4320 (2): 289 304 article genera scincus and scincopus (schmitz et al. 2004; carranza et al. 2008;...

ZOOTAXA

ISSN 1175-5326 (print edition)

ISSN 1175-5334 (online edition)Copyright © 2017 Magnolia Press

Zootaxa 4320 (2): 289–304 http://www.mapress.com/j/zt/

Article

https://doi.org/10.11646/zootaxa.4320.2.5

http://zoobank.org/urn:lsid:zoobank.org:pub:0898C298-1C6F-483A-8F80-1F4E98A82E97

A new species of Eumeces Wiegmann 1834 (Sauria: Scincidae) from Iran

HIVA FAIZI1, NASRULLAH RASTEGAR-POUYANI1,7, ESKANDAR RASTEGAR-POUYANI2

ROMAN NAZAROV3, NASTARAN HEIDARI4, BAHMAN ZANGI5, VALENTINA ORLOVA6

& NIKOLAI POYARKOV3

1Department of Biology, Faculty of Science, Razi University, 6714967346 Kermanshah, Iran

E-mail: [email protected]; [email protected] 2Department of Biology, Hakim Sabzevari University, Sabzevar, Iran. 3Zoological Museum of Moscow State University, Herpetology Department, 125009 Moscow, B. Nikitskaya, 2.

E-mail [email protected] of Animal Biology, Faculty of Biological Science, Kharazmi University, Karaj, Iran. E-mail: [email protected] of Environment, Aban-Pajouh Consulting Engineering Company, Tehran, Iran 6Department of Vertebrate Zoology, Biological faculty, Lomonosov Moscow State University, Moscow, GSP-1, 119991, Russia.

E-mail: [email protected] author. E-mail: [email protected]

Abstract

We describe a new species of skink in the genus Eumeces Wiegmann 1834 from Iran. Eumeces persicus sp. nov. is a me-

dium-sized skink, distinguished by two clear, wide, and brown lateral lines extending from the ear opening to the

hindlimbs, with scattered light orange spots, and two median rows of dorsal scales broadly enlarged in eight longitudinal

rows. The new species ranges from southern Tehran to Kerman Province along the eastern slopes of the Zagros Mountains

towards the Iranian plateau. We provide morphological comparisons of the new species with other Eumeces species from

the region and molecular analyses of two mitochondrial markers (16S and Cytb). We also present taxonomic and phylo-

genetic accounts, with an updated identification key for the genus Eumeces in Iran and surrounding regions.

Key words: Eumeces persicus sp. nov., Iranian Plateau, Morphology, Phylogeny, Skink

Introduction

The genus Eumeces (senso stricto) Wiegmann 1834 is classified as the Afro–Central Asian clade within old

Eumeces sensu lato group, incorporating the type species of the genus (Schmitz et al. 2004; Brandley et al. 2011).

Molecular and morphological studies on Eumeces have provided radical splitting of the genus (Griffith et al. 2000;

Schmitz et al. 2004; Brandley et al. 2011 and 2012). The Afro–Central Asian clade is currently comprised of five

species classified under Eumeces senso stricto: E. algeriensis Peters, 1864; E. blythianus (Anderson, 1871); E.

cholistanensis Masroor, 2009; E. indothalensis Khan & Khan, 1997; and E. schneiderii (Daudin, 1802). Most

researchers (e.g., Anderson 1999; Sindaco & Jeremcenko 2008; Kumlutas et al. 2007; Perera et al. 2012) have

grouped two of the five species and classified them under the schneiderii group (i.e., E. schneiderii and E.

algeriensis). The schneiderii group consists of seven subspecies: (1) E. schneiderii schneiderii (Daudin, 1802); (2)

E. s. pavimentatus (Geoffroy Saint-Hilaire, 1827); (3) E. s. princeps (Eichwald, 1839); (4) E. s. zarudnyi Nikolsky,

1899; (5) E. s. barani Kumlutas, Arikan, Ilgaz & Kaska 2007; (6) E. algeriensis algeriensis (Peters, 1864); and (7)

E. a. meridionalis Domergue, 1901. Eumeces was presented as a paraphyletic genus in previous studies, and even

after excluding many Oriental and Nearctic taxa (e.g., Plestiodon), it still remains paraphyletic in respect to the

genera Scincus and Scincopus (Schmitz et al. 2004; Carranza et al. 2008; Pyron et al. 2013). From sister group

relationships, Arnold and Leviton (1977) stated that the genera Scincus and Scincopus are descendants of E.

schneiderii and that the genus Scincopus is a sister group to E. algeriensis.

Accepted by A. Datta-Roy: 23 Jun. 2017; published: 15 Sept. 2017 289

The recognized Iranian members of the genus are E. schneiderii princeps and E. s. zarudnyi. The former taxon

is widely distributed along the Zagros Mountains from northwestern to southwestern Iran and across the Elburz

Mountains from western to eastern Iran (Anderson 1991; Smid et al. 2014). In these regions, it is known to be

distributed in mountainous habitats, hillsides, and margin of agricultural lands. The E. s. zarudnyi occurs in

southern, southeastern, and eastern Iran, in flat plains and sandy deserts, but it is absent from mountains and

foothills, which serve as barriers to their dispersal (Anderson 1991). (Fig. 1).

In this study, we report a new species of Eumeces from Iran, found in the central Iranian plains and along the

eastern slopes of the Zagros Mountains (Fig. 1) and provide taxonomic accounts of species of the genus Eumeces

in Iran.

FIGURE 1. Distribution map for Eumeces persicus sp. nov. and other congeners. The red square represents the type locality in

Tehran Province.

Material and methods

The findings of this study incorporate two separate and parallel field expeditions in Iran from 2011 to 2014. The

two expeditions independently found the current new species from two extreme distribution points, one from

Tehran (the northern limit) and one from Kerman Province (the southern limit). Three specimens and one tail that

belong to an escaped specimen were collected, in which the tail was used for the molecular analyses only. One of

the three collected specimens was deposited in the Razi University Zoological Museum collection (RUZM;

RUZM-SE-07) in 75% alcohol and the other two specimens were deposited in the collection of Zoological

Museum of Moscow State University (ZMMU R-14723 and ZMMU R-15005). In addition, the single tail was

deposited in Hakim Sabzavari University Zoological Museum with the code ERP 6506. Sampling localities are

presented in Fig. 1 and corresponding details have been provided in Table 1.

