2 molecular cloning and characterization of the phycocyanin genes from spirulina platensis c1
TRANSCRIPT
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 1/140
Molecular cloning and characterization of
the phycocyanin genes from Spirulina platensis C I
Miss Wattana Jeamton B.Sc. (Agriculture)
A Thesis Submitted in Partial Fulfillment of the Requirements
for the Degree of Master of Science
Biotechnology Program
School of Bioresources and Technology
King Mongkut’s Institute of Technology Thonburi
1997
Thesis Committee
5 lg&,&L&&~. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Chairman
. . . . . . . . . . . . . . . . . . . . . . . . . . . Co-Chairman
(Asst. Prof. Suchada Chaisawadi)
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . Member
(Assoc. Prof. Dr. Sakarindr Bhumiratana)
. . . . . . . . . . . .f:. . . . . .f&h?.!?? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Member
(Dr. Patcharaporn Deshnium)
:414. . . . . . . . . . . .Y., CL&’
l.‘Gh. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .Member
(Asst. Prof. Dr. K. J. Reddy)
ISBN 974-624-075-7
Copyright reserved
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 2/140
ii
Thesis Title
Thesis Credits
Candidate
Supervisors
Degree of Study
Department
Academic Year
Molecular cloning and characterization of the phycocyanin
genes from Spirulina platensis Cl
1 2
Miss Wattana Jeamtdn
Asst. Prof. Dr. Supapon Cheevadhanarak
Asst. Prof. Suchada Chaisawadi
Assoc. Prof. Dr. Morakot Tanticharoen
Master of Science
Biotechnology
1997
Abstract
In this study, three strategies were employed in the isolation of the
phycocyanin genes (cpcBA) from S. platensis Cl. These include cloning phycocyanin
genes by inverse polymerase chain technique (IPCR), by screening genomic and
partial library. The phycocyanin genes were successfully obtained from the genomic
library. The cpcA specific probe designed from the conserved amino acid sequences
of cpcA genes of various cyanobacteria and one red alga (Cheevadhanarak,
unpublished) was used as a homologous probe to screen hDASHI1 genomic DNA
library of S. platensis Cl. One out of twenty positive recombinant h clones containing
phycocyanin genes was isolated and their sequences were determined. Two open
reading frames of 5 16 bp and 486 bp corresponding to cpcB and cpcA genes,
encoding p and a subunits, respectively, were found in the EcoRV fragment of the
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 3/140
. . 111
genomic DNA. The cpcH and cpcl gene encoding rod-rod linker proteins were also
found downstream of the cpcA gene. The identity of the deduced amino acid
sequences of cpcB and cpcA genes compared to those of Synechocystis PCC6701,
Synechococcus elongatus, Pseudoanabaena PCC7409 and Agaothamnion neglectum
were 82.5, 8 1.9, 79.6 and 70.9% for cpcB gene and 79.6, 75.3, 79.6 and 70.9% for
cpcA gene, respectively. For the cpcH and cpcI genes, their partial amino acid
sequences revealed the highest score of identity with those of Synechococcus
PCC6301 as 53.1% and 69.5%, respectively. Expected chromophore attachment sites
were found at cysteines position 84 of the a-subunit and position 82 and 153 of the
P-subunit. DNA sequence and restriction mapping analysis revealed that the obtained
genes form cpcBAHI operon with a putative transcriptional start and termination
sites. The putative transcriptional initiation site of this operon was located 290
nucleotides upstream from the translation start site of the cpcB gene. Additionally,
the sequences similar to Escherichia coli consensus promoter sequences were also
found at the putative promoter regions of the cpcBAHI operon of S. platensis Cl.
These results suggest that the obtained genes form cpcBAHI operon and
encodes the phycocyanin and rod components of S. platensis C 1.
Keywords: Spirulina platensis /phycocyanin genelcpcBAHI operon/
cyanobacterium/phycocyanin
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 4/140
iv
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 5/140
V
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 6/140
vi
Acknowledgments
I am very grateful to Asst. Prof. Dr. Supapon Cheevadhanarak, School
of Bioresources and Technology,’ King Mongkut’s Institute of Technology
Thonburi (KMITT), for her advice on all aspects of the work, reading and
kindly suggesting improvements of the manuscript and Asst. Prof. Suchada
Chaisawadi, Pilot Plant Development and Training Institute (PDTI), for her
excellent technical assistance, reading and discussion the manuscript. I also
wishes to thank Assoc. Prof. Dr. Morakot Tanticharoen, Assoc. Prof. Dr.
