the Appendix for more details on the localities).

Speonemadus orchesioides (Fairmaire, 1879)

Figs 5, 13, 30

Choleva orchesioides Fairmaire, 1879: 165.Anemadus orchesioides (Fairmaire); Reitter 1885: 61.Hormosacus orchesioides (Fairmaire); Jeannel 1936: 213.Hormosacus vandalitiae Jeannel; Blas 1984: 252 (partim).Speonemadus orchesioides (Fairmaire); Giachino & Vailati 1993: 174 (partim).

Type locality: Algeria, "Daya, province d'Oran" (Fairmaire 1879).Type series. Lectotype (Fig. 30): ♀, "orchesioides / Fairm. / Daya, Oran / Bedel / typ." [hw], "Syntypus" [red

label, printed], "coll. L. v. Heyden / DEI Eberswalde" (printed), "Lectotypus ♀ / Choleva / orchesioides Fairmaire /, P. M. GIACHINO & / D. Vailati des. 1992" [red label, printed] (SDEI). We have found four specimens in the general collection of the MNHN that should be considered paralectotypes, with data: (1) 1 ♀, "Choleva / orchesioides / Frm. Daya" [hw Fairmaire], "MUSEUM PARIS / COLL. L. FAIRMAIRE 1906" [green label, printed], "TYPE" [red label, printed], "PARALECTOTYPUS [printed] / Choleva / orchesioides [hw]" [red label], (coll. générale in MNHN) (Fig. 31); (2) 1 ♀, "Choleva / orchesioïdes / Fairm . type / Daya" [hw, Fairmaire], "MUSEUM PARIS / COLL. ABEILLE DE PERRIN / 1919" [green label, printed], "TYPE" [printed in red], "Daya" [hw Jeannel], "PARALECTOTYPUS [printed] / Choleva / orchesioides [hw]" [red label], (coll. générale MNHN) (Fig. 32); (3&4) 2 ♀♀ on the same pin, "MUSEUM PARIS / COLL. ABEILLE DE PERRIN / 1919" [green label, printed], "Daya" [hw Jeannel], "PARALECTOTYPUS [printed] / Choleva / orchesioides [hw]" [red label] (coll. générale in MNHN) (Fig. 33).

Diagnosis. The species is characterised by: parameres simple, apex acute, only slightly turned outwards (Fig. 13); apex of median lobe roughly pentagonal (Fig. 5). The most similar species seems to be S. brusteli sp. n. (see the description of this species above).

Remarks. The type series of S. orchesioides is divided between the SDEI (lectotype) and the MNHN (four paralectotypes). All five specimens are females, so males of the species had to be identified from non-typical material. We consider that the male specimen figured by Jeannel (1936) from Ammi-Moussa (a locality ca. 80 km east of Daya, the type locality) belongs to this species. This specimen and a microscopic slide with its dissected aedeagus are deposited in the general collection of the MNHN; the slide is labelled with Jeannel's manuscript handwritting "Hormosacus / tenuipes Peyer. / orchesioides Frm. / Ammi-moussa", "org. cop. [= organe copulateur] ♂". The same preparation has the aedeagus of a specimen of S. tenuipes from the same locality. Note: A specimen figured by Giachino & Vailati (1993) as S. orchesioides is from Djebel Babor, some 600 km east of Daya, a considerable distance from the type locality, and representing a different species (S. pulchellus, see below).

Distribution (Fig. 38; Appendix). Algeria (Tell Atlas) (Fairmaire 1879; Reitter 1885; Jeannel 1936; Giachino & Vailati 1993; Perreau 2000, 2004; Salgado et al. 2008). The records from the Iberian Peninsula, Fuente (1925)


and Seabra (1943) for Portugal, and Giachino & Vailati (1993) for Spain, are unreliable; it seems likely that they should be referred to S. gracilis (see Discussion below). According to Giachino & Vailati (1993), the record of S.

orchesioides from continental Italy by Jeannel (1936) ("Abruzzes: Gran Sasso, une femelle (Schatzmayr!)") is doubtful. However, this record was confirmed by newly obtained material from different provinces in continental Italy by Fabbri & Zoia (1996) and Giachino & Vailati (2000, 2007), as well as specimens in the SMNS (see Appdenxi), still identified as S. orchesioides. These records likely correspond to S. pulchellus (P.M. Giachino, personal communication 2018; see below under S. pulchellus). The same happens with all the records from the Aurès mountains in Algeria and Tunisia (Jeannel 1936) and the Eastern half of Algeria (Giachino 1985). The records from the Moroccan Rif (Jeannel 1936) may correspond to S. brusteli sp. n., but the identity of those from the Middle Atlas, also in Morocco (Giachino & Vailati 1993), is unknown.

FIGURE 35. Paralectotypes of Anemadus pulchellus.

Speonemadus pulchellus (Reitter, 1885) stat. rest.

Figs 11, 18, 34, 35

Anemadus pulchellus Reitter, 1885: 59.Speonemadus orchesioides pulchellus (Reitter); Jeannel 1936: 214


Hormosacus vandalitiae Jeannel; Blas 1984: 252 (partim).Speonemadus orchesioides (Fairmaire); Giachino & Vailati 1993: 174 (partim).

Type locality: "Sicilien" [= Sicily], Italy (Reitter 1885).Type series. Lectotype (by present designation) (Fig. 34): ♂, "pulchellus / m. [= mihi] Sicilien" [hw Reitter],

"coll. Reitter" [printed], "HOLOTYPUS 1884 / Anemadus / pulchellus Reitter" [red label, printed], "LECTOTYPUS / Anemadus / pulchellus Reitter, 1885 / Fresneda et al. des. 2018" [red label, printed] (HNHM); aedeagus mounted on a glue card on the same pin. Paralectotypes (Fig. 35): four specimens mounted on a single pin with five cards (one of the specimens is lost), "A. pulchellus / m. Sicilien" [hw Reitter], "155" [printed], "TYPE" [red label, printed], "MUSEUM PARIS / (COLL. E. REITTER) / A. GROUVELLE 1913" [printed], "pulchellus / Reitt." [hw], "PARALECTOTYPUS / Anemadus / pulchellus Reitter, 1885 / Fresneda et al. des. 2018" [red label, printed] (coll. générale in MNHN).

Diagnosis. Length 2.8–2.9 mm; elytra regularly narrowing towards apex; external face of protibiae without tubercles, with setae directly inserted in tegument; antennomeres VIII–XI longer than wide; parameres very robust, slightly longer than apex of median lobe, with rounded apex (Fig. 18); apex of median lobe regularly arched (Fig. 11). Molecular data place S. pulchellus as sister species of S. vandalitiae.

Remarks. Speonemadus pulchellus was considered to be a subspecies of S. orchesioides by Jeannel (1936: 214), and a synonym by Giachino & Vailati (1993). All the studied and figured specimens of Speonemadus from Sicily (see Appendix) share a more or less similar aedeagus, which is also similar to that of the specimen from Djebel Babor figured by Giachino & Vailati (1993) as S. orchesioides, and that we consider to belong to S.

pulchellus. There are some small differences in the apex of the aedeagus of the specimens from Ficuzza (Appendix), which are slightly more rounded than those of the lectotype. We consider these differences as intraspecific variation, although the study of additional material may prove the existence of consistent variation deserving taxonomic recognition. In any case, the aedeagi of the material considered under the name S. pulchellus

are clearly different to that of the male identified as S. orchesioides by us (from Ammi-Moussa, see above) (Figs 5, 13 and 11, 18 respectively).

Distribution (Fig. 38; Appendix): Italy (including Sicily), Eastern Algeria and likely Tunisia.

Speonemadus tenuipes (Peyerimhoff, 1917)

Figs 8, 9, 16, 36

Anemadus tenuipes Peyerimhoff, 1917: 130.Hormosacus tenuipes (Peyerimhoff); Jeannel 1936: 214.Hormosacus vandalitiae Jeannel; Blas 1984: 252 (partim).Speonemadus tenuipes (Peyerimhoff); Giachino & Vailati 1993: 179.

Type locality. Algérie, massif du Zaccar (see lectotype designation below).Type series. Lectotype (by present designation) (Fig. 36): ♂, "Mt Zackar / fin nov. 99" [= end of November

1899] [hw in red], "tenuitarsis / type ♂" [hw Peyerimhoff], "LECTOTYPUS / Anemadus / tenuipes Peyer. 1917 / Fresneda et al. des. 2017" [red label, hw Fresneda] (coll. Peyerimhoff in MNHN), aedeagus mounted on a transparent card on the same pin (coll. Peyerimhoff in MNHN). Paralectotypes: 1 ♂, "crête du / Djurdjura" [printed], "Anemadus / tenuitarsis / Peyer. type" [hw Peyerimhoff], aedeagus mounted on a transparent card on the same pin. 3 exs. on the same pin (2 ♀♀ + 1 ex. eaten in part by Anthrenus), "Garh [?] el Kef / [?]1,XII,05" [hw] / "massif des / mouzaia" [printed], "Anemadus / tenuitarsis / Peyer. types" [hw Peyerimhoff]. 1 ex.: "Les Mouzaïa / fin mars 05[?]" [hw]. 1 ♂ "En Nouaduir[?] / Ouarsenis / avril 1914" [hw], "Speonemadus / orchesioides Fairmaire / Fresneda det. 2017". All paralectotypes in coll. Peyerimhoff (MNHN) and with an additional label "PARALECTOTYPUS / Anemadus / tenuipes Peyer. 1917 / Fresneda et al. des. 2017" [red label, hw Fresneda].Note: The male paralectotype labelled "En Nouaduir [?] / Ouarsenis / avril 1914" actually belongs to S.

orchesioides.Diagnosis. Length 2.8–2.9 mm; elytra strongly narrowing towards apex; external face of protibia granulated,

with setae inserted in small tubercles; antennomeres VIII-XI longer than wide; parameres wide, robust and sinuated, with notch at external margin and acuminate apex (Fig. 16); apex of median lobe simple, regularly


rounded, without expansion (Fig. 8). Molecular data show that S. tenuipes is the sister species of S. gracilis. The aedeagi of the two species have a similar structure (Figs 7, 8), although the apex of the median lobe of S. gracilis

has an elongated expansion and the parameres are more slender, with the distal part straight.

FIGURE 36. Lectotype of Anemadus tenuipes.

Remarks. There is some morphological variability among the specimens forming the type series of S.

tenuipes. The aedeagus of one specimen from "crête du Djurdjura" (MNHN, coll. Peyerimhoff, labelled as "type" by the hand of Peyerimhoff), even if corresponding to the general morphology of the lectotype (Fig. 9), has distinctly less sinuate parameres, the notch on the external side of the parameres is less marked (only clearly visible in the left paramere), the apical section of the paramere is shorter than that of the lectotype from Zaccar, the apex of the median lobe of the aedeagus is more rounded, almost truncated. Other studied specimens from Ifri Semedane, Ammi-Moussa, Mouzaia (a possible but dubious syntype from the general collection of the MNHN, not considered here as part of the type series), plus those from the Akfadou and Gerrouch forests (Giachino & Vailati 1993: figs 320, 321), have an aedeagus identical to that of the lectotype. Being found in a single specimen we have considered these differences to be intraspecific variation, but future studies may demonstrate that the Ifri Semedane population represent a separate species.