Morphological examinations. Morphological characters of the new species were compared with the other

known congeners for which data were available from the literature (e.g., Taylor 1935; Minton 1966; Khan 1987,

2006; Masroor 2009). The following morphological characters (16 metric and 16 meristic characters) were

examined as previously used in other studies (e.g., Taylor 1935; Minton 1966; Khan 1987, 2006; Masroor 2009).

For morphometric measurements, we used a digital caliper to 0.01 mm accuracy as follows: Snout to vent length,

from tip of snout to caudal edge of anal scales (SVL); Tail length, from caudal edge of anal scales to tip of tail, on

complete original tails only (TL); Ratio of snout to vent length/Tail length (SVL/TL); Head length, from tip of

FAIZI ET AL.290 · Zootaxa 4320 (2) © 2017 Magnolia Press

snout to posterior edge of tympanum (HL); Head width, at the widest point of head (HW); ratio of head length to

head width (HL/HW); Head height, from upper surface of head to lower surface of chin (HH); length of forelimb

(LFO); length of hindlimb (LHL); ratio of length of forelimb to length of hindlimb (LFO/LHL); Eye-nostril length,

length from eye to nostril (ENL); Eye-ear length, length from eye to tympanum (EEL); Neck length, from

tympanum to scapula bone (NL); Length of femur (LF); Length of leg (LL); Number of supralabials (NSL);

Number of infralabials (NIL); Number of longitudinal rows of ventral scales (NVP); Number of dorsal scales at

midbody (NDS); Number of postmental pairs (NPP); Pairs of nuchals (PN); subdigital lamella of 1–4th toe (SL1–

4thT); subdigital lamella of 1–4th finger (SL1–4thF).

TABLE 1. Specimens used in this study for the molecular analyses, including collecting locality, collection numbers,

exact coordination and GenBank accession numbers. Museum code abbreviations: ERP (=Eskandar Rastegar -Pouyani);

RUZM (Razi University Zoological Museum; ZMMU (Zoological Museum Moscow University). ●Data from Griffith et

al. 2006; *Data from Carranza et al., 2008.

Molecular analyses. For the molecular analyses, 20 sequences of E. s. princeps (n= 9), E. zarudnyi (n=3), E. s.

pavimentatus (n=2), E. s. schneiderii (n=2), and Eumeces persicus sp. nov. (n=4) were used in this study. One

sequence each of Chalcides ocellatus and Eurylepis taeniolatus were retrieved from Genbank and were selected as

outgroups based on a previous study (Carranza et al. 2008). The Eumeces sequences were used to clarify the

phylogenetic position and validate the systematics and taxonomy of the new species in comparison to other known

congeners.

Species Locality Museum Code Coordinates 16S/Cytb

Eurylepis taeniolatus Iran, Khorasan Razavi MVZ246017● 35.24114 58.51394 JQ344268/JQ344269

Chalcides ocellatus Iran ERP 3052 27.88819 51.8856 KY436552/KY436524

E. s. princeps Iran, Khorasan Razavi ERP 914 36.31679 60.47604 KY436553/KY436525

E. s. princeps Iran, Fars province ERP 1437 30.23395 53.21785 KY436554/KY436526

E. s. princeps Iran, Khorasan Razavi ERP 1443 35.24114 58.51394 KY436555/KY436527



E. s. princeps Iran, Kermanshah province RUZM-SE-01 34.10438 46.56466 KY436558/KY436530

E. s. princeps Iran, Kurdistan province RUZM-SE-02 35.41896 46.95688 KY436559/KY436531

E. s. princeps Iran, Ilam prov., Dinarkouh RUZM-SE-03 32.9594 47.43134 KY436560/KY436532

E. s. princeps Uzbekistan, Navoi district ZMMU

R-11048

37.35035 68.45418 KY436565/KY436537

E. s. pavimentatus Turkey, Karaotlak E8121.16

(BEV1594)*

37.46358 34.46858 EU278069/EU278235

E. s. pavimentatus Turkey, Coastal dunes after

Karatas

E8121.17

(BEV1566)*

38.00145 35.47796 EU278070/EU278234

E. s. zarudnyi Iran, Qeshm Island RUZM-SE-04 26.85097 55.99425 KY436573/KY436545

E. s. zarudnyi Iran, Zabol RUZM-SE-05 31.14677 61.80003 KY436574/KY436546

E. s. zarudnyi Iran, Qeshm Island RUZM-SE-06 26.85098 55.99433 KY436575/KY436547

E. persicus sp. nov Iran, Kerman province ZMMU

R-14723

28.41604 58.30814 KY436576/KY436548

E. persicus sp. nov Iran, Kerman province ZMMU

R-15005

28.41604 58.30814 KY436577/KY436549

E. persicus sp. nov Iran, Tehran province RUZM-SE-07 35.39758 51.30911 KY436578/KY436550

E. persicus sp. nov Iran, Tehran province ERP 6506 35.39758 51.30911 KY436579/KY436551

E. s. schneiderii-1 Egypt E1009.7● 30.24169 29.20791 EU278071/EU278236

E. s. schneiderii-2 Egypt E1009.6● 27.86844 30.46279 EU278072/EU278237

Zootaxa 4320 (2) © 2017 Magnolia Press · 291NEW EUMECES FROM IRAN

Genomic DNA was extracted from thigh muscles and isolated using non-organic DNA Extraction Procedure,

Proteinase K and Salting out (Maurya et al., 2013). We performed PCR reactions to amplify partial regions of non-

protein coding 16S rRNA (573 bp) and the protein-coding gene Cytochrome b (Cytb, 642 bp). The PCR conditions

for both genes were as follows: 4 minutes at 94°C for denaturation, followed by 36 cycles of 40 seconds at 94°C,

40 seconds at 56°C for annealing and 1:30 minutes at 72°C for primer extension, then a final 10 minutes incubation

at 72°C. Primers and source references are presented in Table 2. The compiled alignment comprised of 22

sequences of the partial sequences of the 16S and Cytochrome b. The amplified genes were sequenced with an

automatic DNA sequencer by relevant protocols of Macrogen Company, South Korea.