Sakarindr Bhumiratana, and Dr. Patcharaporn Desnium, National Center for
Genetic Engineering and Biotechnology (BIOTEC) and Asst. Prof. Dr. K. J.
Reddy, State University of New York at Binghamton, for their guidance,
discussion and reading the manuscript.
Lastly, without all the encouragement, understanding and support
from everyone in Gene Technology Laboratory, this thesis would not have
been completed. Their contribution is greatly appreciated. This thesis was
supported in part by a grant from the National Center for Genetic Engineering
and Biotechnology (BIOTEC).
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 7/140
vii
Contents
English abstract
Thai abstract
Acknowledgments
Contents
List of Tables
List of Figures
Abbreviations
Chapter 1 Introduction
1.1 Background
1.2 Objectives
1.3 Scopes
Chapter 2 Literature Review
2.1 Cyanobacteria
2.2 Spirulina
2.3 Phycobilisome
2.3.1 Phycobilisome structure
2.3.2 Phycobiliprotein
2.3.2.1 PBPs constituting the PBS core
2.3.2.2 Phycobiliprotein constituting the PBS rod
2.3.3 Linker polypeptide
Page
ii
iv
vi
vii
xi
xii
xvi
1
1
2
2
4
4
7
11
1 3
1.5
1 9
2 2
2 5
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 8/140
..~V l l l
2.3.4 Chromophore
2.3.5 Organization and transcription of the genes
encoding the PBS component
2.3.6 Energy transfer in the phycobilisomes
2.3.7 Regulation of phycobilisomes by environments
2.3.7.1 Control of the PBS size and number
by light intensity
2.3.7.2 Effect of light quality on PBS structure
2.3.7.3 Regulation of the PBS by nutrient
2.4 Studies of PBS in Spirulinaplatensis
Chapter 3 Material and Methods
3.1 Strains and Plasmids
3.1.1 Cyanobacterium strain
3.1.2 Bacterial strains
3.1.3 Plasmids
3.2 Chemicals
3.3 Enzymes
3.4 Media and culture condition
3.4.1 Cyanobacteria
3.4.1.1 Culture medium
3.4.1.2 Culture condition
3.4.2 Bacteria
3.4.2.1 Culture medium
2 7
3 0
3 7
3 8
3 8
4 0
4 2
4 3
4 5
4 5
4 5
4 5
4 5
4 6
4 6
4 6
4 6
4 6
4 8
4 8
4 8
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 9/140
ix
3.4.2.2 storage and culture
3.5 Primers/Synthesis nucPeotides
3.6 Buffers and solutions
3.7 Molecular biology techniques
3.7.1 General procedures
3.7.2 Plasmid extraction
3.7.3 Bacterial transformation
3.7.4 Subcloning of DNA fragments
3.7.5 DNA labelling
3.8 Cloning of phycocyanin gene from S. platensis Ct Strain
3.8.1 Preparation of genomic DNA
3.8.2 Phycocyanin probe
3.8.3 Genomic library construction
3.8.4 Plating bacteriophages
3.8.5 Screening of the DNA library
3.8.6 Preparation of DNA from bacteriophage
3.8.7 Partial genomic DNA library construction
3.8.8 Screening the partial genomic DNA library
3.8.9 Isolation of PC gene by inverse polymerase chain
technique (IPCR)
4 8
4 9
4 9
5 3
5 3
5 6
5 7
5 8
5 9
5 9
5 9
6 0
6 2
6 3
6 4
6 5
6 6
6 8
6 8
3.8.10 Characterization of positive clones 6 9
3.8.10.1 Southern blot analysis 6 9
3.8.10.2 Restriction mapping analysis 6 9
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 10/140
X
3.8.10.3 Sequencing analysis
3.8.11 Analysis of the copy number of phycocyanin gene
Chapter 4 Results and Discussions
4. 1 Isolation of phycocyanin gene from S. platensis
4.1.1 Isolation of phycocyanin gene from h genomic
DNA library
4.1.2 Isolation of phycocyanin genes from partial
genomic DNA library
4.1.3 Isolation of phycocyanin gene by using inverse
polymerase chain reaction technique (IPCR)
4.2 Characterization of the phycocyanin genes
Chapter 5 Conclusion and Suggestion
5.1 Conclusion
5.2 Suggestion
References
7 0
7 1
7 2
7 2
7 2
8 3
84
88
106
106
107
108
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 11/140
xi
List of Tables
Table Page
2. 1 Abbreviations for the biliprotein subtiits and for linker polypeptides 3 1
2.2 Phycobilisome polypeptides and their genes 3 2