Distribution (Fig. 38; Appendix). Found in the Tell Atlas, from the wilayah [= province] of Jijel in the northeast of Algeria, close to Oran in the west (Jeannel 1936; Szymczakowski 1970; Giachino 1985; Giachino & Vailati 1993). It has also been recorded from the Middle and High Atlas in Morocco (Peyerimhoff 1917), although the identity of these specimens is doubtful.

Speonemadus vandalitiae (Heyden, 1870)

Figs 10, 17, 37

Catops vandalitiae Heyden, 1870: 97.Ptomaphagus vandalitiae (Heyden); Heyden 1883: 368.Anemadus vandalitiae (Heyden): Uhagón 1890: 32.Hormosacus vandalitiae (Heyden); Jeannel 1936: 214.Hormosacus vandalitiae pyrenaeus Jeannel (1936: 214); Blas 1984: 252 (synonymy)Hormosacus vandalitiae pyrenaeus Jeannel; Speonemadus vandalitiae (Heyden); Giachino & Vailati 1993: 183.

Type locality. "Sierra della Nieve prope Ronda Andalusiae" (Heyden 1870), Spain.


FIGURE 37. Lectotype of Catops vandalitiae (scale bar: specimen, 2 mm; aedeagus, 0.3 mm).

Lectotype (Fig. 37): ♂, "Ronda, Heyden" [hw L. von Heyden], "Syntypus" [red, printed], microscopic slide with aedeagus and "1563" [hw], "Coll. L. v. Heyden, DEI Eberswalde" [printed], "Lectotypus ♂, Catops Vandalitiae Heyden, P. M. Giachino & D. Vailati des. 1992" [red, printed] (SDEI).

Diagnosis. Apex of median lobe acuminated (Fig. 10); parameres very long, forming a marked angle, with apex round and expansion on inner side (Fig. 17) (see other characters under S. gracilis, see above). Molecular data place S. vandalitiae as sister species of S. pulchellus; although both species belong to the vandalitiae-group sensu

Giachino & Vailati (1993), their aedeagi are considerably different (compare Figs 10 and 11), with much shorter and robust parameres relative to the length of the median lobe in S. pulchellus.


Distribution (Fig. 39; Appendix). Iberian Peninsula, extending to the French Pyrenees (Jeannel 1936; Giachino & Vailati 1993; Perreau 2000, 2004; Salgado et al. 2008; Agirre & Blas 2009; Fresneda & Salgado 2017). In Spain there are records from Albacete, Ciudad Real, Granada, Huesca and Madrid (Fresneda et al. 2007), Málaga (Heyden 1870; Fuente 1925; Giachino & Vailati 1993), Murcia (Fresneda et al. 2007), Tarragona and Toledo; and in France from Basses-Pyrénées (Jeannel 1936). However, some of these records may refer to S.

gracilis, which has been considered to be a synonym of S. vandalitiae since Reitter (1885) (see section 3.3. above).

FIGURE 38. Distribution maps of: (38) Speonemadus brusteli sp. n., S. comasi sp. n., S. orchesioides, S. pulchellus, S.

tenuipes (empty circles are dubious records of which no material could be studied; the records from continental Italy, given originally as S. orchesoides, are considered S. pulchellus, P.M. Giachino, personal communication 2018; see main text). See Appendix for detailed locality data.

Molecular phylogeny of Speonemadus

The trees obtained with RAxML and BEAST had identical topologies, with very good support (boostrap support values, bs > 70% and Bayesian posterior probabilities, pp > 0.95) for almost all nodes (Fig. 44). Only the internal relationships of the clade formed by S. angusticollis, S. bolivari and S. breuili were poorly supported in both analyses, but these are closely related species estimated to be of Late Pleistocene origin.

The crown age of Speonemadus was estimated to be of Tortonian origin (11–10 Ma, Fig. 42), with a first split between two clades (clade A and B in Fig. 44) each of them including species from the Iberian Peninsula and North Africa. Clade B had a subsequent split during the Messinian giving rise again to lineages with both Iberian and North African species (clades B1 and B2, Fig. 44). However, the next three cladogenetic processes were estimated to have happened around the end of the Messinian salinity crisis, and having separated lineages occurring exclusively on the Iberian Peninsula from lineages occurring exclusively in North Africa, with the only exception of S. maroccanus which is recorded from both sides of the Strait of Gibraltar (Coiffait 1954; Blas 1976, 1977; Fresneda et al. 2007; Fig. 43). Speonemadus orchesioides has also been recorded from the Iberian Peninsula and North Africa, but most likely the Iberian records of S. orchesioides correspond to other species of the genus (see above), as this species seems to be restricted to the mountains east of the river Moulouya.


FIGURE 39. Distribution maps of: (39) S. gracilis, S. vandalitiae. See Appendix for detailed locality data.

Thus, clade A was divided into: (1) clade A1, including S. clathratus (Perris, 1864) and the sampled species of the S. escalerai-group of Giachino & Vailati (1993) (S. breuili, S. angusticollis and S. bolivari), all of them exclusively Iberian (Fresneda & Salgado 2017); (2) clade A2, including S. brusteli sp. n. and S. maroccanus, both occurring in Morocco but the latter also in the extreme south Spain (Coiffait 1954; Blas 1976, 1977; Fresneda et al.

2007; Fresneda & Salgado 2017) (Fig. 44).Clade B1 was divided into the Iberian S. gracilis and S. tenuipes, found in Algeria and Morocco. Clade B2 was

divided into S. vandalitiae from the Iberian Peninsula (including the French Pyrenees) and S. pulchellus, present in North Africa and Sicily (Giachino & Vailati 1993; Fresneda & Salgado 2017 as S. orchesioides, see above).

Discussion

Of the two newly described species of Speonemadus, S. brusteli sp. n. is clearly related to the species of the S.

vandalitiae-group, both according to the morphological and molecular data. The affinities of S. comasi sp. n. are, however, more uncertain, as there are no molecular data available, and the morphological affinities are also unclear. According to some morphological characters it seems possible that it represents an intermediate grade between Anemadus and Speonemadus. As noted in the Introduction, Jeannel (1922) established Speonemadus for a group of species of Anemadus with a well-defined morphology and distribution (Iberian Peninsula and North Africa), in contrast with the more variable and widely distributed remaining species of Anemadus. This suggests the possibility that Speonemadus is a derived clade within Anemadus, with S. comasi sp. n. as sister to the rest of the species of Speonemadus and providing a link to Anemadus. However, there is also the possibility that the similarities of the endophallus are a plesiomorphic character of the clade Speonemadus + Anemadus, which may be


the sister taxa of S. comasi sp. n. included in Speonemadus. It would clearly be desirable to have fresh material of S. comasi sp. n. to obtain molecular data, but this appears as an unlikely possibility in the near future. Iri Adar Nyighil was a small cavity on soil (Fig. 45), next to an unpaved road between Tagelft and Anergui (Morocco). The specimen was collected with the use of pitfall traps placed inside the cavity during a period of 48 hours. In a subsequent visit in 2012 the cavity had been destroyed due to the extension of the road (F. Fadrique, personal communication 2017). Iri Adar Nyighil was certainly not the only place where the species lived, but the capture of more specimens may require extensive deep pitfall sampling in the area, something not easily achievable.

The identity and relationships of the other species of the genus Speonemadus seems to be relatively well established, mostly based on the male genitalia and the molecular data presented here. There remain, however, some uncertainties in the distribution of some of the species, partly derived from the taxonomic confusion previous to the revision of Giachino & Vailati (1993). Blas (1984) did not recognise differences between the aedeagi of S.

vandalitiae, S. orchesioides and S. tenuipes, synonymising them under S. vandalitiae and by this preventing the correct identification of some Iberian records.

FIGURES 40–41. Palaeomaps with the reconstructed evolution of the distribution of Anemadus and Speonemadus at: (40) 18 Ma, Burdigalian; (41) 15 Ma, Langhian; (after Jolivet et al. 2006, modified).


FIGURES 42–43. Palaeomaps with the reconstructed evolution of the distribution of Anemadus and Speonemadus at: (42) 10 Ma, Late Serravallian-Tortonian; (43) 6–5.33 Ma Late Messinian, (after Jolivet et al. 2006, modified).

The identity of S. orchesioides was further obscured by the differences between the aedeagi figured by Jeannel (1936: figs 425–426), more similar to the Iberian S. gracilis (Fig. 7), and those in Giachino & Vailati (1993: figs 308, 315–317).

Jeannel (1936) recorded S. orchesioides from Ifri Semedane, and subsequently also Giachino & Vailati (1993) recorded this species from the same locality from specimens in Dodero's collection. However, here we found that the specimens we could study from Ifri Semedane (voucher IBE-AN671) corresponded to S. tenuipes, with an aedeagus similar to that of the lectotype here designated (Fig. 8).

Both the type locality of S. orchesioides (Daya) and the paralectotypes of S. tenuipes (massifs du Zaccar) are in the Tell Atlas, so it is likely that other records of both species within the same mountain massif are accurate. However, the records from the Aurès mountains and from Sicily should likely be referred to S. pulchellus. Similarly, among all the studied Iberian Speonemadus we have never seen any true S. orchesioides, and we have doubts about the presence of this species in the Iberian Peninsula. It seems likely that the Iberian records of S.

orchesioides should be referred to S. gracilis, which until now was considered a synonym of S. vandalitiae. The records of S. tenuipes and S. orchesioides from the Moroccan High and Middle Atlas are also dubious. The description of two new species west of the Moulouya valley (S. brusteli sp. n. and S. comasi sp. n.) opens the possibility that previous records from the area may actually refer to any of them. For S. tenuipes there is a gap of ca. 700 km between the closest localities in Morocco (Middle Atlas) and Algeria (Zaccar and Mouzaïa mountains), both separated by the arid valley of the Moulouya river. It seems plausible to hypothesise that S. tenuipes may be distributed through the forest areas east of the Moulouya (the Tell Atlas), while S. brusteli sp. n. may occupy the mountains west of the river (Rif, High and Middle Atlas). The Oued Moulouya and its basin suffered strong


environmental fluctuations, including marine transgressions, during the Pliocene, and are a well-documented biogeographic barrier for different groups of North African organisms, especially amphibians and reptiles (Arano et al. 1998; Zangari et al. 2006; Recuero et al. 2007; Paulo et al. 2008; Beukema et al. 2010; Velo-Antón et al. 2012). Among the species of Speonemadus there is a second case of vicariance at both sides of the Moulouya river: S. subcostatus is found in the Tellian Atlas of Algeria, while its likely sister species, S. maroccanus (extremely close morphologically, even in the aedeagus), is found in the Rif and the Iberian Betic mountains (Giachino & Vailati 1993).