TABLE 2. List of the primers, their sequences and references.

The alignment was performed using MAFFT v.7 (Katoh & Standley 2013). We used MEGA v.7 (Kumar et al.

2016) to translate the coding gene (Cytb) to amino acid to check for stop codons, and to calculate the inter-specific

uncorrected p-distances. We used MrModeltest 2.3 (Nylander 2004) to identify the best evolutionary models under

the Akaike information criteria (Posada & Buckley 2004) for each gene independently. Phylogenetic analyses were

performed using maximum likelihood (ML) and Bayesian Inference (BI) methods. ML analysis was performed

with RAxML v.7.2.8 (Stamatakis 2006) using the concatenated dataset (16S+Cytb). We implemented RAxML GUI

v.1.3 (Silvestro & Michalak 2012) while using a GTRGAMMA model of sequence evolution, for 10 runs, using

1000 bootstrap replicates (Felsenstein 1985). The analysis involved 22 nucleotide sequences. Codon positions

included were 1st+2nd+3rd+Noncoding. All positions with less than 95% site coverage were eliminated. That is,

fewer than 5% alignment gaps, missing data, and ambiguous bases were allowed at any position.

Bayesian Inference analysis run for 50*106 steps, sampling states every 1000 generations performed with

BEAST v1.7.5 (Drummond & Rambaut 2007). Here we used a simple model of speciation, Calibrated Yule model

(Heled & Drummond 2012) as the tree prior that is more appropriate when considering sequences from di?erent

species. For clock model, we left the selection at the default value of a strict molecular clock. In the site model

panel, GTR selected for 16S and HKY for Cytb both as invariant sites + gamma heterogeneity as substitution

model. The convergence in runs was assessed using TRACER v.1.6 (Rambaut et al. 2014) wherein we checked for

adequate effective sample sizes (ESS values>200). LogCombiner v.1.7.5 used to combine the runs and

TreeAnnotator v.1.7.4 (Drummond et al. 2012) to summarize the sampled trees after discarding initial 25% ‘burn-

in’ states, both implemented in the BEAST package.

Results

Molecular analyses. The final dataset for phylogenetic analyses included partial mitochondrial fragments of 16S

and Cytb from 22 individuals. Selected evolutionary models and prior specifications were GTR+I+G for 16S and

HKY+I+G for Cytb.

The percentages of pairwise uncorrected p-distances of 16S and Cytb among studied taxa and two outgroups

are presented in Table 3. Genetic differences among subspecies is 6–7% for Cytb and 1–2% for 16S. However, the

same distance among Eumeces persicus sp. nov. and the current subspecies is 13–17% between for Cytb, and 11%

for 16S. Similarly, the distance between E. zarudnyi and the current subspecies is 15–18 for Cytb and 12–13% for

16S. Also, the calculated genetic distance between E. persicus sp. nov. and E. zarudnyi was 12% for Cytb and 5%

for 16S gene (Table 3).

Gene Primer Sequence 5′-3′ Reference

Cytb L14724 (F) CGAAGCTTGATATGAAAAACCATCGTTG Kocher et al., 1998;

Meyer et al., 1990

H16064 (R) CTTTGGTTTACAAGAACAATGCTTTA Burbrink et al. 2000

L14919 (F) AACCACCGTTGTTATTCAACT de Queiroz et al. (2002)

Ei700r (R) GGGGTGAAAGGGGATTTT(AG)TC Rastegar Pouyani et al., 2009

16S 16SL (F) GCCTGTTTATCAAAAACAT Palumbi et al. (1991)

16SH (R) CCGGTCTGAACTCAGATCACGT Palumbi et al. (1991)


TABLE 3. Uncorrected pairwise genetic differences (p-distance) for 16S (upper-right) and Cytb (lower-left) among

different species/subspecies of the genus Eumeces.

The reconstructed trees using both ML and BI methods resulted in identical tree topologies with relatively

high bootstrap and posterior probability values, respectively (Fig. 2). The evolutionary history inferred using ML

was based on the General Time Reversible model. The tree with the highest log likelihood (-3163.8500) is shown

(Fig. 2B).

FIGURE 2. The Bayesian tree (A) and the ML tree (B) based on the concatenated dataset. Numbers next to the nodes denote

posterior probability (in A) and bootstrap support values (in B). Nodes without values have 100% support. The colors of the

taxa are according to the distribution map in Figure 1.

The resultant trees revealed two main clades. One included E. persicus sp. nov. and E. zarudnyi, and the other

included (E. s. princeps + E. s. pavimentatus + E. s. schneiderii) with high posterior probability (0.95) and

relatively low bootstrap support value (70%). The phylogenetic position of E. zarudnyi and its genetic distance in

comparison to other subspecies within the E. schneiderii complex points to the requirement of its assignment as a

distinct species. Therefore, we hereafter consider E. schneiderii zarudnyi as a valid species and represent it as E.

zarudnyi. It differs from the schneiderii group in coloration, and it occupies lower elevations. According to a

phylogenetic species concept, mitochondrial DNA sequences distinguishes it as a distinct species from other

Taxa 1 2 3 4 5 6 7

1- Chalcides ocellatus 0.13 0.12 0.12 0.16 0.12 0.13

2- Eurylepis taeniolatus 0.19 0.11 0.11 0.13 0.11 0.12

3- E. s. princeps 0.16 0.18 0.03 0.13 0.02 0.11

4- E. s. pavimentatus 0.19 0.22 0.08 0.13 0.01 0.11

5- E. zarudnyi 0.22 0.20 0.16 0.18 0.12 0.05

6- E. s. schneiderii 0.17 0.18 0.06 0.07 0.16 0.11

7- Eumeces persicus sp.nov 0.17 0.18 0.14 0.17 0.12 0.15


subspecies of E. schneiderii. Results of ML/BI analyses revealed a distinct phylogenetic position for E. persicus

sp. nov. and revealed a sister relationship with E. zarudnyi as the result of Bayesian and ML analyses showed with

statistically high Bayesian posterior probability (1.00) and bootstrap support values (100) (Fig. 2). Delineating E.

persicus sp. nov. along with E. zarudnyi from E. schneiderii subspecies based on molecular data provides a strong

basis for recognizing this lineage as distinct and well differentiated from E. schneiderii ssp. The taxonomy and

systematic status of E. persicus and E. zarudnyi are presented in the following sections.