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 12/140
xii
List of Figures
Figure
2. 1
2.2
2.3
2.4
Schematic diagram of thin section of a cyanobacterial cell
Morphology of Spirulina
Life cycle of Spirulina
Page
6
9
1 0
1 2
2.5
A model of the phycobilisomes attached to thylakoid membrane
from Cyanophora paradoxa
Phycobilisome structures
2 . 6 Crystal structure of C-phycocyanin monomer ~~~~~~~~ in a
boomerang shape from Mastigocladus laminosus
Crystal structure of trimeric C-phycocyanin (opc(3pc)~ from
Mastigocladus laminosus
1 3
1 7
2 . 7 1 7
2. 8 Schematic side view of a phycocyanin haxamer (apcppc)s from
Mastigocladus laminosus
1 8
2 . 9 General features of allophycocyanin subunits (a and p subuits) 2 1
2.10 General structure, common features and chromophore
variability of phycocyanins
2.11 Phycobilin and their peptide linkages in phycobiliproteins
2.12 Phycobilin biosynthesis pathway
2.13 The organization and transcription of genes encoding
phycobilisome component of cyanobacteria Synechococcus PCC7002,
Synechococcus PCC6301 and Anabaena PCC7 120
2 3
2 7
2 9
3 5
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 13/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 14/140
xiv
S. platensis Cl in plasmid pGT52 and subcloning of EcoRIIClaI
and ClaIIXhoI fragments of that into plasmid pGEM7Z+
4.8 (A)Amplification of phycocyanin gene from S. platensis Cl
genomic DNA by using IPCR technique (B) Southern blot analysis
of 4.2 kb amplified fragment with homologous cpcA probe
4 . 9 Amplification of IPCR product by using PCR technique
4 . 1 0 The nucleotide and deduced amino acid sequences of cpcBA genes
of S. platensis Cl
4.11 Comparison of the deduced amino acid of a subunit of phycocyanin
of S. platensis Ci (Spi) with those of Synechocystis PCC 6701
(Syn 6701), Synechococcus elongatus (Syn), Pseudanabaena PCC7409
(Pseu) and Agaothamnion neglecturn (Agao)
4.12 Comparison of the deduced amino acid of p subunit of phycocyanin
of S.. platensis Cl (Spi) with those of Synechocystis PCC 6701
(Syn 6701), Synechococcus elongatus (Syn), Pseudanabaena PCC7409
(Pseu) and Agaothamnion neglecturn (Agao)
4.13 Comparison of the deduced amino acid of a subunit and p subunit
of phycocyanin (PC) and allophycocyanin (APC) of S. platensis Cl
4.14 Comparison of the promoter sequences found upstream of the
transcriptional start sites of cpcBA from Anabaena 7120 (Ana),
8 6
8 7
8 9
9 0
9 1
9 4
9 7
Cyanophoraparadoxa (Cya) and putative promoter of S. platensis Cl (Spi)
4.15 Comparison of the promoter sequences found upstream of the 9 8
transcriptional start sites of cpcBA from cyanobacteria Anabaena 7 120 (Ana),
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 15/140
x v
4 . 1 6
4 . 1 7
Synechococcus PCC 7002 (Syn), Calothrix PCC 7601 (Cal) and
putative promoter of S. platensis Cl (Spi)
The possible terminator sequence of cpcBA operon of S. platensis Cl
form Stem and Hairpin loop ’
The partial nucleotide and deduced amino acid sequences of cpcH
(the first openreading frame) and cpcl (the second openreading frame)
genes of S. platensis Cl
100
1 0 1
4.18
4 . 1 9
Comparison of deduced amino acid of partial cpcH and cpcl of 102
S. platensis Ci (Spi) with the rear part and the first part of cpcH
and cpcl genes of Synechococcus PCC 6301 (Syn), respectively
Southern blot analysis of genomic DNA of 5’. platensis Cl 104
digested with EcoRV, EcoRI, EcoRV and EcoRI, ClaI, EcoRV and ClaI,
EcoRI and ClaI and HindIIUEcoRI hmarker probing with 700 bp
CZaIIHindIII fragment contained a part of cpcB and cpcA genes
4.20 Organization and restriction map of cpc genes of 5’. platensis Cl 1 0 5
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 16/140
xvi
Abbreviations
D N A
%
w
k b
O.D.