FIGURE 44. Majority rule consensus tree obtained with BEAST, with the reconstructed phylogeny of Speonemadus. Numbers in nodes: above the branch, posterior probability / maximum likelihood bootstrap; below, estimated age (Ma). Blue bars in nodes, 95% confidence interval of the estimated age.

Phylogeny of Speonemadus

After the description of the two new species and the reinstatement of S. gracilis and S. pulchellus, the genus Speonemadus adds to 16 species, of which our molecular phylogeny includes ten (Tables 1, 2). Other than the newly described S. comasi sp. n., S. transversostriatus is a missing species with an uncertain phylogenetic position, the only member of its species group sensu Giachino & Vailati (1993). These authors did not include S.


transversostriatus in the escalerai-group due to some differences in the sexual dimorphism of males: they have simple protibiae, without the characteristic keel of the species of the escalerai-group (Reboleira et al. 2017). However, all other characters agree with the typical morphology of the escalerai-group: elytral sculpture of "type c", median lobe of the aedeagus bottle-shaped, parameres of the aedeagus only shortly longer than the median lobe (Giachino & Vailati 1993), and females with elytral apex more acute than males (strongly acute and with a cleavage in the females of the escalerai-group, Blas 1984). It seems thus likely that S. transversostriatus is either sister or within the clade formed by the species of the S. escalerai-group. The other four missing species (S. escalerai, S.

algarvensis, S. orchesioides and S. subcostatus) are morphologically very close to some species included in the phylogeny, as already noted.

Of the species groups defined in Giachino & Vailati (1993), we recovered as monophyletic the studied species of the escalerai- and vandalitiae-groups. However, according to the characters used to define the vandalitiae-group the newly described S. brusteli sp. n. should have been included in it, but we recovered it as sister to S.

maroccanus, which belongs to the clathratus-group. Some of the characters used to define species groups were reconstructed as having been independently gained in different species. The thick and blunt setae (the "spine") on the ventral side of the apex of the parameres (Figs 19–26) is a derived state of clade A, present in S. maroccanus

(Fig. 26), in the species of the S. escalerai-group (Figs 19–23) including S. transversostriatus (Fig. 24) and in S.

clathratus (Fig. 25). According to our reconstruction the "spine" was secondarily lost in S. brusteli sp. n. and its likely sister S. orchesioides, and it is primarily absent in clade B and in Anemadus (Fig. 28).

The shortening of the parameres from the apparent plesiomorphic condition of being much longer than the median lobe has occurred independently in S. maroccanus and the S. escalerai and S. clathratus-groups. Other characters used by Giachino & Vailati (1993), such as the presence of more or less developed striae on the elytral disc, are difficult to define precisely. Despite their usefulness in identifying the species of the genus, our results suggest that the species groups defined within Speonemadus are in need of revision.

Biogeography of Speonemadus

The estimated phylogeny of Speonemadus and the current distribution of the species are in agreement with the palaeogeography of the Betic-Rifean area during the Miocene (Figs 40–43), as happens with other subterranean groups in the area (e.g. the ground beetle Trechus fulvus-group, Faille et al. 2014). The geographic origin of the genus Speonemadus cannot be unambiguously reconstructed, but considering the distribution of the presumed sister genus Anemadus (Palaearctic, mostly from Italy to the eastern Mediterranean and with species until Japan; see Perreau 2000), the origin is likely the western Palaearctic. Most Mediterranean islands are populated by species of Anemadus (Corsica, Sardinia, Cyprus and some Greek Islands), which may have a late Messinian origin although there is no available phylogenetic data for the species.

We estimated a crown age of Speonemadus of ca. 10–11 Ma, with a split from the sampled Anemadus at ca. 15 Ma (Figs 40–41). This excludes the possibility of a colonisation of North Africa from Europe through the tectonic rafting of the Kabylian plates, which started to drift from the Iberian Peninsula at ca. 33 Ma, keeping some contact with the plates of the Balearic and Alboran islands until 26 Ma (Rosenbaum et al. 2002; Schettino & Turco 2006). Assuming a northern Mediterranean (i.e. European) origin of the genus, the separation between the ancestor of Speonemadus and Anemadus could have been mediated by the isolating effect of the Pyrenean chain (which was already formed by the late Oligocene, at ca. 23 Ma, ISC 2017) or, more likely, by the opening of the Rhone-Provençal basin (the "Basin miocène rhodano-provençal", BMRP, of Besson 2005). The BMRP bordered the north side of the Alps from Marseille to Vienna (Meulenkamp & Sissingh 2003; Besson 2005), with the stronger fluvial erosion dating from the Burdigalian (Fig. 40), and a marine transgression inundating the region from the Langhian (Fig. 41). This is in agreement with the hypotheseis of Giachino & Vailati (1993) of a separation between Anemadus and Speonemadus during the late Miocene at both sides of the BMRP.

The first cladogenesis separating the two basal clades of Speonemadus (A and B) was estimated to have occurred in the Tortonian (ca. 10.5 Ma) (Fig. 42). Subsequently, in the early Messinian (ca. 6.5 Ma), a further split separated clades B1 and B2 (Fig. 43). Each of these three clades has species both on the Iberian Peninsula and in North Africa. During the Tortonian and early Messinian the isolation of the highly dynamic Betic microplates has been hypothesised to have promoted the diversification of some groups (e.g. Hydrochidae water beetles, Hidalgo-


Galiana & Ribera 2011, or Mesocarabus and Trechus ground beetles, Andújar et al. 2012 and Faille et al. 2014, respectively); this could also have been the case in Speonemadus, with the isolation of three lineages (A, B1 and B2) either in Iberia, North Africa or some of the Betic-Rifean plates. During the salinity crisis of the late Messinian all these areas became united, likely allowing the expansion of the species through the Strait of Gibraltar. The re-opening of the Gibraltar strait at the end of the Messinian salinity crisis 5.33 Ma (García-Castellanos et al. 2009) isolated the Iberian from the North African populations of these three widespread ancestral Speonemadus, resulting in an almost simultaneous split into three clades: (1) clade A, the Iberian S. clathratus and the species of the S.

escalerai-group vs. the North African S. brusteli sp. n. and S. maroccanus (plus most likely S. orchesioides and S.

subcostatus); (2) clade B1, the Iberian S. gracilis vs. the North African S. tenuipes; (3) clade B2, the Iberian S.

vandalitiae vs. the North African S. pulchellus.This scenario would require the colonisation of south Iberia by S. maroccanus during the Pleistocene, and of

Sicily—and possible continental Italy—during the Plio-Pleistocene. There is no information on the timing of these colonisations, they may have been related to the climatic fluctuations during the Pliocene, with first a temperature and precipitation higher than at present (Dowsett et al. 1999; Haywood et al. 2000) and then the establishment of the Mediterranean climate at ca. 3.2 Ma (Suc 1984), or they may have been facilitated by the descent of the sea level during the Pleistocene glaciations.

Within the Iberian Peninsula, in the late Pliocene S. clathratus may have been isolated from the ancestor of the S. escalerai-group by the Gualdalquivir valley, either due to the onset of the Mediterranean climate or by the marine transgressions and inland seas that inundated most of the valley until the Middle Pleistocene (Torres et al. 2003). The increased seasonality and aridification, as well as the Pleistocene glaciations and the associated climatic changes, may have limited the surface movement of some species of Speonemadus, promoting the isolation of peripheral populations in the subterranean medium and giving origin to the current species of the S. escalerai-group.

FIGURE 45. Type locality of Speonemadus comasi n. sp., Iri Adar Nyighil, Tagelft, Morocco (photo: J. Comas).


Acknowledgments

We thank our friends and colleagues Hervé Brustel (Toulouse) and Jordi Comas (Barcelona) for allowing us to study their most interesting material, as well as the other collectors mentioned in Table 2. We also thank Toni Pérez (Grupo de Espeleología Villacarrillo, Jaén, Spain) for sending specimens for study, Lutz Behne (SDEI, Müncheberg, Germany), Ottó Merkl (HNHM, Budapest) and Azadeh Taghavian and Antoine Mantilleri (MNHN, Paris) for their help, Ana Izquierdo (MNCN) and Anabela Cardoso (IBE) for laboratory work, and Pier Mauro Giachino (Torino) for useful comments to the manuscript. Molecular work was partly funded by projects CGL2013-48950-C2-1-P and CGL2016-76705-P (AEI/FEDER, UE) to IR.

References

Agirre, E. & Blas, M. (2009) Estudio de los Cholevinae (Coleoptera: Leiodidae) de las Sierras de Ancares y del Caurel (Noroeste de la Península Ibérica). Elytron, 22–23 (2008–2009), 87–98.

Andújar, C., Gómez-Zurita, J., Rasplus, J.-Y. & Serrano, J. (2012) Molecular systematics and evolution of the subgenus Mesocarabus Thomson, 1875 (Coleoptera: Carabidae: Carabus), based on mitochondrial and nuclear DNA. Zoological

Journal of the Linnean Society, 166, 787–804.https://doi.org/10.1111/j.1096-3642.2012.00866.x

Antunes-Carvalho, C., Ribera, I., Beutel, R.G. & Gnaspini, P. (2018) Morphology-based phylogenetic reconstruction of Cholevinae (Coleoptera: Leiodidae): a new view on higher-level relationships. Cladistics. [published online] https://doi.org/10.1111/cla.12230

Arano, B., Llorente, G.A., Montori, A., Buckley, D. & Herrero, P. (1998) Diversification in North-West African water frogs: molecular and morphological evidence. Herpetological Journal, 8, 57–64.

Barraclough, T.G., Hogan, J.E. & Vogler, A.P. (1999) Testing whether ecological factors promote cladogenesis in a group of tiger beetles (Coleoptera: Cicindelidae). Proceedings of the Royal Society B, Biological Sciences, 266, 1061–1067.https://doi.org/10.1098/rspb.1999.0744

Besson, D. (2005) Architecture du bassin rhodano-provencal miocène (Alpes, SE France): relations entre déformation,

physiographie et sédimentation dans un bassin molassique d'avant-pays. Paris, École Nationale Supérieure des Mines de Paris, 438 pp.