Eumeces persicus sp. nov.

Proposed vernacular name: Persian striped skink

(Figs. 3–6; Tables 3–5)

Holotype: RUZM-SE-07 (Razi University Zoological Museum), an adult male, collected 28 km southwest of

Tehran Province from flat plains around the Imam Khomaini Airport (IKA), at 528078 E, 3917723 N, at an

elevation of about 1100m, collected by Hiva Faizi, on 26th of June 2011.

Paratypes: two specimens, one male ZMMU R-14723 (SVL: 101.8 mm; TL: 151.2 mm) and one female

ZMMU R-15005 (SVL: 96.2 mm, TL:157 mm) were collocated by Roman Nazarov, 04.05.2014 in Kerman

Province, about 20 km SE of Orzueeyeh city, N 28 26; E 56 10, h 1047m a.s.l. This locality is about 900 km from

the type locality.

Other material. A single tail (ERP 6506) was collected at the type locality by the authors. It was solely for the

molecular analyses.

Etymology. The species epithet “persicus” is an adjective that refers to the current known distribution of the

new species—Iran (=Persia).

Diagnosis (Table 4). The new striped, small-bodied Eumeces persicus sp. nov. differs in morphology, habitat

characteristics, and behavior from the uniform-colored, large-bodied E. s. princeps and E. zarudnyi. The new

species is considered a desert dweller in the plains of central Iranian plateau in the eastern slopes of the Zagros

Mountains. It is a medium-sized skink, (SVL: 103.27; TL: 115.45), distinguished by two clear, wide, and brown

lateral lines extending from the ear opening to the hindlimbs, and two relatively less distinct brown lines along both

sides of vertebral line, with scattered light orange spots in life, two median rows of dorsal scale widely enlarged, in

eight longitudinal rows. Eyelids with transparent discs (Fig. 3).

Due to relatively similarity in overall body forms in Eumeces persicus sp. nov. and E. cholistanensis and their

geographical vicinity, we present some pholidosis characteristics to clarify the distinctness and validation of these

species (Table 4). Some descriptive differences are as follows: the nasal scale slightly contacts the first supralabial,

but not touching the second one; in contrast, in E. cholistanensis (and also in E. s. princeps) the nasal scale is in

contact with first supralabial; the interparietal and frontal are in the same shape, the length of the former is more

than half the length of the latter in E. cholistanensis, while in E. persicus sp.nov the length of frontal is greater than

the length of interparietal; the frontonasal in E. cholistanensis is slightly smaller than each prefrontal, wider than

long, its width less than one and one-half times its length, extending considerably forward between the supranasals,

which are laterally in contact with nasals which is exactly in reverse situation in E. persicus sp. nov. There are

trianglar prefrontals in E. persicus sp. nov. in comparison with hexagonal prefrontals in E. cholistanensis. Ear

openings are vertical with five preauricular lobules in E. persicus sp. nov., in contrast to there being no lobules on

the ear openings of E. cholistanensis. The number of subdigital lamellae under the toes and fingers are greater in E.

persicus sp. nov. than in E. cholistanensis (Fig. 3 and Table 4).

Description of Holotype. Upper head scales relatively convex; head relatively short (HL: 20.08 mm); nasal

scale contacting the first supralabial not touching the second one; rhomboid frontonasal with equal length and

width relatively larger than trianglar prefrontals; frontal hexagonal, distinctly longer than its width; rostral

separating nasal shields, slightly broader than high, triangular, distinctly broader than frontonasal in dorsal view;

frontal shield at middle of head as long as its distance from both rostral and occipital with median points into

frontonasals anteriorly and frontoparietals posteriorly, distinctly longer than width, its length more than two times

its greatest width; frontoparietals slightly smaller than prefrontals, relatively hexagonal with a median suture in line

with the prefrontals; seven supraoculars with three enlarged median ones; frontal is bordered by three median

supraoculars; 4–5 supra ciliaries on each side, in direct contact with supraoculars; interparietal is longer than broad,


more than half of the frontal and twice as long as frontonasal, bordered by first pair of nuchals posteriorly, abruptly

truncated at both ends; parietals relatively flat and nearly as wide as its length; body scales regular in longitudinal

rows juxtaposing relatively; two median dorsal rows enlarged, much wider than long and extended from the

nuchals to tail dorsum; 67 paired middorsal enlarged scales, in a single longitudinal row, from interparietal to mid

hindlimbs; 71 ventral scales in a single longitudinal row from postmental to anal; eight supra- and seven

infralabials; 12 ventral series in longitudinal rows along the belly; 24 scales around midbody; 19 rows of lamella

under the fourth finger and 18 under the fourth toe; ear openings vertical with five preauricular lobules, the first

one above the largest and the last one the smallest; mental shield narrower than rostral; three azygous postmentals,

being broader backward, all broader than mental shield; four pairs of chain shields, first pair not in contact fully,

separated by one to four scales backward; two large median preanal shields, 26 scales around the tail base just

posterior to vent.

Coloration in life. Some scattered orange spots with very low density on the dorsal surface and a faint yellow/

orange color on supralabial scales on both sides of the body; two vivid wide, dark brown stripes on lateral sides,

extended from ear opening to hindlimbs; two median light brown dorsal stripes from mid forelimbs to mid

hindlimbs; head uniformly brown-olive; lips, chain, and ventral surfaces whitish (Fig. 4).

FIGURE 3. Holotype of Eumeces persicus sp. nov. RUZM-SE-07, dorsal (A) and ventral (B) views of the head, and a view of

palmar region (C).


TABLE 4. Metric and meristic characters for Eumeces persicus sp. nov. (holotype) and its congeners. Measurements are

presented in millimeter.

Variation and comparisons. There are some metric and meristic differences within the type series which are

most likely due to geographic variation and the great distance between the localities of the holotype and paratypes

(Table 5 and Fig. 5). E. persicus sp. nov. differs from all other species/subspecies of the genus Eumeces by some

pholidosis characteristics described above with more details and distinctly different color pattern including regular

brown lines dorsally and laterally. A comparison of the new species with some other species/subspecies is included

in the phylogenetic tree presented in Fig. 5.