PCC
PCR
RNase
DNase
l-43
Pl
A P C
P C
P E
P E C
Deoxyribonucleic acid
nanogram
miligram
kilobase (1 kb = 6.7~ 1 O5 daltons = 1000 base pairs)
optical density
Pasteur Culture Collection
Polymerase Chain Reaction
Ribonuclease
Deoxyribonuclease
revolution per minute
microgram
microlitre
allophycocyanin
phycocyanin
phycoerythrin
phycoerythrocyanin
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 17/140
Chapter 1
Introduction
1.1 Background
Spirulina sp. is a filamentous cyanobacterium of industrial importance. It
has been used as feed for fish, poultry and farm animals [ 11. It is used also as a
supplement in human diets as it contains a lot of vitamins and minerals, and is
specially rich in protein containing about 55-60 % of cell dry weight [2].
Furthermore, it contains phycocyanin, p-carotene, chlorophyll a [3], and gamma-
linolenic acid, a polyunsaturated fatty acid [4]. Of all these substances, phycocyanin,
a blue pigment, is of high commercial value. In Japan, phycocyanin from Spirulina is
used as a natural blue-pigment for food coloring. In addition, owing to its
fluorescence property, pure phycocyanin is used as labeling substance in
immunoassays, microscopy and cytometry [5]. Moreover, it has been demonstrated
that Spirulina has therapeutic effects against hyperlipidemia [6]. Therefore, there is a
potential for future pharmaceutical use of Spirulina to produce many health related
products. It may be possible to further enhance the production of certain compounds
such as p-carotene in Spirulina through genetic engineering.
Phycocyanin is a major blue-colored pigment, phycobiliprotein, of S.
platensis other than allophycocyanin [7], constituting macromolecule structures,
phycobilisome, mediated by noncolored linker polypeptides. In 5’. platensis,
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 18/140
2
phycocyanin is located in phycobilisome rods radiating from the allophycocyanin
which constitutes the core portion. These phycobilisomes reside on the
photosynthetic membrane (thylakoid) and are important in photosynthesis in
harvesting light energy from sunlight. The absorbed light energy is transferred very
rapidly, from phycocyanin to allophycocyanin that act as the final energy transmitters
from the phycobilisome to reaction center of PSI1 [8,9].
Spirulina is the only cyanobacterium grown in large industrial scale as
human food or animal feed, and it is cultivated mainly under outdoor conditions.
Hence light intensity plays a major role in the production of cell mass, as well as in
the quantity and quality of photosynthetic pigments such as phycocyanin in the cells.
Thus the aim of this study is to clone and characterize the phycocyanin (cpcBA)
genes from the cyanobacterium, S. platensis C i strain, resulting in providing
important tools for understanding the physiology and biochemistry of the
phycocyanin at a molecular level.
1. 2 Obiectives
1 . To clone the phycocyanin (cpcBA) operon from S. platensis C i strain.
2 . To characterize the obtained operon.
1.3 Scope
1 . Construction of h genomic DNA and partial genomic DNA library of
S. platensis Ci strain.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 19/140
2. Screening of phycocyanin (cpcBA) operon from 5’. platensis Cl h
genomic DNA and partial genomic DNA library using amplified partial cpcA gene of
S. platensis Cl strain.
3. Isolation of the phycocyanin (cpcBA) operon by using the inverse
polymerase chain technique.