Beukema, W., De Pous, Ph., Donaire, D., Escoriza, D., Bogaerts, S., Toxopeus, A.G., De Bie, C.A.J.M., Roca, J. & Carranza, S. (2010) Biogeography and contemporary climatic differentiation among Moroccan Salamandra algira. Biological Journal

of the Linnean Society, 101, 626–641.https://doi.org/10.1111/j.1095-8312.2010.01506.x

Blas, M. (1976) Coleópteros cavernícolas del distrito andaluz (Catopidae). Actas 4 Congreso Nacional de Espeleología. Nerja,

Málaga, 1976, 157–160.Blas, M. (1977) Contribución al conocimiento de los Anemadinae de la Península Ibérica. (Col. Catopidae). Comunicacions 6è

Simposium d'Espeleologia: Bioespeleologia, Terrassa, 1977, 125–130.Blas, M. (1979) Contribución al conocimiento de los Catopidae (excepto la subfam. Bathysciinae) de la Península Ibérica

(Coleoptera Staphylinoidea). Unpublished PhD thesis, Universidad de Barcelona, Barcelona, 361 pp.Blas, M. (1981a) Sobre la presencia de Hormosacus vandalitiae (Heyden, 1870) en la isla de Mallorca. (Col. Catopidae).

Rapport Communications Internationales Mer Méditerranée, 27 (9), 87–88.Blas, M. (1981b) La subfamilia Anemadinae Jeannel (Col. Catopidae) i llur distribució geográfica actual. Treballs de

l'Institució Catalana d'Història Natural, 9, 155–156.Blas, M. (1984) El género Hormosacus Jeannel, 1936 y su distribución geográfica. (Col. Catopidae). Mémoires de

Biospéologie, 11, 251–255.Blas, M. (1985) Sobre los Catopidae de Portugal (Coleoptera). Suplemento 1. Boletim da Sociedade Portuguesa de

Entomologia, 1985, 169–176.Blas, M. (1992) Nuevos datos sobre los Cholevidae (Col.) de las Islas Baleares. Elytron, 6, 159–162.Cieslak, A., Fresneda, J. & Ribera, I. (2014) Life-history specialization was not an evolutionary dead-end in Pyrenean cave

beetles. Proceedings of the Royal Society B, Biological Sciences, 281, 20132978. https://doi.org/10.1098/rspb.2013.2978

Cobos, A. (1954) Una breve campaña entomológica por las sierras de Tejeda y Almijara (Provincia de Málaga): Ins. Coleópteros. Archivos del Instituto de Aclimatación de Almería, 2, 81–88.

Coiffait, H. (1954) Catopidés récoltés en Andalousie. Description de trois formes nouvelles. Notes Biospéologiques, 9 (1), 21–24.

Dowsett, H., Barron, J.A., Poore, R.Z., Thompson, R.S., Cronin, T.M., Ishman, S.E. & Willard, D.A. (1999) Middle Pliocene

paleoenvironmental reconstruction: PRISM2. U.S. Geological Survey Open File Report 99–535.

https://doi.org/10.3133/ofr99535Drummond, A.J. & Rambaut, A. (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary


Biology, 7, 214.https://doi.org/10.1186/1471-2148-7-214

Fabbri, R.A. & Zoia, S. (1996) Segnalazioni faunistiche n° 10—Speonemadus orchesioides (Fairmaire, 1879) (Insecta, Coleoptera, Cholevidae). Quaderni di Studi e Notizie di Storia Naturale della Romagna, 6, 78.

Faille, A., Andújar, C., Fadrique, F. & Ribera, I. (2014) Late Miocene origin of an Ibero-Maghrebian clade of ground beetles with multiple colonizations of the subterranean environment. Journal of Biogeography, 41, 1979–1990.https://doi.org/10.1111/jbi.12349

Faille, A., Bourdeau, C. & Fresneda, J. (2010b) A new species of blind Trechinae from the Pyrenees of Huesca, and its position within Aphaenops (sensu stricto) (Coleoptera: Carabidae: Trechini). Zootaxa, 2566, 49–56.

Faille, A., Ribera, I., Deharveng, L., Bourdeau, C., Garnery, L., Quéinnec, E. & Deuve, T. (2010a) A molecular phylogeny shows the single origin of the Pyrenean subterranean Trechini ground beetles (Coleoptera: Carabidae). Molecular

Phylogenetics and Evolution, 54, 97–105.https://doi.org/10.1016/j.ympev.2009.10.008

Fairmaire, L. (1879) Descriptions de coléoptères nouveaux du nord de l'Afrique. Annales de la Société Entomologique de

France, 5ème Série, 9, 155–172.Faria e Silva, I., Salgado, J.M. & Serrano, A.R.M. (2013) New data on the Cholevidae (Coleoptera) from Portugal. Graellsia,

69, 45–56. https://doi.org/10.3989/graellsia.2013.v69.078

Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3, 294–299.

Fresneda, J. (2013) Los leiódidos (Coleoptera, Leiodidae) subterráneos de Jaén In: Pérez Fernández, T. & Pérez Ruiz, A. (Eds.), Los invertebrados de hábitats subterráneos de Jaén. Grupo de Espeleología de Villacarrillo, Jaén, pp. 164–175.

Fresneda, J., Cárdenas, A.M., Castro, A., Lencina, J.L., López-Colón, J.I. & Baena, M. (2007) Nuevos datos de los Cholevidae en la Península Ibérica (Coleoptera). Boletín de la Asociación Española de Entomología, 31, 187–214.

Fresneda, J., Grebennikov, V. & Ribera, I. (2011) The phylogenetic and geographic limits of Leptodirini (Coleoptera: Leiodidae: Cholevinae), with a description of Sciaphyes shestakovi sp.n. from the Russian Far East. Arthropods

Systematics & Phylogeny, 69, 99–123.Fresneda, J. & Salgado, J.M. (2017) Catálogo de los coleópteros Leiodidae Cholevinae Kirby, 1837 de la península Ibérica e

islas Baleares. Monografies del Museu de Ciències Naturals, 7 (2016), 1–308.Fuente, J.M. de la (1925) Catálogo sistemático-geográfico de los coleópteros observados en la península Ibérica, Pirineos

propiamente dichos y Baleares. Boletín de la Real Sociedad Entomológica de España, 7 (2–3), 93–117. [1924]García-Castellanos, D., Estrada, F., Jiménez-Munt, I., Gorini, C., Fernández, M., Vergés, J. & Vicente, R. de (2009)

Catastrophic flood of the Mediterranean after the Messinian salinity crisis. Nature, 462, 778–781.https://doi.org/10.1038/nature08555

Giachino, P.M. (1985) Choleva (s. str.) gabriellae e Sciodrepoides casalei nuove specie della Kabylia e note corologiche sui Catopidi d'Algeria (Coleoptera, Catopidae). Bollettino del Museo Regionale di Scienze Naturali, Torino, 3, 337–348.

Giachino, P.M. & Vailati, D. (1993) Revisione degli Anemadinae. Monografie di "Natura Bresciana" No. 18. Museo Cívico di Scienze Naturali di Brescia, Brescia, 314 pp.

Giachino, P.M. & Vailati, D. (2000) Nuovi dati sugli Anemadinae con descrizione di Anemadus whiteheadi sp. n. (Coleotera Cholevidae). Elytron, 14, 119–124.

Giachino, P.M. & Vailati, D. (2007) I Coleotteri Cholevidi dell’Appennino settentrionale e centrale: inventario, analisi faunistica e origine del popolamento (Coleoptera Cholevidae). Biogeographia, 28, 365–420.

Haywood, A.M., Sellwood, B.W. & Valdes, P.J. (2000) Regional warming: Pliocene (3Ma) paleoclimate of Europe and the Mediterranean. Geology, 28, 1063–1066. https://doi.org/10.1130/0091-7613(2000)28%3C1063:RWPMPO%3E2.0.CO;2

Hebert, P.D.N., Penton, E.H., Burns, J.M., Janzen, D.H. & Hallwachs, W. (2004) Ten species in one: DNA barcoding reveals cryptic species in the Neotropical skipper butterfly Astraptes fulgerator. Proceedings of the National Academy of Sciences

of the United States of America, 101, 14812–14817.https://doi.org/10.1073/pnas.0406166101

Heyden, L. von (1870) Catops Vandalitiae Heyd. nov. sp. In: Heyden, L. von, Entomologische Reise nach dem südlichen

Spanien, der Sierra Guadarrama und Sierra Morena, Portugal und den Cantabrischen Gebirgen. Mit Beschreibungen der

neuen Arten. Nicolaische Verlagsbuchhandlung, Berlin, pp. 97–98.Heyden, L. von (1881) Zweites Verzeichniss von Coleopteren aus Asturien. Deutsche Entomologische Zeitschrift, 25, 241–246.Heyden, L. von (1883) Zwei neue Käfer von Creta. Deutsche Entomologische Zeitschrift, 27, 368. Hidalgo-Galiana, A. & Ribera, I. (2011) Late Miocene diversification of the genus Hydrochus (Coleoptera, Hydrochidae) in the

west Mediterranean area. Molecular Phylogenetics and Evolution, 59, 377–385.https://doi.org/10.1016/j.ympev.2011.01.018

ISC (2017) International Chronostratigraphic Chart. Version 2017/02. International Commission on Stratigraphy. Available from: http://www.stratigraphy.org (accessed 9 May 2018)

Jeannel, R. (1922) Silphidae Catopinae, (deuxième série). Étude phylogénétique et paléogéographique de la sous-famille.


https://doi.org/10.1130/0091-7613(2000)28%3C1063:RWPMPO%3E2.0.CO;2

Archives de Zoologie Expérimentale et Générale, 61, l–98.Jeannel, R. (1936) Monographie des Catopidés. Mémoires du Museum National d'Histoire Naturelle, 1, 1–433.Jolivet, L., Augier, R., Robin, C., Suc, J.-P. & Rouchy, J.M. (2006) Lithospheric-scale geodynamic context of the Messinian

salinity crisis. Sedimentary Geology, 188–189, 9–33.https://doi.org/10.1016/j.sedgeo.2006.02.004

Katoh, K. & Toh, H. (2008) Recent developments in the MAFFT multiple sequence alignment program. Briefings in

Bioinformatics, 9, 286–298.https://doi.org/10.1093/bib/bbn013

Kraatz, G. (1870) Choleva gracilis n. sp. In: Heyden, L. von, Entomologische Reise nach dem südlichen Spanien, der Sierra

Guadarrama und Sierra Morena, Portugal und den Cantabrischen Gebirgen. Mit Beschreibungen der neuen Arten.

Nicolaische Verlagsbuchhandlung, Berlin, pp. 99–101.López, H. & Oromí, P. (2010) A pitfall trap for sampling the mesovoid shallow substratum (MSS) fauna. Speleobiology Notes,

2, 7–11.Martínez de la Escalera, M. (1927) Del verdadero hábitat de algunos catopinos (Col. Silphidae). Boletín de la Real Sociedad

Española de Historia Natural, 27, 426–428. Meulenkamp, J.E. & Sissingh, W. (2003) Tertiary palaeogeography and tectonostratigraphic evolution of the Northern and

Southern Peri-Tethys platforms and the intermediate domains of the African-Eurasian convergent plate boundary zone. Palaeogeography, Palaeoclimatology, Palaeoecology, 196, 209–228. https://doi.org/10.1016/S0031-0182(03)00319-5

Paulo, O.S., Pinheiro, J., Miraldo, A., Bruford, M.W., Jordan, W.C. & Nichols, R.A. (2008) The role of vicariance vs. dispersal in shaping genetic patterns in ocellated lizard species in the western Mediterranean. Molecular Ecology, 17, 1535–1551.https://doi.org/10.1111/j.1365-294X.2008.03706.x

Pérez, T. (2015) Catálogo de invertebrados citados en cuevas, simas y minas de Andalucía. Monografías Bioespeleológicas, 9, 1–97.