There are some distinct morphological difference between E. persicus sp. nov. and most of its congeners

(Table 4). The coloration of the new species differs from that of E. schneiderii ssp and E. algeriensis by the striped

laterals with dark brown stripes. There are five distinct preauricular lobules in E. persicus sp.nov in comparison

with the absence of lobules in the ear openings of E. cholistanensis. Three azygous postmentals in the new species

differ from the single postmental in E. blythianus and a different color pattern and stripes in comparison with E.

indothalensisis. Eumeces persicus sp. nov. is the third Eumeces species known from Iran, and the tenth taxon

(includes species and subspecies) described within the genus.

References This study Minton, 1966 Khan, 1997, 2006 Masroor, 2009

Characters E. persicus sp. nov. E. s. princeps E. zarudnyi E. blythianus E. indothalensis E. cholistanensis

SVL 103.27 106–140 69–145 85–111 57–60 88.2–102.7

TL 115.45 112–210 78–125 140–170 94–259 148.5

SVL/TL 0.9 0.9–0.7 0.89–1.16 0.61–0.65 0.20–0.61 0.7

HL 20.08 18.21–27.25 17.85–19.5 15 13–17 21.1–23.3

WH 16.21 10.02–18.45 11.7–15.91 - 9–11 13.1–15

HL/HW 1.23 1.8–1.48 1.3–1.52 - 1.4–1.5 1.6–1.5

HH 11.08 10.88–16.13 13.25–16.5 - - 11.6–12.4

LFL 30.14 25.94–37.44 28.65–34.1 - - -

LHL 45.16 41.46–57.12 47.4–56.2 - - -

LFL/LHL 0.67 0.6–0.7 0.6–0.61 - - -

ENL 5.27 6.45–7.08 5.48–6.98 - 4 7.8–8.4

EEL 9.87 9.46–10.25 8.25–10.24 - 9 11–12.4

NL 15.18 16.78 –17.58 15.74–17.0 - - -

LF 19.40 34.08–35.02 28.45–32.1 - - -

LL 10.54 15.8–16.74 14.8–16.5 - - -

LA 7.14 10.8–11.02 11.24–12.4 - - -

NSL 8 8–9 9 8 8 8–10

NIL 7 6–8 8 6–7 6 7–8

NVP 71 67–75 68–70 - 60–63 64–67

NDS 24 26–30 32–34 28–30 26–27 26–28

NPP 3 2–3 2–4 1 2 2

PN 4 4–5 3–4 3 1 2–6

SL1F 8 8–10 10–11 - 6–7 6–7

SL2F 11 12–13 12–14 - 9–11 9–10

SL3F 16 16–18 15–16 - 10–11 10–11

SL4F 18 18–19 20–21 - 9–11 9–11

SL1T 9 10–11 12–14 - 6–7 6–8

SL2T 12 13–14 19–21 - 9–10 9

SL3T 16 17–18 21–22 - 12–13 12–13

SL4T 19 21–23 26–27 - 16–17 15–16


Habitat characteristics (Fig. 6). The habitat of the new species is composed of broad flat vegetated plains

with scattered bushes and soft soils. We noticed at least three borrows in the habitats that were most likely used for

escaping and nesting. The species is usually found in the course of flood plains or seasonal waterways. E. persicus

sp. nov was generally seen to inhibit lower elevations (from 1100–2100 m above sea level) in the central Iranian

Plateau) and drier environment than the larger, uniform morphs (e.g., E. schneiderii).

FIGURE 4. (A) Holotype of Eumeces persicus sp. nov RUZM-SE-07. Inset shows close-up of the lateral side of the head. (B)

Paratype specimen (ZMMU R-14723-1) alive in its habitat.


FIGURE 5. Photographs of live specimens of Eumeces persicus sp. nov. in comparison with some other species/subspecies

included in phylogenetic tree presented in Figure 2. (A) E. persicus sp. nov. (B) E. zarudnyi (C) E. s. schneiderii (D) E. s.

pavimentatus (E) E. s. princeps.


Distribution. The new species is widely distributed at the eastern Zagros Mountain slopes, in the central plains

of Iran from the deserts of southern Tehran (holotype) to Kerman Province (paratypes) encompassing a distribution

range of about 900 km (Fig.1). To date, only two localities are known for E. persicus sp. nov. and its distribution is

most likely much wider. Further investigation is necessary to find more records in other regions with similar

habitats situated between the two current localities. Eumeces persicus sp. nov. is also found in sympatry with other

reptile species including snakes and lizards such as Bunopus crassicauda, Tenuidactylus caspium, Trachylepis

aurata, Varanus griseus, Spalerosophis diadema, Malpolon insignitus, Lytorhynchus ridgewayi and Platyceps

karelini, and specifically in close syntopy with Trapelus agilis.

TABLE 5. Metric and meristic characters for Eumeces persicus sp. nov. type series. Measurements are presented in

millimeter. Abbreviation of variables are detailed in the Materials and Methods section.

Variable Holotype Paratype 1 Paratype 2

RUZM-SE-07 ZMMU R-14723-1 ZMMU R-14723-2

Male Female Female

SVL 103.27 101.8 96.2

TL 115.45 151.2 157

SVL/TL 0.9 0.67 0.6

HL 20.08 20.0 19.7

HW 16.21 14.6 12.6

HL/HW 1.23 1.37 1.56

HH 11.08 11.8 8.8

LFL 30.14 30.2 27.2

LHL 45.16 45.8 42.5

LFL/LHL 0.67 0.65 0.64

ENL 5.27 5.2 4.8

EEL 9.87 8.7 7.3

NL 15.18 14.2 13.6

LF 19.40 15.2 14.7

LL 10.54 12.2 12.2

LA 7.14 8.7 9.5

NSL 8 8 8\8

NIL 7 6 6\7

NVP 71 68 71

NDS 24 29 30

NPP 3 3 3

PN 4 4 4

SL1F 8 6 6

SL2F 11 9 10

SL3F 16 11 14

SL4F 18 14 13

SL5F 8 8 9

SL1T 9 8 10

SL2T 12 9 11

SL3T 16 12 14

SL4T 19 17 18

SL5T 10 11 11


FIGURE 6. Habitat of Eumeces persicus sp. nov., south of Tehran (type locality, A) and Kerman (B).

