24 april, 2008mgx tutorial mgx © 2007-2008 umass boston load organisms from green house

24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON

Load organisms from green house.


Click “open”


Select an organism for self crossfor eg. The Red organism

Then click tab“Self-cross One Organism”


Resulting offsprings of Red organism.

Then double click on Tray1and click “Send to Lower Panel”


Select two different organisms(heterozygous)

Then click the tab“Cross Two Organisms”


Resulting offsprings of Red and Green-1 organism.


Select two same organisms(homozygous)

Then click the tab“Cross two Organisms”


Resulting offsprings of Red organism.


Select an organism

Then click “Mutate One Organism”


Mutant versions of Green-2 organism.

Then click the tab“Biochemistry”.


In the Biochemistry addamino acid sequence SSSSSSS here.

Then click“FOLD”

Corresponding phenotype populated when sequence is folded.

The default phenotype

History List is populated with correspondingtemplate and phenotype.-White organism


Enter another sequenceFFFFFFFand click “FOLD”

Correspondingphenotype(Red)

Heterozygous combined phenotype(Red)


Enter the same sequence FFFFFFF here and click “FOLD”

Homozygous combined phenotype.(Red )


Then click tab“Molecular Biology”


Click the tab“Enter New DNA”

Then enter the DNA sequence-TATAAATGTCTAATCGTCATATTTTATTAGTTTTTTGTCGTCAATAGGGGGG

and click “OK”


Then click “Fold Protein”


Resulting Organism -Red

Default Phenotype


Double click “History List”and select “Send to LowerPanel” orEnter the same DNA byclicking “Enter New DNA” in Lower panel.


The same two DNA sequencesgive the combined phenotype here(Red) which is homozygous.


Enter DNA-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT

and click “OK”


Click “Fold Protein”


Resulting Green-1 organism

The two different DNA sequences gives a Heterozygous combined phenotype which populates here.

24 april, 2008mgx tutorial mgx © 2007-2008 umass boston load organisms from green house

Documents

mgx tutorial mgx

umass boston slide

umass boston double

umass boston load organisms

ok slide

protein slide

open slide

white organism slide