4. Characterization of the obtained gene by restriction mapping, DNA
sequencing and comparison of the gene products with those from other organisms.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 20/140
Chapter 2
Literature Review
2.1 Cyanobacteria
Cyanobacteria are members of the Kingdom Prokaryotae and are included in
the Division Gracilicutes (bacteria with a Gram-negative cell wall). They are
assigned to the Class Photobacteria within Subclass Oxyphotobacteriae, Order
Cyanobacteriales [lo]. Cyanobacteria are probably the most diverse group of
prokaryotes in the number of species, type of habitat, morphology and physiological
properties [l 11. Besides their prokaryotic nature, the unifying property of
cyanobacteria is their ability to perform oxygenic photosynthesis by mechanisms
similar to those of algae and higher plants. Because cyanobacteria can live in many
different ecological niches, they have experienced different environmental stresses
and may thus, have evolved specialized adaptation mechanisms. Some strains are
strict photoautotrophs, others can alternatively use exogenous carbon sources such as
glucose [ 111. Moreover, some strains are able to fix nitrogen. These strains have
developed the ability to differentiate highly specialized nitrogen-fixing cells, so
called heterocysts, when facing an environment in which combined nitrogen becomes
limited [ 121. Other differentiation processes, mainly directed towards reproduction
and dissemination of the species, resulted in the evolution of three different cell
types: akinetes, baeocytes and hormogonia [ 121. The general organization of
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 21/140
5
cyanobacterial cell as shown in Figure 2.1 was reviewed by Starrier and Cohen-
Bazire [ 13,141. Almost all the cyanobacteria possess classical thylakoid membranes
with two photosystems (photosystem I and photosystem II). However, unlike most of
the photosynthetic eukaryotes (with the exception of eukaryotic red algae), they do
not contain chlorophyll b, but harvest light energy primarily through unique
multimolecular structures, the phycobilisomes. Cyanobacteria also often contain a
large variety of intracellular inclusions, some of which are surrounded by a non-unit
membrane and most of which have reserve function (also see in Figure 2.1). These
inclusion bodies are accumulated under adverse conditions of nutrient imbalance
[ 121. The nitrogen is stored in the form of cyanophycin granules which contain high
molecular mass non-ribosomally synthesized polymers consisting of equimolar
quantities of arginine and aspartate. They are nitrogen reserves uniquely to but not
universally present in cyanobacteria [ 121. In addition, under certain circumstances,
phycobiliproteins which represent the major components of the phycobilisomes may
also serve as a nitrogen source. Carboxysomes are polyhedral bodies containing
carbonic anhydrase and ribulose-1 &bisphosphate carboxylase-oxygenase (Rubisco),
the key enzyme required for the assimilation of inorganic carbon, as well as a few
additional enzymes related to carbon metabolism [ 121. Polyglucose (glycogen bodies)
and poly+-hydroxybutyrate are reserves of carbon and energy, while polyphosphate
bodies are storage of phosphate.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 22/140
I
6
Figure 2.1 Schematic diagram of thin section of cyanobacterial cell. CM; cell
membrane, TH; thylakoid, PBl and PB2; face and side views of
phycobilisomes attached to adjacent thylakoids, GG; glycogen granules,
CY; cyanophycin granule, C; carboxysome surrounded by nucleoplasm,
R; ribosomes, G; gas vesicles. Insert A; enlarged view of the cell
envelope showing the outer membrane, peptidoglycan wall layers and the
cytoplasmic membrane. Insert B; enlarged view of part of a thylakoid
showing the paired unit membrane with attached phycobilisomes in side
view [14].
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 23/140
7
2.2 Spirulina
Spirulina is a multicellular filamentous cyanobacterium. It belongs to
Phylum Cyanophyta, Family Oscillatoriaceae [ 151. Spirulina is a ubiquitous
organism which can be found in a variety of environments such as soil, sand,
marshes, brackish water, seawater and fresh water [ 161. Spirulina appears to be
capable of adaptation to very different habitats and colonizes harsh environments
where life is very difficult for other organisms. Spirulina is a thermophilic alga, the
optimal temperature for its growth falls between 35 to 37’C. The salt concentration
(mostly carbonates and bicarbonates) plays a direct role in the growth of Spirulina
[ 161. The growth of S. platensis is optimal at salt concentrations ranging from 20 to
70 g per liter, however S. platensis was found in water containing from 85 to 270 g of
salt per liter. In the lakes containing salt concentrations more than 30 g per liter,
Spirulina was the only organism present in significant quantities [ 161.