Key to the species of Eumeces in Iran and neighboring regions

1a Series of dark brown stripes on sides and dorsum alternating with light narrower stripes. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2

1b Nearly uniform grey or olive above, without dorsal stripes or with colored lateral lines. . . . . . . . . . . . . . . .Eumeces blythianus

2b Two or more azygous postmentals . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3


3a Nasal scale reaches the second supralabial . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .Eumeces cholistanensis

3b Nasal scale dose not touch the second supralabial . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .4

4a Dorsal pattern with 5–7 clear and distinct dark brown stripes separated by alternating light narrower stripes, extended on to the

tail . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .Eumeces indothalensis

4b Two broad lateral brown stripes from ear opening to hind-limbs, not extending on to the tail . . . . . .Eumeces persicus sp. nov.

5a No lateral light colored line (yellow or red orange) present . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Eumeces algeriensis

5b A colored lateral line from mouth margins to middle of body . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6

6a A distinct, light yellow lateral line present . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Eumeces schneiderii

6b A reddish or red brick lateralline present . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .Eumeces zarudnyi

Discussion

It is likely that ancestors of the genus Eumeces sensu lato originated in Asia and then spread in two directions,

towards Africa (as a western lineage) and America (as an eastern lineage) (Taylor 1935; Brandley et al. 2012). The

western lineage led to a group including Eumeces senso stricto (the E. schneiderii group of Taylor 1935), Scincus,

and Scincopus. All these taxa form a clade that is hypothesized to have originated in Central Asia or the Middle

East (about 14 million years ago), and then spread out to North Africa (Carranza et al. 2008; Brandley et al. 2010).

The far eastern forms mainly dispersed to North America through the Bering isthmus to form Plestiodon (about

18–30 million years ago) that is clearly an older radiation than Eumeces senso stricto (Brandley et al. 2011, 2012).

The genus Eumeces sensu stricto has eastern and western geographic form. In fact, E. persicus sp. nov. has a series

of dark brown stripes on its sides and dorsum alternating with narrower light stripes, which is phenotypically more

similar to the eastern forms of the genus (E. indothalensis, E. blythianus and E. cholistanensis) which are

distributed in Pakistan and Afghanistan. Color patterns that are nearly uniform grey or olive above, without dorsal

stripes or lines or with colored lines laterally are distinctive between eastern forms and the western forms and these

characteristics, grouped E. zarudnyi with the western forms which are E. schneiderii ssp occurring in the Iranian

Plateau, Caucasia and Anatolia, and E. algeriensis subspecies occurring in Morocco and Algeria. Despite the

similarities in overall external morphology, E. zarudnyi is phylogenetically closer to E. persicus sp. nov than to the

us E. schneiderii complex.

Unfortunately, there are no sequences available in GenBank for the eastern species. Therefore, the missing

species/subspecies ranging in Pakistan and Afghanistan prevent us from revealing their phylogenetic positions in

comparison with the existing Iranian and western forms of the genus.

Eumeces persicus sp. nov. is restricted to flat habitats in central Iran and it seems that some ecological and

biogeographic barriers have driven the evolution of this species. Dasht-e-Kavir and Kavir-e-Lout, are two large

sand desert regions located at the central and eastern parts of the Iranian Plateau. These two deserts may have acted

as biogeographic and physical barriers for dispersal of Eumeces persicus sp. nov. Furthermore, the mountainous

ecosystems of the northern (i.e., the Elborz and Kopet Dagh mountains) and western (i.e., the Zagros Mountains)

parts of these deserts are connected and restrict the distribution of Eumeces persicus sp. nov. These biogeographic

barriers have been suggested to drive the cladogenesis of other reptiles in the region (e.g., Macey et al. 1998;

Heidari et al. 2014; Rastegar-Poyani et al. 2009; Tamar et al. 2016).

The phylogenetic tree and estimated genetic distances presented in this study suggest there is subspecific

genetic variation and divergence in E. schneiderii populations in Iran and Turkey. However, analysis of these

relationships is beyond the scope of the present study.

A strongly supported ancestral dichotomy between a clade containing E. zarudnyi-Eumeces persicus sp. nov.

and the clade of E. schneiderii subspecies is provided in all trees. There is strong support and stable phylogenetic

position for the sister relationships and phylogenetic evidence to show species level for E. persicus sp. nov., and E.

zarudnyi and elevating the latter to a fully separate species in all resulted trees.

Taxonomic accounts

Our phylogenetic analysis recovered E. persicus sp. nov. and E. zarudnyi at the base of the trees, whereas E. s.

princeps, E. s. pavimentatus and E. s. schneiderii were nested at the most derived node, sister to the clade

containing the new species. These results show that E. zarudnyi is misclassified and misplaced as a subspecies of


E. schneiderii, and even that they are not sister taxa. In fact, although Taylor 1935 grouped the four current

subspecies into E. schneiderii complex when he published his revision in 1935, this does not automatically mean

that the four subspecies are valid taxonomically as separate species or subspecies. Results of phylogenetic trees and

genetic distances treat E. zarudnyi here as a full species and not as a subspecies of E. schneiderii. Eumeces persicus

sp. nov. and E. zarudnyi, as sister taxa, form a deeply divergent lineage and well-supported clade that place E.

zarudnyi outside the other subspecies of E. schneiderii complex rather than within it, contrary to our expectation.

(Fig. 2).

The clade consisting E. persicus sp nov. and E. zarudnyi is distributed in lowlands and true deserts of central

and southern Iran, but the members of the clade consisting of the subspecies of E. schneiderii is widely distributed

from Uzbekistan westward through Iran, Armenia and Turkey and occupies a variety of habitats including both

lowlands and highland regions. The clade containing E. schneiderii subspecies represent some subclades

corresponding to subspecific level and contained at least three subspecies as E. s. princeps, E. s. pavimentatus, and

E. s. schneiderii. These taxa are in congruence with traditional taxonomy of the subspecies and show some

geographical concordance. Perera et al. (2012) and Carranza et al. (2008) analyses based on mitochondrial DNA

showed the same validation for these subspecies.