Pérez, T. & Pérez, A. (2006) Estudios bioespeleológicos en la Cueva Secreta del Sagreo, La Iruela (Jaén). Monografías

Bioespeleológicas, 1, 1–13.Pérez, T., Pérez, A., Pérez, J. & García, F. (2013) La cueva Secreta del Sagreo (La Iruela, Jaén, sur de España), una cavidad con

historia en Jaén. Espeleo-Tema, 24, 31–39.Pérez, A. & Tinaut, A. (2005) Bioespeleología en la provincia de Jaén. Espeleo, 17, 1–10.Perreau, M. (2000) Catalogue des coléoptères Leiodidae Cholevinae et Platypsyllinae. Mémoires de la Société Entomologique

de France, 4, 1–460.Perreau, M. (2004) Leiodidae. In: Löbl, I. & Smetana, A. (Eds.), Catalogue of Palaearctic Coleoptera. Vol. 2. Apollo Books,

Stenstrup, pp. 133–203.Peyerimhoff, P. de (1917) Nouveaux coléoptères du Nord-Africain. Vingt-cinquième note avec des renseignements

synonymiques sur les Silphidae et les Histeridae. Annales de la Société Entomologique de France, 86, 117–148.Reboleira, A.S., Fresneda, J. & Salgado, J.M. (2017) A new species of Speonemadus from Portugal with the revision of the

escalerai-group (Coleoptera, Leiodidae). European Journal of Taxonomy, 261, 1–23. https://doi.org/10.5852/ejt.2017.261

Recuero, E., Iraola, A., Rubio, X., Machordom, A. & García-París, M. (2007) Mitochondrial differentiation and biogeography of Hyla meridionalis (Anura: Hylidae): an unusual phylogeographical pattern. Journal of Biogeography, 34, 1207–1219.https://doi.org/10.1111/j.1365-2699.2007.01688.x

Reitter, E. (1885) Bestimmungs-Tabellen der europäischen Coleopteren, 12 Necrophaga. Verhandlungen des Naturforschenden

Vereines in Brünn, 23 (1884), 3–122.Ribera, C. (1970) Resultados faunísticos de la campaña Serranía de Ronda 70. Actas I Congreso Nacional de Espeleología,

Barcelona, 123–129. Ribera, I., Fresneda, J., Bucur, R., Izquierdo, A., Vogler, A.P., Salgado, J.M. & Cieslak, A. (2010) Ancient origin of a western

Mediterranean radiation of subterranean beetles. BMC Evolutionary Biology, 10, 29.https://doi.org/10.1186/1471-2148-10-29

Rosenbaum, G., Lister, G.S. & Duboz, C. (2002) Reconstruction of the tectonic evolution of the western Mediterranean since the Oligocene. Journal of the Virtual Explorer, 8, 107–130.https://doi.org/10.3809/jvirtex.2002.00053

Rubink, W.L., Murray, K.D., Baum, K.A. & Pinto, M.A. (2003) Long term preservation of DNA from honey bees (Apis

mellifera) collected in aerial pitfall traps. Texas Journal of Science, 55, 159–168.Sáez Bolaño, J. & Blanco Villero, J.M. (2010) Los colévidos epigeos (Coleoptera, Leiodidae, Cholevinae) de la Sierra de Tudía

(Badajoz, Extremadura, España). Boletín de la Sociedad Entomológica Aragonesa, 47, 357–361.Salgado, J.M. (1985) Nuevos datos sobre Catopidae (Col.) capturados en cuevas. Boletín de la Asociación Española de

Entomología, 9, 271–277.Salgado, J.M. (1996) Leiodidae Cholevinae (Coleoptera) in the Orocantabrian phytogeographic province (Cantabrian

Cordillera, North Spain). Giornale Italiano di Entomologia, 8, 213–229.Salgado, J.M., Blas, M. & Fresneda, J. (2008) Coleoptera, Cholevidae. Fauna Ibérica. Vol. 31. Museo Nacional de Ciencias

Naturales, CSIC, Madrid, 799 pp.


https://doi.org/10.1016/S0031-0182(03)00319-5

Salgado, J.M. & Fernández, M. (1998) Estudio de los Leiodidae: Cholevinae (Coleoptera) en las cuencas de los ríos Bernesga, Torío y Porma (León, España). Boletín de la Asociación Española de Entomología, 22, 81–97.

Schettino, A. & Turco, E. (2006) Plate kinematics of the Western Mediterranean region during the Oligocene and Early Miocene. Geophysical Journal International, 166, 1398–1423.https://doi.org/10.1111/j.1365-246X.2006.02997.x

Seabra, A.F. de (1943) Contribuçoes para o inventário da fauna lusitânica, Insecta, Coleoptera. Memórias e Estudos do Museu

Zoológico da Universidade de Coimbra, 142, 1–151. Shull, V.L., Vogler, A.P., Baker, M.D., Maddison, D.R. & Hammond, P.M. (2001) Sequence alignment of 18S ribosomal RNA

and the basal relationships of adephagan beetles: evidence for monophyly of aquatic families and the placement of Trachypachidae. Systematic Biology, 50, 945–969. https://doi.org/10.1080/106351501753462894

Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. & Flook, P. (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene-sequences and a compilation of conserved polymerase chain-reaction primers. Annals of the

Entomological Society of America, 87, 651–701.https://doi.org/10.1093/aesa/87.6.651

Stamatakis, A., Hoover, P. & Rougemont, J. (2008) A rapid bootstrap algorithm for the RAxML web servers. Systematic

Biology, 57, 758–771.https://doi.org/10.1080/10635150802429642

Suc, J.-P. (1984) Origin and evolution of the Mediterranean vegetation and climate in Europe. Nature, 307, 429–432.https://doi.org/10.1038/307429a0

Szymczakowski, W. (1970) Contribution à la connaissance des Catopidae (Coleoptera) paléarctiques. Acta Zoologica

Cracoviensia, 15, 259–282.Tinaut, A. (1998) Artrópodos terrestres de las cavidades andaluzas. Zoologica Baetica, 9, 3–28.Tizado, E.J. & Salgado, J.M. (2000) Local-scale distribution of cholevid beetles (Col., Leiodidae: Cholevinae) in the province

of León. Acta Oecologica, 21, 29–35.https://doi.org/10.1016/S1146-609X(00)00109-0

Tizado, E.J., Salgado, J.M. & Núñez, E. (1995) Ecological correlates of the distribution of species of the family Cholevidae (Coleoptera) in the Cantabrian Mountains of northwest Spain. Acta Oecologica, 16, 351–360.

Torres, T., Ortiz, J.E., Soler, V., Reyes, E., Delgado, A., Valle, M., Llamas, J.F., Cobo, R., Julià, R., Badal, E., García de la Morena, M.A., García-Martínez, M.J., Fernández-Gianotti, J., Calvo, J.P. & Cortés, A. (2003) Pleistocene lacustrine basin of the east domain of guadix-baza basin (Granada, Spain): sedimentology, chronostratigraphy, and palaeoenvironment. In: Valero-Garcés, B.L. (Ed.), Limnogeología en España: un homenaje a Kerry R. Kelts. Consejo Superior de Investigaciones Científicas, Madrid, pp. 151–185.

Uhagón, S. (1890) Ensayo sobre las especies españolas del grupo "Cholevae". Anales de la Sociedad Española de Historia

Natural, 19, 15–96.Uhagón, S. (1898) Adiciones a mi "Ensayo sobre las especies españolas del grupo Cholevae". Anales de la Sociedad Española

de Historia Natural, 7 (2), 27 (Actas de la Sociedad Española de Historia Natural, sesión del 1º de VI-1898), 117–126. Velo-Antón, G., Godinho, R., Harris, D.J., Santos, X., Martínez-Freiria, F., Fahd, S., Larbes, S., Pleguezuelos, J.M. & Brito,

J.C. (2012) Deep evolutionary lineages in a Western Mediterranean snake (Vipera latastei/monticola group) and high genetic structuring in Southern Iberian populations. Molecular Phylogenetics and Evolution, 65, 965–973. https://doi.org/10.1016/j.ympev.2012.08.016

Vogler, A.P., DeSalle, R., Assmann, T., Knisley, C.B. & Schultz, T.D. (1993) Molecular population genetics of the endangered tiger beetle Cicindela dorsalis (Coleoptera, Cicindelidae). Annals of the Entomological Society of America, 86, 142–152.https://doi.org/10.1093/aesa/86.2.142

Zangari, F., Cimmaruta, R. & Nascetti, G. (2006) Genetic relationships of the western Mediterranean painted frogs based on allozymes and mitochondrial markers: evolutionary and taxonomic inferences (Amphibia, Anura, Discoglossidae). Biological Journal of the Linnean Society, 87, 515–536.https://doi.org/10.1111/j.1095-8312.2006.00585.x

APPENDIX

Detailed locality data of the studied species of Speonemadus (including published and unpublished records; see Figs 38, 39 for the distribution of some species). For studied type material see main text under the corresponding species.

Speonemadus gracilis (Kraatz, 1870)Spain: Albacete: Férez, Puente de Híjar, MSS (= shallow subterranean environment, "milieu souterrain superficiel"), 5-III-2004, Lencina leg., 1 ex. (CFL) (Fresneda et al. 2007, sub S. vandalitiae). Badajoz: Cabeza la Vaca, Los Cortinales, locality code: CLV-2, in a short (25 m) and narrow artificial gallery, 5-VI-2005, 1 ♂; in fungus infection in a chestnut tree, 18-XI-2006, 2 ♂♂; in a rodent nest, 19-III-2008, 1 ♂,1 ♀; trap, 18-III-10, 1 ♂; trap with cheese in MSS, 5-VI-2010, 1 ♂ (all MNCN) (all Sáez & Blanco 2010, sub S. vandalitiae). Cádiz: Grazalema, La Vegueta-Jaral (tamis), 3-XI-2013, Brustel leg., 7 exs (CFL).