Under a microscope, Spirulina appears as blue green filaments composed
of cylindrical cells arranged in unbranched, helicoidal trichomes (Figure 2.2). The
filaments are motile, gliding along their axis and heterocysts are absent [ 161. The
helical shape of trichome is characteristic of the genus but the helical parameters (i.e.,
pitch length and helix dimensions) vary with the species, and even within the same
species [ 171. However, the helical shape is maintained only in liquid media, in solid
media the filaments become true spirals [ 181.
The diameter of the cells ranges from 1 to 3 pm in the smaller species and
from 3 to 12 pm in the larger ones. The cytoplasm of the smaller species appears
homogenous, with no gas vacuoles and scarcely visible septa. On the contrary, the
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 24/140
8
large species such as S. platensis (6-8 pm cell diameter) and S. maxima (4-6 pm cell
diameter) have a granular cytoplasm containing gas vacuoles and easily visible septa.
The most prominent cytoplasmic structure is the system of thylakoids originating
from the plasmalemma [19,20,21,22 j. Like other cyanobacteria, there are
phycobilisomes, high-molecular weight aggregates of phycobiliprotein, appear to be
attached to the thylakoids [22] as expected on the basis of their function as light-
harvesting antennae.
The genome sizes of 128 strains representing all major taxonomic groups
of cyanobacteria have been determined by renaturation kinetics analysis [23]. The
value of 2.53 x lo9 daltons found for an identified species of Spirulina and these
values are similar to many bacteria such as Escherichia cob.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 25/140
I
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 26/140
10
The life cycle of Spirulina is shown in the Figure 2.3 [16]. A mature
trichome is broken into several pieces through the formation of specialized cell,
necridia, that undergo lysis, giving rise to biconcave separation disks. The
fragmentation of the trichome at necridia produces, short (two to four cells) chains of
cells, the hormogonia, that move away from the parental filament to give rise to a
new trichrome. The cells in the hormogonium lose the attached portions of the
necridial cells, becoming rounded at the distal ends with little or no thickening of the
walls. During this process, the cytoplasm appears less granulated and the cells
assume a pale blue-green color. The number of cells in hormogonia increases by cell
fission while the
green color. By
helicoidal shape.
cytoplasm becomes granulated, and the cells assume a brilliant blue
this process trichomes increase in length and assume the typical
Figure 2.3 Life cycle of Spirulina [ 161.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 27/140
11
Spirulina is utilized as food in the area around Lake Chad for long time
ago, and is marketed as a healthy aliment in the United States and Japan. It has been
used as feed for fish, poultry and farm animals [ 11. S. platensis is the only species of
cyanobacteria grown on an industrial scale [ 11. It is a rich source of protein, minerals
vitamin B 12 and essential fatty acids like y-linolenic acid [4]. Moreover, some
preclinical testing suggests that Spirulina has several therapeutic properties such as
hypocholesterolemic, immunological, antiviral and antimutagenic activity other than
its nutritive value [24].
A novel sulfated polysaccharide named calcium spirulan (Ca-SP) has been
isolated from S. platensis [25,26]. This polysaccharide was composed of rhamnose,
ribose, mannose, fructose, galactose, xylose, glucose, glucuronic acid, galacturonic
acid, sulfate and calcium. Ca-SP was found to inhibit the replication of several
enveloped viruses, including Herpes simplex virus type 1, human cytomegalovirus,
measles virus, mumps virus, influenza A virus and HIV- 1. It was revealed that Ca-SP
selectively inhibited the penetration of virus into host cells.
2.3 Phycobilisome
The major light-harvesting antennae in eukaryotic red algae and
prokaryotic cyanobacteria are called phycobilisomes (PBSs) [ 131. Although
functionally analogous to the light-harvesting chlorophyll-protein complexes of
higher plants, these water-soluble structures are attached to but not embedded in the
photosynthetic membranes as shown in Figure 2.4. Phycobilisomes were first
purified from the red alga Porphyridium cruentum [27] and postulated to represent an
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 28/140
1
1 2
order array of the pigmented phycobiliproteins that associate with the thylakoid
membrane and harvesting light energy for the photosynthetic reaction centers.