Therefore, neither “E. persicus”, nor “E. zarudnyi” are nested among other subspecies of E. schneiderii

subspecies and they are completely placed in a deeply divergent separate clade in all phylogenetic trees. Therefore,

we conclude and strongly believe that “E. persicus” (and “E. zarudnyi”) are true and valid species and we assign

these taxa to a full species. In addition, genetic distances among E. persicus sp. nov. along with E. zarudnyi with

other subspecies is outside the range of subspecific level genetic distance range (Table 2). Additional molecular

analyses with a broader sampling is required in order to determine the phylogenetic relationships among Eumeces

lizards.

Acknowledgements

We gratefully acknowledge the funding received towards a PhD thesis research project from the Razi University

and Science Ministry of Iran, research project of MSU Zoological Museum (АААА-А16-116021660077-3) and

with financial support by a grant from the Russian Science Foundation (РНФ, project 14-50-00029). We would

like to thank Dr. Kraig Adler (Cornell University) and Dr. Karin Tamar for their very careful reading of the

manuscript and giving such constructive comments that substantially improved the quality of the manuscript. The

authors are also very grateful to wild life photographer Fariborz Heidari. We thank the anonymous reviewers for

their careful reading of our manuscript and their many insightful comments and suggestions.

References

Anderson, S.C. (1999) The Lizards of Iran. Society for the Study of Amphibians and Reptiles, Ithaca, New York, 415 pp.

Arnold, E.N. & Leviton, A.E. (1977) A revision of the lizard genus Scincus (Reptilia: Scincidae). Bulletin of the British

Museum (Natural History), Zoology, 3, 187–248.

Beltz, E. (2006) Scientific and Common Names of the Reptiles and Amphibians of North America—Explained. Available

from: http://ebeltz.net/herps/etymain.html#Snakes (accessed 12 June 2017)

Brandley, M.C., Schmitz, A. & Reeder, T.W. (2005) Partitioned Bayesian analyses, partition choice, and the phylogenetic

relationships of Scincid lizards. Systematic Biology, 54, 373–390.

https://doi.org/10.1080/10635150590946808

Brandley, M.C., Wang, Y., Guo, X., de Oca, A.N., Fería-Ortíz, M., Hikida, T. & Ota, H. (2011) Accommodating heterogenous

rates of evolution in molecular divergence dating methods: an example using intercontinental dispersal of Plestiodon

(Eumeces) lizards. Systematic Biology, 60, 3–15.

https://doi.org/10.1093/sysbio/syq045

Brandley, M.C., Hidetoshi, O.F., Tsutomu, H., Adrián, N.M., Manuel, F.O., Xianguang, G. & Yuezhao, W. (2012) The

phylogenetic systematics of blue-tailed skinks (Plestiodon) and the family Scincidae. Zoological Journal of the Linnaean

Society, 165, 163–189.

https://doi.org/10.1111/j.1096-3642.2011.00801.x

Burbrink, F.T., Lawson, R. & Slowinski, J.B. (2000) Mitochondrial DNA phylogeography of the polytypic North American

ratsnake (Elaphe obsoleta): a critique of the subspecies concept. Evolution, 54, 2107–2118.


https://doi.org/10.1111/j.0014-3820.2000.tb01253.x

Carranza, S., Arnold, E., Geniez, P., Roca, J. & Mateo, J. (2008) Radiation, multiple dispersal and parallelism in the skinks,

Chalcides and Sphenops (Squamata: Scincidae), with comments on Scincus and Scincopus and the age of the Sahara

Desert. Molecular Phylogenetics and Evolution, 46, 1071–1094.

https://doi.org/10.1016/j.ympev.2007.11.018

De Queiroz, A., Lawson, R. & Lemos-Espinal, J.A. (2002) Phylogenetic relationships of North American garter snakes: how

much DNA is enough? Molecular Phylogenetics and Evolution, 22, 315–329.

https://doi.org/10.1006/mpev.2001.1074

Drummond A.J. & Rambaut, A. (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology,

7, 214.

https://doi.org/10.1186/1471-2148-7-214

Griffith, H., Ngo, A. & Murphy, R.W. (2000) A cladistics evaluation of the cosmopolitan genus Eumeces Wiegmann 1834

(Reptilia, Squamata, Scincidae). Russian Journal of Herpetology, 7 (1), 1–16. ["Novoeumeces gen nov.", p. 11]

Heidari, N., Rastegar Pouyani, N., Rastegar-Pouyani, E. & Faizi, H. (2014) Molecular phylogeny and biogeography of the

genus Acanthodactylus Fitzinger, 1834 (Reptilia: Lacertidae) in Iran, inferred from mtDNA Sequences. Zootaxa, 3860 (4),

379–395.


Katoh, K. & Standley, D.M. (2013) MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance

and Usability. Molecular Biology and Evolution 30 (4), 772–780.

https://doi.org/10.1093/molbev/mst010

Khan, M.S. & Ahmed, N. (1987) On a collection of amphibians and reptiles from Baluchistan, Pakistan. Pakistan Journal of

Zoology, 19 (4), 361–370.

Khan, M.S. & Khan, M.R.Z. (1997) A new skink from the Thal desert of Pakistan. Asiatic Herpetological Research, 7, 61–67.

https://doi.org/ 10.5962/bhl.part.18856

Khan, M.S. (2006) Amphibians and reptiles of Pakistan. Krieger Publishing Company. Malabar, Florida, 311 pp.

Kumar, S., Stecher, G. & Tamura, K. (2016) MEGA7: Molecular Evolutionary Genetics Analysis version 7.0. Molecular

Biology and Evolution, 33 (7), 1870–1874.

https://doi.org/10.1093/molbev/msw054

Kumlutas, Y., Arikan, H., Ilgaz, C. & Kaska, Y. (2007) A new subspecies, Eumeces schneiderii barani n. ssp (Reptilia: Sauria:

Scincidae) from Turkey. Zootaxa, 1387 (1), 27–38.


Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Pääbo, S. & Villablance, F.X. (1989) Dynamics of mitochondrial DNA

evolution in animals: Amplification and sequencing with conserved primers. Proceedings of the National Academy of

Sciences of the United States of America, 86, 6196–6200. [PMCID: PMC297804]

https://doi.org/10.1073/pnas.86.16.6196

Lanfear, R., Calcott, B., Ho, S.Y. & Guindon, S. (2012) Partition Finder: combined selection of partitioning schemes and

substitution models for phylogenetic analyses. Molecular Biology and Evolution, 29, 1695–1701.

https://doi.org/10.1093/molbev/mss020

Masroor, R. (2009) Description of a new species of Eumeces (Sauria: Scincidae) from Pakistan. Zootaxa, 2161, 33–46.