Córdoba: Cabra, Fuente de Jarcas, 31-X-2004, Castro leg., 1 ex.; Cabra, La Nava, 28-IV-2007, Baena leg., 1 ex.; Santa María de Trasierra, Arroyo del Molino, among bush litter, 12-XII-2004, Baena leg., 1 ♂ (all CFL) (all Fresneda et al. 2007, sub S.

vandalitiae). Cuenca: Monteagudo de Salinas, Los Llecos, 4-XI-1981, Lencina leg., 1 ♀ (CFL) (Fresneda et al. 2007, sub S.

vandalitiae). Jaén: Hornos, Sima de la Tubería, 28-VIII-2011, 45 exs; 28-IV-2012, 1 ex.; 13-VIII-2013, 4 exs (all GEV leg.) (all CFL). Hornos, Cueva del Pantano, 10-X-2004, GEV leg., 8 exs; Hornos, Sima, 14-VIII-2006, GEV leg., 1 ♀; Siles, Sima GEV-2000, 4-II-2007, GEV leg., 1 ex.; Siles, Cueva de Peñafleita, 3-VI-2007, GEV leg., 14 exs (all CFL) (all Fresneda et al.

2007, sub S. vandalitiae). La Iruela, Sierra de Cazorla, Cueva Secreta del Sagreo (Ribera 1970, sub S. vandalitiae), Mateu & Cobos leg. (Blas 1977, sub S. vandalitiae); 18-V-1953, Mateu & Cobos leg., 32 exs (Blas 1979, sub S. vandalitiae); 2-XII-2007, GEV leg., 1 ♀ (CFL) (Fresneda & Salgado 2017, sub S. vandalitiae). Madrid: Rivas-Vaciamadrid, Cerros de Casa Eulogio, 2-V-1991, López-Colón leg., 2 ♂♂, 1 ♀ (CFL) (5 exs, Fresneda et al. 2007, sub S. vandalitiae). Málaga: Antequera, Complejo del Romeral, 27-IX-2008, GEV leg., 3 exs (CFL). Murcia: Jumilla, Sierra del Carche, 1000 m, MSS, 13-IV-1997, 2 exs; XII-1989, 10 exs; 3-IV-1997, 4 exs; 2-II-2003 3 exs; Jumilla, Sierra del Carche, 1100 m, MSS, 22-II-2003, 4 ♀♀; Yecla, Sierra de Salinas, 23-IX-2003, 1 ♀; 29-XI-2003, 3 exs; all Lencina leg. (all CFL) (all Fresneda et al. 2007, sub S. vandalitiae). Valencia: Enguera, Serra d'Enguera, Barranco de las Cuevas, 10-I-1983, Lencina leg., 2 exs (CFL) (Fresneda et al. 2007, sub S.

vandalitiae).

Speonemadus orchesioides (Fairmaire, 1879)Notes: The only material identified with certainty as S. orchesoides is currently the type material from Daya (Algeria), all females, and the male from Ammi-Moussa recorded by Jeannel (1936) (see main text). The following material has been recorded under the name S. orchesioides, but is of doubtful identity. They could actually be S. gracilis, S. orchesioides, S.

pulchellus or S. tenuipes. In some cases we note the most likely identity according to the geographic distribution of the species. Algeria: Alger, coll. Reitter: Alger, Ain-Beida, Théry; Djurdjura, entrée de l'Ifri Semedane, Peyerimhoff; Teniet-el-Had, Bedel; Terni, Normand (all Jeannel 1936). Djurdjura, Boghni, Beni Mendez, m 900, con scavo in forra calcarea (Giachino 1985). Djurdjura, 4 km SW Tikjda, 1200 m, 7-V-1988, 4 ♂♂, 1 ♀ (MHNG); Djurdjura, forêt de Tala Guilef, 950-1100 m, 10-V-1988, 1 ♀ (MHNG); 2 exs (CDO); G. de Kabylie, forêt de Akfadou, 1050 m, 16-V-1988, Burckhardt, Besuchet, Löbl, 2 ♂♂, 3 ♀♀ (MHNG); G. de Kabylie, forêt de Akfadou, 26 km E Yakouren, 1200 m, 16-V-1988, Burckhardt, Besuchet, Löbl, 5 ♂♂, 8 ♀♀, (MHNG); G. de Kabilie, Oued Aïssi, Ouadhia, 200 m, 12-V-1988, 1 ♀ (MHNG); Gorges de la Chiffa, Ruisseau de Singes, 280-380 m, 4-V-1988, Burckhardt, Besuchet, Löbl, 1 ♀ (MHNG); G. de K.-Azazga Yakouren, 600 m, 14-V-1988, 1 ♀ (MHNG); Oran, Coll. Heyden, 1 ♂ (SDEI) (all Giachino & Vailati 1993). Notes: The latter specimen could be S. orchesioides, as the type series of this species is also from Oran, Daya. 5 exs: "Entrée d'Ifri / Semedane / 21.VI.08" [hw], "Anemadus / orchesioides / pulchellus" [hw], "orchesioides Frm / Jeannel det." [hw Jeannel, printed] (coll. Peyerimhoff, MNHN). 3 exs on the same pin: "Ifri Semedane / Djurdjura / 21.VI.08", "Anemadus / pulchellus / Reitter", "comparé au / type 11 Juin 1910" (coll. Peyerimhoff, MNHN). The studied specimens from this locality, collected by A. Faille, are S. tenuipes (see Table 2). Morocco: The following two records may correspond to S. brusteli sp. n.: Rif, El Ajmas, C. Bolívar (Jeannel 1936). Sources de l'Oum er Rhia, 1100 m, 5-V-1960, Besuchet, 1 ♂ (MHNG) (Giachino & Vailati 1993). Portugal: Estremadura, Lisboa, Sintra, Pena, 6-VI-1966, Besuchet leg., 1 ♂; Trás-os-Montes, Bragança, Rebordâos, 10-VI-1966, Besuchet leg., 1 ♂ (all MHNG) (all Giachino & Vailati 1993). Trás-os-Montes, São Martinho (de Anta), Corrêa de Barros (Fuente 1925). Spain: Jaén, Sierra de Cazorla, 15-VI-1960, Besuchet leg., 19 ♂♂ (MHNG) (Giachino & Vailati 1993). Note: Most likely the records of Spain and Portugal correspond to S. gracilis. Tunisia: Most likely the following records correspond to S. pulchellus: Ain Draham; Fernana, Normand; Le Kef, Normand (all Jeannel 1936).

Speonemadus pulchellus (Reitter, 1885)Algeria: "Setif, Djebel Babor, m 2100, al vaglio in foresta di cedri, 5-XI-1984, Giachino", 1 ♂ (CPMG) (Giachino 1985; Giachino & Vailati 1993). Identified by the figure of the aedeagus in Giachino & Vailati (1993). 1 ♂: "Mouzaïaville" [hw], "Speonemadus / pulchellus / Fresneda det. 2017" [hw, printed] (coll. Peyerimhoff, MNHN). In this locality there are also records of S. tenuipes. 1 ♂: "Mahmel / Aurès / 16 juin 1922" (coll. Peyerimhoff, MNHN; sub orchesioides). Italy (Sicily): Recorded without further data by Reitter (1885), 3 ♂♂ (SDEI); Reitter leg., 2 exs (SDEI); V. Pomieri, 24-V-1912, 1 ex. (MCSNG); Bosco di Malabotta, 1300 m, 2-VI-1985, Giachino leg. (CPMG); Castelbuono, fine V-1906, Dodero leg., 1 ex. (CDO); Ficuzza, Ragusa, Leonhard, Dodero leg., 8 exs (MCSNG); 19/27-V-1906, Dodero leg., 6 exs (CDO); V-1912, Dodero leg., 7 exs (CDO); 13-V-1912, A. Fiori leg., 5 exs (MCSNG); 19/27-V-1906, Dodero leg., 22 exs (MCSNG); 1908, Leonhard leg., 19 exs (SDEI); V-1912, Dodero leg., 7 exs (MCSNG); "SICILIA Ficuzza (PA) / 18.VI.1982 / leg. F. Angellini", 1 ex — under orchesioides ssp pulchellus— (SMNS); Ficuzza, Rocca Busambra (PA), 1200 m, 9-V-1981, R. Poggi leg., 1 ex. (MCSNG); 25-X-1982, R. Poggi leg., 1 ♂ (MCSNG); Ficuzza, Pizzo Nero (PA), 1000 m, 26-X-1982, R. Poggi, 6 exs (MCSNG); "SICILIA Madonie / Gibilmanna (PA) / 1000 m, 28.V.1996 / quer., leg. F. Angelini", 1 ♀ —under orchesioides— (SMNS); Madonie, Castellana Sicula (PA), 850 m, 8-V-1981, R. Poggi leg., 1 ♂ (MCSNG); Madonie, Piano Pomieri (PA), 1400 m, 30-V-1985, R. Poggi leg., 1 ex. (MCSNG); "SICILIA / Melilli (SR), 5.IV.97 / 100 m, foglie banano / + pietre, leg. Angelini", 1 ♀ —under orchesioides— (SMNS); Messina, 1/12-V-1906, Dodero leg., 3 exs (CDO); Palermo, Cadamuro leg. (MHNG); Piano Battaglia (PA), 1600 m, 30-V-1985, Giachino leg., 1 ex. (MRSN): Todrano, Valle Maria (PA), 700 m, 27-X-1982, R. Poggi leg., 1 ex. (MCSNG) (all Giachino & Vailati 1993). Ficuzza, Ragusa, Leonhard, Dodero leg.; Fiumedinisi, Holdhaus leg. (all Jeannel 1936). 1 ex. "Castelbuono / Sicilia / fine V.1906 / A. Dodero" [printed], "Anemadus / pulchellus" [hw], "pulchellus Reit / Jeannel det." [hw Jeannel, printed] (coll. Peyerimhoff, MNHN). Fiumedinisi, Holdhaus leg.; 4-V-1906,


Dodero leg., 8 exs (CDO), 3 exs (MCSNG) (Giachino & Vailati 1993). “2 ♂♂ Italia, Sicilia, Madonie, Piano Battaglia, m 1200, 25.V.19777, A. Casale leg. (CGi, CCa)” (Giachino & Vailati 2000); "SICILIA M. Nebrodi / P.lla Femminamorta / (ME), 1650 m, 11.VI/91, fagg. lg Angelini", 1 ex —under orchesioides— (SMNS). In the general collection of the MNHN there is a R. Jeannel's microscope slide with an aedeagus of this species from this locality, labelled as orchesioides. Italy (mainland):Abruzzi, Gran Sasso, Schatzmayr, one female (Jeannel 1936); “Emilia-Romagna, Argenta (FE), Oasi di Campotto , canale Lorgana, 2.IV-26.V.1993, 1 ♂, leg. R.A. Fabbri; ibidem, ll.IX.l995-1.II.1996, 2 ♂♂, leg. R.A. Fabbri; Argenta (FE), fiume Reno, 9.X.1996, 3 ♂♂ 3 ♀♀ e osservati plur. exx., leg. R.A. Fabbri” (Fabbri & Zoia 1996); “3 ♂♂ 3 ♀♀, Italia, Abruzzo, Zittola (AQ), Castel di Sangro, 17.XI.l990, Fiordigigli e Osella leg. (CGi); 1 ♂, ltalia, Abruzzo, Zittola (AQ), Castel di Sangro, 14.I.1991, Fiordigigli e Osella leg. (CGi)” (Giachino & Vailati 2000); “BO—Mordano: Bubano, Laghetto (A. De Giovanni leg.)” (Giachino & Vailati 2007); “BASILICATA Pignola / L.Pantano (PZ), 770 m / 19.X.1996, trapp. / aceto, leg. F. Angelini”, 1ex ; “BASILICATA Pignola / L.Pantano (PZ), 770 m / 3.XI.1996, trapp. / aceto, leg. F. Angelini”, 1 ♂, 1 ♀; “Basilicata (f. Basento) / Pignola (PZ) 30/11/95 / L. Pantano (Oasi WWF) / 760 m.s.l.m. trap. n5 / Leg. A. Romano // Pignola 30/11/95 / Trappola aceto n°5”, 1 ♂ —under orchesioides— (SMNS).