Figure 2.4 A model of the phycobilisomes attached to thylakoid membrane from
Cyanophora parudoxa showing the phycobilisomes attached to 1 0-mn
EF particles [28]. CFo and CFr; subunits of coupling factor. P;
Protoplastmic leaflet (cytoplasmic or stromal). E; exoplasmic leaflet
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 29/140
1 3
2.3.1 Phycobilisome structure
The structure of the PBS was characterized by examination of
images obtained from electron microscopy. Based upon their appearance in electron
micrographs, the PBS can be divided into four structural classes, bundle shaped [29],
block shaped [30], hemiellipsoidal shaped [30] and hemidiscoidal shaped PBS [3 I].
The most common PBS structural form is the hemidiscoidal class that have been
most extensively characterized. In general, hemidiscoidal PBS have a fanlike
appearance (Figure 2.5) with a molecular mass of 7~10~ to 15~10~ Da [32,33], a
diameter of 32 to 70 nm, a height of 25 to 45 nm and a thickness of 12 to 40 nm .
These appearances depend on organisms and the conditions in which the organism
are grown.
Figure 2.5 Phycobilisome structures. (A) The PBS from Synechococcus 7942 with
bicylinder core. (B) The PBS with tricylindrical core as for
Synechocystis 7601. The numbers indicate the molecular mass of the
rod l inker polypeptides in kDa. PC; phycocyanin , APC;
allophycocyanin [35].
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 30/140
1 4
The PBS are arranged into two substructure, the core attached to
the thylakoid membrane and the peripheral rods fanning out from the core. The core
of PBS is comprised of either two [29] or more generally three [29,30,31,33]
cylindrical subassemblies (Figure 2.5) and each of which has a diameter of about 11
nm and a length of 14-l 7 nm. Each of these core cylinders is formed from the
stacking of four disc-shaped molecules. Each disc molecule comprising of 3 sets of a
and p subunits (oApcpApc) so called trimers about 3.5x1 1 m-n [3 11. In the case of
bicylindrical cores the two cylinders lie side by side and in the tricylindrical cores the
third cylinder is stacked on top of the two basal cylinders to produce a structure that
approximates a pyramid (Figure 2.4). In addition to the major PBP allophycocyanin,
the core substructure of a hemidiscoidal PBS is comprised of the minor aAPC-like
polypeptide and pAPC -like polypeptide. These minor aAPC and PAP’ like polypeptides
play special roles in energy transfer from the PBS to the chlorophyll a of PSI1
and
could play special roles in the assembly and attachment of PBS to the thylakoid
surface [36].
The second structural domain of hemidiscoidal PBS, the peripheral rods
radiating from the surfaces of the core subassembly, are not in contact with the
thylakoid membrane [3 I]. Most hemidiscoidal PBS have six peripheral rods attached
to their cores [36]. The peripheral rods are comprised of phycocyanin (PC) solely or
in combination with phycoerythrin (PE) or phycoerythrocyanin (PEC) [31]. Each
peripheral rod is a cylinder approximately 11 nm in diameter, the length of the rod
cylinders depends on the organism and the growth conditions and can vary between
12 to 36 nm [36]. The fundamental building block of the peripheral rods is a disc-
shaped molecule of about 3 x 11 nm comprising 3 sets of a and /3 subunits ~~~~~~~~
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 31/140
1 5
so called trimers (Figure2.7). Pair of these molecules are stacked together face-to-
face to produce 6 x 11 nm disc. Hexamers are then stacked tail-to-tail to produce the
peripheral rods. The latter interaction depends on the presence of specific linker
polypeptides. Three to six linker polypepfides are typically required for the assembly
of the peripheral rods [31,33,34,37].
The phycobilisome is assembled from two types of polypeptides. The first
polypeptide is phycobiliprotein (PBPs) binding with pigment molecules, the
chromophores that serve to harvest light energy. The second are linker polypeptides
that involve in arranging the PBPs into a functional phycobilisome and may also bind
chromophores. The PBPs generally comprise about 85-90% of the PBS mass with the
linker polypeptides comprising the remainder.