Maurya, R., Kumar, B. & Sundar, S. (2013) Evaluation of salt-Out method for the isolation of DNA from whole blood a

pathological approach of DNA based diagnosis. International Journal of Biological & Pharmaceutical Research, 2 (2),

53–57.

Macey, J., Robert, J.A., Schulte, J.A., Ananjeva, N.B., Larson, A., Rastegar-Pouyani, N., Sakhat, M.S. & Papenfuss, T.J. (1998)

Phylogenetic Relationships among Agamid Lizards of the Laudakia caucasia Species Group: Testing Hypotheses of

Biogeographic Fragmentation and an Area Cladogram for the Iranian Plateau. Molecular Phylogenetics and Evolution, 10

(1), 118–131.

https://doi.org/10.1006/mpev.1997.0478

Meyer, A. & Wilson, A.C. (1990) Origin of tetrapods inferred from their mitochondrial-DNA affiliation to lungfish. Journal of

Molecular Evolution, 31, 359–364.

https://doi.org/10.1007/BF02106050

Minton, S.A. (1966) A contribution to the herpetology of Western Pakistan. The Bulletin of the American Museum of Natural

History, 134 (2), 28–184.

Nei, M. & Kumar, S. (2000) Molecular Evolution and Phylogenetics. Oxford University Press, New York, 352 pp.

Nylander, J.A.A. (2004) Mrmodeltest v2. Program distributed by the author. Evolutionary Biology Centre, Uppsala University.

Palumbi, S.R., Martin, A., Romano, S., McMillan, W.O., Stice, L. & Grabowski, G. (1991) The Simple Fool's Guide to PCR.

Version 2.0. Privately published, University of Hawaii, Honolulu, 45 pp.

Perera, A., Sampaio, F., Costa, S., Salvi, D. & Harris, D.J. (2012) Genetic variability and relationships within the skinks

Eumece salgeriensis and Eumeces schneideri using mitochondrial markers, African Journal of Herpetology, 61, 69–80.

https://doi.org/10.1080/21564574.2011.583284

Posada, D. & Buckley, T. (2004) Model selection and model averaging in phylogenetics: advantages of Akaike information

criterion and Bayesian approaches over likelihood ratio tests. Systematics Biology, 53, 793–808.


https://doi.org/10.1080/10635150490522304

Pyron, R.A., Burbrink, F.T. & Wiens, J.J. (2013) A phylogeny and revised classification of Squamata, including 4161 species of

lizards and snakes. BMC Evolutionary Biology, 13, 93.

https://doi.org/ 10.5061/dryad.82h0m/4

Rastegar Pouyani, E., Rastegar Pouyani, N., Kazemi Noureini, S., Joger, U. & Wink, M. (2009) Molecular phylogeny of the

Eremias persica complex of the Iranian plateau (Reptilia: Lacertidae), based on mtDNA sequences. Zoological Journal of

the Linnean Society, 158 (3), 641–660.

https://doi.org/ 10.1111/j.1096-3642.2009.00553.x

Schmitz, A., Mausfeld, P. & Embert, D. (2004) Molecular studies on the genus Eumeces Wiegmann, 1834: phylogenetic

relationships and taxonomic implications. Hamadryad, 28, 73–89.

https://doi.org/10.1007/s13127-011-0056-0

Silvestro, D. & Michalak, I. (2012) RaxmlGUI: A graphical front-end for RAxML. Organisms Diversity and Evolution, 12 (6),

335–337.

https://doi.org/10.1007/s13127-011-0056-0

Sindaco, R. & Jeremcenko, V.K. (2008) The reptiles of the Western Palearctic. Edizioni Belvedere, Latina, 579 pp.

Stamatakis, A. (2006) Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models,

Bioinformatics, 22, 2688–2690.

https://doi.org/10.1093/bioinformatics/btl446

Tamar, K., Carranza, S., Sindaco, R., Moravec, J., Trape, J.F. & Meiri, S. (2016) Out of Africa: Phylogeny and biogeography of

the widespread genus Acanthodactylus (Reptilia: Lacertidae). Molecular Phylogenetics and Evolution, 103, 6–18.

https://doi.org/10.1016/j.ympev.2016.07.003

Taylor, E.H. (1935) A taxonomic study of the cosmopolitan lizards of the genus Eumeces with an account of the distribution

and relationship of its species. University of Kansas Science Bulletin, 23 (14), 1–643.


AbstractIntroductionMaterial and methodsResultsEumeces persicus sp. nov.Key to the species of Eumeces in Iran and neighboring regionsDiscussionTaxonomic accountsAcknowledgementsReferences

/ColorImageDict > /JPEG2000ColorACSImageDict > /JPEG2000ColorImageDict > /AntiAliasGrayImages false /CropGrayImages true /GrayImageMinResolution 150 /GrayImageMinResolutionPolicy /OK /DownsampleGrayImages true /GrayImageDownsampleType /Bicubic /GrayImageResolution 300 /GrayImageDepth -1 /GrayImageMinDownsampleDepth 2 /GrayImageDownsampleThreshold 2.00000 /EncodeGrayImages true /GrayImageFilter /DCTEncode /AutoFilterGrayImages true /GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict > /GrayImageDict > /JPEG2000GrayACSImageDict > /JPEG2000GrayImageDict > /AntiAliasMonoImages false /CropMonoImages true /MonoImageMinResolution 1200 /MonoImageMinResolutionPolicy /OK /DownsampleMonoImages true /MonoImageDownsampleType /Bicubic /MonoImageResolution 1200 /MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000 /EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode /MonoImageDict > /AllowPSXObjects false /CheckCompliance [ /None ] /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false /PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true /PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXOutputIntentProfile (None) /PDFXOutputConditionIdentifier () /PDFXOutputCondition () /PDFXRegistryName () /PDFXTrapped /False

/CreateJDFFile false /Description >>> setdistillerparams> setpagedevice

4320 (2): 289 304 article genera scincus and scincopus (schmitz et al. 2004; carranza et al. 2008;...

Documents