Speonemadus tenuipes (Peyerimhoff, 1917)Algeria: El Kseur, Forêt d'Akfadou, Fontaine des Ifs, m 1320, al vaglio in foresta di quercia (Giachino 1985), 12/13-XI-1984, Giachino leg., 2 ♂♂ & 1 ♀ (CPMG); 29-X-1984, Giachino leg., 1 ex. (CPMG) The aedeagus is figured in Giachino & Vailati (1993); Jijel, Forêt de Gerrouch, m 900, al vaglio in foresta di quercia (Giachino 1985), 10-XI-1984, Giachino leg., 1 ♂ (MRSN) The aedeagus is figured in Giachino & Vailati (1993) (all Giachino & Vailati 1993). "lac de Mouzaïa / 4 nov 1919 / champignons", 1 ex.; "O. Haïrom des / Mouzaïa / 15-17 mai 1932", 4 exs; "Boualem des / Mouzaïa / 15 mai 1930", 2 ♀♀ (all coll. Peyerimhoff, MNHN). Djurdjura, Aït Abd El Ali, Ifri Semedane, 23-V-2012, S. Aït-Mouloud & A. Faille, 4 ♂♂, 1 ♀ (CAF, CFL). Massif du Djurdjura, vers 2000 m, une série d'exemplaires, syntypes (MNHN) (Peyerimhoff 1917); Jeannel (1936); Giachino & Vailati (1993). Massif de Mouzaïa, entre 1000 et 1500 m, une série d'exemplaires, syntypes (MNHN) (Peyerimhoff, 1917); Jeannel (1936); Giachino & Vailati (1993). 1 ♂: "pic des / mouzaïa / 14 juin 1926" [hw Jeannel], "type" [red label printed], "tenuipes / Pey." [hw Jeannel], "edeage?" [hw Faille], "Speonemadus / tenuipes / Fresneda det. 2017" [hw, printed] (coll. générale, MNHN). The date of capture reflected in the labels is posterior to the description of the species. We have then not considered these specimens as types, despite being from the type locality and having a red "type" label. 1 ♂: "les Mouzaïa" [hw Jeannel], "Museum Paris / Coll. Abeille de Perrin / 1919" [green label, printed], "Speonemadus / tenuipes / Fresneda det. 2017" [hw, printed] (coll. générale, MNHN). 1 ♀: "Mouzaïa / Peyerimhoff" [hw], "Speonemadus / tenuipes / Fresneda det. 2017" [hw, printed] (coll. générale, MNHN).Material erroneously identified: "Massif d'Ouarsenis, entre 1000 et 1500 m, une série d'exemplaires, syntypes" (MNHN) (Peyerimhoff 1917); Jeannel (1936); Giachino & Vailati (1993). The only syntype of A. tenuipes in the MNHN from this locality actually belongs to S. orchesioides.Material recorded as S. tenuipes but of uncertain identity: Algeria: Kabylie, Yakouren, Chobaut, une femelle (Jeannel 1936); Giachino & Vailati (1993). Morocco: "Maroc central (Moyen Atlas): "A. de Sidi Ali, 6760 ft., 32 ml. Ifrane 165°, Il. V. 1961 (under stones)", leg. P. N. LAWRENCE, 1 ♂", "Coll. British Museum (Nat. Hist.) (B. M. 1961-328)"; "Maroc occidental (Haut Atlas): "Airene (W. Imlil), 55 km S. Marrakech, 5000 ft., 26. VI. 1961, 985-8", leg. P. N. LAWRENCE, 1 ♀", "Coll. British Museum (Nat. Hist.) (B. M. 1961-328)"; "Nr. Imlil, 5000 ft., 25. IV. 1961, 974—5", leg. P. N. LAWRENCE, 1 ♀", "Coll. British Museum (Nat. Hist.) (B. M. 1961-328)" (all Szymczakowski 1970; Giachino & Vailati 1993).

Speonemadus vandalitiae (Heyden, 1870)Spain: Albacete: Riópar, Cañada de los Mojones, 15-XI-1987, Lencina leg., 4 exs (CFL) (Fresneda et al. 2007). Ciudad Real: Navas de Estena, El Boquerón, 11-XII-2001, Lencina leg., 1 ♂ (CFL). Granada: Baza, Santa Bárbara, 1500 m, 15-X-1988, Lencina leg., 1 ♀ (CFL) (Fresneda et al. 2007). Huesca: Bonansa, Caricau del Puso, 4-IX-1991, Fresneda leg., 1 ♂ (CFL) (Fresneda et al. 2007). Villanúa, Cueva de Esjamundo, 28-IX-2009, Bourdeau, Faille & Fresneda, 1 ♂ (IBE, DNA voucher IBE-AC110); “Huesca: SW Sta. Cruz de la Seros / 1000 m. 3.9.1986 / leg. W. Schawaller”, 1 ♂, 1 ♀; “Huesca: Sierra de San Juan de la Pena / 1300-1500 m, 3.9.1986 / leg. W. Schawaller”, 1 ♂, 2 ♀; “Huesca: Rio Ara S Bujaruelo / 1200 m, 9.9.1986 / leg. W. Schawaller”, 1 ♂ (SMNS). León: Ponferrada, Paganetti leg., 1 ♂ (coll. générale, MNHN) (Jeannel 1936; Blas 1977, 1979; “Ponferrata / Spanien / Paganetti leg.”, 1 ♂ + 10 exx (SMNS). Madrid: Miraflores, entre Miraflores y el Puerto de la Morcuera, 11-X-2004, J.J. de la Rosa leg., 1 ♀ (CFL) (Fresneda et al. 2007). Sierra de Guadarrama, Uhagón leg., 1 ♂ (MNHN) (Jeannel 1936). Murcia: Moratalla, Revolcadores, 1800 m, Sierra Seca, 9-VI-1998, 1 ex.; 17-X-1998, 2 exs; all Lencina leg. (all CFL) (all Fresneda et al. 2007). Tarragona: Ports de Tortosa, El Mascà, Font del Pastor, trampa de etilenglicol: V/X-1981, Bajet leg., 1 ex. (CFL). Toledo: Almendral de la Cañada, Sierra de San Vicente, 15-X-2005, Lencina & Andújar leg., 1 ♂ (CFL).

Speonemadus gracilis/vandalitiae

Material from the following localities should be revised: Algeria: 1 ex.: "le Hamma / 6.II.09 J.C" and 1 ex.: "Mansourah / 17.12.09 J.C", both specimens on the same pin; "Bou Thaleb / mars 1914", 1 ex. (coll. Peyerimhoff, MNHN). Morocco: "Sefrou / 21.3.37 Otin" [printed] / "ALOES / POURRI", 1 ex. (coll. Peyerimhoff, MNHN). Spain: Álava: Without detailed locality: Martínez de la Escalera (Fuente 1925). Ibón de Olano, Puerto de Okina, 3-IV-1995, Marcos leg., 1 ex.; Montes Izkiz, 27-IX-1995, Marcos leg., 1 ex.; Montes de Zarpia, 16-IX-1996, Marcos


leg., 2 exs; Puerto de Herrera, 13-XI-1994, Marcos leg.; Sierra de Elguea, 15-IV-1997, Marcos leg., 2 exs, (MCNA); 31-V-1998, in Pinus radiate forest, Marcos leg., 1 ex.; Sierra de Entzia, 5-IX-1996, Marcos leg., 1 ex.; Sierra Toloño, 29-IX-1995, Marcos leg., 1 ex.; Sierra de Urkilla, 1-X-1994, Marcos leg., 1 ex. (MCNA); 9-IX-95, Marcos leg., 3 exs; Villamardones, 26-IX-1995, Marcos leg., 1 ex., (all MCNA) (all Fresneda & Salgado 2017). Zuazo, Pinar de Ullibarri, in detrite (Uhagón 1898). Albacete: Molinicos, V-1903, 1 ex.; 24-V-1938, 27 exs; 20/30-X-1938, 3 exs; 9-XI-1938, 5 exs (all Blas 1977, 1979). Riópar, 24-IV-1988, Lencina leg., 1 ex.; 17-V-1992, Lencina leg., 1 ex.; Vianos, Cañada de los Mojones, 18-II-1990, Lencina leg., 1 ex.; Villapalacios, Río Guadalmena, 27-IX-2003, Lencina leg., 1 ex. (all Fresneda et al. 2007). Vianos, 1400 m, 10-V-1960, Besuchet leg., 1 ♂, 6 ♀♀ (MHNG) (Giachino & Vailati 1993). Andalucía: Without detailed locality (Reitter 1885). Asturias: Without detailed locality: 1 ♂, 1 ♀ (SDEI) (Heyden 1881, Reitter 1885, Giachino & Vailati 1993). Cangas del Narcea, Puerto del Rañadoiro 1000 m, 26-VI-1987, Meregalli leg. (CPMG) (Giachino & Vailati 1993). Veneros, Cueva la Cuevona, 2-VI-1984, Salgado leg., 1 ex. (CZULE) (Salgado 1985). Villaviciosa, 5-X-1927, 4 exs and 30-IX-1927, 1 ex. (Blas 1977, 1979). Ávila: Sierra de Gredos, Uhagón leg. (Uhagón 1890, Jeannel 1936, Blas 1979). Crotch leg. (Uhagón 1890); Uhagón leg. (Fuente 1925); Burgos: “Castilla-Leon, 40 km ESE Burgos, 1720 m, Trigaza, Fagus litter, N42°16.16' W03°14.55' / 12.x.2003 Leg. V. Assing”, 2 ♀♀ (SMNS). Cádiz: Laguna de la Janda, 30-V-1966, Besuchet leg., 1 ♀; Sierra del Pinar, 1100 m, 10-V-1960, Besuchet leg., 3 ♂♂, 10 ♀♀ (all MHNG) (all Giachino & Vailati 1993). Cantabria: Santander, Crotch, Uhagón leg. (Fuente 1925). Fuente Dé, Aliva (Salgado 1996). Reinosa, Crotch leg. (Uhagón 1890, Jeannel 1936); Uhagón leg. (Uhagón 1890); 5 exs (Blas 1977, 1979). Ciudad Real: Horcajo de los Montes, P.N. de Cabañeros, Pinar de las Llanas, 5-XI-2002, Lencina leg., 2 exs (CFL) (Fresneda et al. 2007). Venta de Cárdenas, 700 m, Rio Magaña, 16-V-1960, Besuchet leg., 5 ♀♀ (MHNG) (Giachino & Vailati 1993). Coruña: Rambousek leg. (Jeannel 1936; Blas 1979). Oleiros, Agirre leg., 14 exs (Agirre & Blas 2009). Cuenca: Korb (Fuente 1925). 1890, Korb leg. (SDEI); Las Torcas, 19-V-1960, Besuchet leg., 2 ♂♂ (MHNG) (all Giachino & Vailati 1993). Granada: Dúdar, 3-V-2015, Tinaut leg., 3 ♂♂, 10 ♀♀ (Fresneda & Salgado 2017); “Granada, Sierra Nevada – Guejar / Camino de Loma Cunas / de los Cuartos 1900-2100 m / 14.VI.1991 Wrase”, 1 ♀ (SMNS). Huesca: Puerto de Bonrepós, 13-VI-1966, Besuchet leg., 1 ♂; Valle de Ordesa, 12-VI-1966, Besuchet leg., 1 ♀ (all MHNG) (all Giachino & Vailati 1993); “Huesca: E Pto. de Cotefablo / 1000 m, 9.9.1986 / leg. W. Schawaller”, 1 ♀ (SMNS). Jaén: Cazorla, Fuente Bermeja (Blas 1976). Sierra de Cazorla, 20-V-1953, Español leg., 2 exs; “Jaen - Sierra de Cazorla - 15.VI.1960. BESUCHET”, 1 ♀ (SMNS); El Pardal, Sierra de Segura, VI-1903, Martínez de la Escalera leg., 2 exs; Santa Elena, 1 ex.; Sierra de Cazorla, VI-1950, Español leg., 1 ex. (all Blas 1977, 1979). Sierra de Cazorla, 15-V-1960, Besuchet leg., 2 ♂♂ (MHNG) (Giachino & Vailati 1993). León: Alija de la Ribera, 775 m; Arbás del Puerto; Busdongo; Camposolillo; Candanedo; Cerezales del Condado; Ciñera; Embalse del Porma; Garrafe (de Torío); Getino; Huergas de Gordón; Lorenzana; Lugán; Matallana de Torío; Palazuelo de Boñar; Pardavé; Piornedo; Puebla de Lillo; Puente Villarente; Puerto de las Señales; San Feliz de Torío; Vegacervera, Hoces de Vegacervera; Vegamián; Villamanín (all Salgado & Fernández leg.) (all Salgado & Fernández 1998; Tizado & Salgado 2000). Candín; Casares de Arbás; Cofiñal; Estación de Brañillin; Morgovejo; Villar de Santiago (all Salgado 1996). Puerto de Ancares; Puerto de Leitariegos; Puerto del Pando; Puerto del Pontón; Puerto de las Señales; Prioro; Puebla de Lillo, Cueva del Tesoro, 7-VIII-1982, Salgado leg., 3 exs; Santa Olaja de la Varga, Cueva de la Cantera, 20-IX-1974, 1 ex.; Tolibia de Abajo, Cueva de las Lendreras, 7-V-1978, Salgado leg., 1 ex. (all CZULE) (all Salgado 1985). Ponferrada, 2 exs (MCSNG); 39 exs (CPMG); 50 exs (MRSN); 41 exs (SDEI) (all Giachino & Vailati 1993). Lugo: Sierra de Ancares, Agirre leg., 120 exs; Serra do Courel, Agirre leg., 7 exs (all Agirre & Blas 2009). Madrid: Madrid, Martínez leg.; Madrid, Casa de Campo, Uhagón leg.; Escorial, Pérez-Arcas & Martínez leg.; Navacerrada, Pérez-Arcas & Martínez leg.; Alcalá de Henares, bajo las capas de arcilla, Martínez de la Escalera leg.; Villaviciosa de Odón, in rabbit skins (Uhagón 1898). Brunete, Barranca de Cienvallejos, 5-X-1927, 1 ex.; 10-X-1927, 4 exs (all Martínez de la Escalera & Bolívar leg.) (all Martínez de la Escalera 1927). Cercedilla, Arias leg., 1 ex.; VII-1938, Peláez leg., 2 exs; El Paular, XI-1908, Arias leg., 3 exs; Sierra de Guadarrama, Lauffer leg., 1 ex. (Blas 1977, 1979). "Umg. Escorial, Hi. c.", Franz leg., 2 exs (SDEI); Navalagamella, 13-IV-1960, Besuchet leg., 2 ♀♀ (MHNG) (all Giachino & Vailati 1993). Guadalix de la Sierra, Embalse del Vellón, 29-IX-2004, Baena leg., 1 ♀ (CFL); female specimen without antennae, impossible to identify (Fresneda et al. 2007). Málaga: Cómpeta, Sierra Almijara, Loma de "El Daire", 1250 m., Cobos leg. (Cobos 1954); “Hi., Andalus., Ronda, 7.5.79, leg. E. Ulbrich”, 2 ♀♀ (SMNS); Ronda, 2 exs (SDEI) (Giachino & Vailati 1993). Ronda, Sierra de las Nieves, Heyden leg. (Heyden 1870; Uhagón 1890; Jeannel 1936; Blas 1979); 3 exs (SDEI) (Giachino & Vailati 1993); V-1952, Coiffait leg., 1 ♂, 1 ♀ (MHNG) (Coiffait 1954; Giachino & Vailati 1993); Blas (1976); on Abies pinsapo, Mateu & Cobos leg. (Cobos 1954). Sierra Bermeja, 2-XII-1976, Ramírez leg., 1 ex. (Blas 1977, 1979). Sierra de Ronda, Sima del Hoyo Jaralón (Blas 1976), 16-V-1952, Mateu leg., 1 ex. (Blas 1977, 1979); Tinaut (1998); Pérez (2015). Murcia: Moratalla, Cerro del Castellar, 8-XI-1992, Lencina leg., 1 ex. ; Moratalla, Revolcadores, 1800 m, 22-III-1979, Lencina leg., 3 exs ; Moratalla, Revolcadores, 1800 m, exterior de sima en la pista, 22-III-1979, Lencina leg., 2 exs (all Fresneda et al. 2007). Orense: Campobecerros, Serra do Invernadoiro, 9-VI-2012, Salgado leg., 2 exs (CJMS) (Fresneda & Salgado 2017). Puerto Outero de Aguas, vers. n, 800 m, 13-VI-1989, Meregalli leg. (CPMG) (Giachino & Vailati 1993). Palencia: 1 ex. (SDEI) (Giachino & Vailati 1993). Rioja: Sierra de Cebollera, vers. n, 1300 m, Arroyo Fuente, 17-VI-1987, Meregalli leg., 11 exs (CPMG) (Giachino & Vailati 1993); “Prov. Logrono // 31.7.1971 / Villoslada de Cameros”, ♀♀ (SMNS). Segovia: Pérez Arcas, Martínez (Fuente 1925). La Granja, Bedel leg. (Jeannel 1936; erroneously located in the province of Madrid); VI-1908, Sanz leg., 2 exs (Blas 1977, 1979); San Ildefonso, Pérez-Arcas y Martínez leg. (Uhagón 1890). Soria: Montenegro de Cameros, 20 exs, Bolívar leg.; Urbión, VI-1923, 1 ex. (all Blas 1977, 1979). Puerto de Oncala, 1400 m, 16-VI-1987, Meregalli leg.; Sierra del Moncayo, 1250 m, 16-VI-1987, Meregalli leg., 11 exs; 16-VII-1987, 10 exs (all CPMG) (all Giachino & Vailati 1993). Teruel: Between Alcalá de la Selva and Gúdar, 1400 m, 22-V-1960, Besuchet leg., 3 ♂♂ (MHNG) (Giachino & Vailati 1993). Valencia: Ayora, La Unde, 12-V-1990, Lencina leg., 1 ex.; Enguera, Serra d'Enguera, Navalón, 15-


XI-1992, Lencina leg., 1 ex. (all Fresneda et al. 2007). Balearic Islands (Spain): Mallorca: Peguera, Rambla leg., 1 ♂ (CMB) (Blas 1981a, 1992). Portugal: Beira Alta: Castelo, Manteigas, 1650 m, 16-IV-1960, Besuchet leg., 1 ♂; 16-V-1960, Besuchet 1 ♂ (all MHNG) (all Giachino & Vailati 1993). Beira Litoral: Bairro-Ourém, Serras d'Aire e Candeeiros Nature Park, Pinus

pinaster plantation, 12-II-2002, 1 ♀; 26-II-2002, 1 ♀; 26-III-2002, 2 ♀♀; 9-IV-2002, 2 ♂♂; 23-IV-2002, 1 ♂, 2 ♀♀; 7-V-2002, 1 ♂; 1-V-2002, 2 ♀♀; 22-X-2002, 1 ♀ (Faria e Silva et al. 2013). Trás-os-Montes: São Martinho (de Anta), Corrêa de Barros (Fuente 1925). Vila Real, Murça, 10-VI-1966, Besuchet leg., 2 ♂♂ (MHNG) (Giachino & Vailati 1993). Algosinho-Mogadouro, Douro Internacional Nature Park, Stream bank with Fraxinus angustifolia and Salix salvifolius, 18-IV-2001, 1 ♂; 31-X-2001, 1 ♀; 14-XI-2001, 1 ♀; Bruçó-Mogadouro, Douro Internacional Nature Park, Douglas fir (Pseudotsuga menziesii) stand, 4-IV-2001, 1 ♀; 16-V-2001, 1 ♂; 17-X-2001, 1 ♂, 4 ♀♀; 31-X-2001, 2 ♀♀; 14-XI-2001, 2 ♀♀; Palão-Freixo de Espada à Cinta, Douro Internacional Nature Park, Eucalyptus globulus plantation with Cytisus spp. understorey, 13-VI-2001, 1 ♀; Picotino-Freixo de Espada à Cinta, Douro Internacional Nature Park, Pinus pinaster plantation, 28-II-2001, 1 ♀; 4-IV-2001, 1 ♀; 17-X-2001, 3 ♂♂, 1 ♀; 14-XI-2001, 1 ♀; Mogadouro, Douro Internacional Nature Park, young Quercus pyrenaica forest, 7-II-2001, 1 ♀; 21-II-2001, 1 ♀; 21-III-2001, 2 ♂♂, 2 ♀♀; 4-IV-2001, 2 ♂♂, 2 ♀♀; 5-IX-2001, 1 ♀; 17-X-2001, 1 ♀; 14-XI-2001, 1 ♀ (all Faria e Silva et al. 2013).


4543 (1): 001 036 articlemolevol.cmima.csic.es/ribera/pdfs/fresneda_etal2019_speonemadus.pdf ·...

Documents