2.3.2 Phycobiliprotein
Phycobiliproteins (PBPs) are coloured water soluble pigment
protein complexes. The colors of the PBPs originate mainly from covalently bound
open chain tetrapyrrole chromophores known as phycobilin. On the basis of their
visible absorption properties, the PBPs have been assigned to four spectroscopic
classes. These are phycoerythrocyanin (PEC) with absorption maxima at 590 run,
phycoerythrin (PE) with absorption maxima in the range 490 to 570 mn, phycocyanin
(PC) with absorption maxima in the range 610 to 630 nm, and allophycocyanin
(APC) with absorption maxima in the range 650 to 670 nm [36]. PEC was primary
found in certain filamentous heterocyst-forming cyanobacteria such as Fischerella sp.
(also known as Mastigocladus Zaminosus), Anabaena sp. and Nostoc sp. [38]. PEC
and PE are found at the core-distal ends of the peripheral rods of phycobilisome. PC
constitutes the portion of the peripheral rods adjacent to the core while the APC
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 32/140
1 6
forms the major component of the PBS core substructure. The allophycocyanin
family includes minor phycobiliproteins such as an aAPC-like polypeptide (denoted
aAPmB) and a PAPc-like polypeptide (denoted p’6.5) which form complexes with APC
[W ~
Phycobiliproteins from cyanobacteria and red algae are hetero-
monomers consisting of two different subunits, a and p, which are present in
equimolar stoichiometry (ap) and this ap monomer has the shape of a boomerang
(Figure 2.6). Each phycobiliprotein subunit differ in molecular mass (160-l 84 amino
acid residues each), amino acid sequence and chromophore content. Phycobiliprotein
subunit carries at least one and as many as three chromophores bound to a single
polypeptide [34,37]. The chromophores are covalently attached to PBP polypeptide
chains by either one and occasionally two cysteinyl thioether linkages [34]. The
fundamental assembly unit for all PBS is a disc-shaped trimer (ap)3 (Figure 2.7)
forming a toroidal shaped aggregate with a diameter of 11 nm and a thickness of 3-
3.5 nm with a central hole 3 nm in diameter [39]. PC, PE and PEC also form (ap),j
hexamer structures (Figure 2.8), 11 nm in diameter and 6 nm in thickness by face-to-
face joining of two trimers [40,41].
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 33/140
I
17
Crystal structure of C-phycocyanin monomer ~~~~~~~~ in a boomerang
shape from Mastigocludus luminosus [42].
Figure 2.7 Crystal structure of trimeric C-phycocyanin (cxpc~pc)~ from
Mastigocladus laminosus [42].
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 34/140
Figure 2.8 Schematic side view of a phycocyanin hexamer (aPCpPC)6 from
Mastigocladus iaminosus [42].
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 35/140
1 9
2.3.2.1 PBPs constituting, PBS core
The major phycobiliprotein constituting PBS core is
allophycocyanins (APCs). APC is comprised of two different subunits, a and p,
encoded by apeA and apcB genes, respectively. Phycocyanobilin (PCB) is the
chromophore typically found associated with both subunits of APC at Cys 82
(cysteine 82) as shown in Figure 2.9. APC occurs mainly in the trimeric form
(ahPCf3”C)3. APC s assemble the PBS core with the assistance of three types of linker
polypeptides: the large core-membrane linker phycobiliprotein (LcM), rod core linker
polypeptides (Lac) and with small Lc linker polypeptides. Complexes containing
APC are the longest wavelength absorbing and fluorescing unit in the PBS. In
addition to the major phycobiliprotein APC, the PBS core is also comprised of
another allophycocyanin family, namely, allophycocyanin-B (AP-B or aAPmB) and
p16,5 subunit [36,42]. The complex containing minor allophycocyanin is formed as
(CIAP-BCI* hpcP3Apc)Lc8~9 in which an aAPC subunit is substituted by a structurally
similar but distinctive aAPmB subunit [43]. The CI‘@-~ subunit is encoded by the apcD
gene. Another minor allophycocyanin subunit is p’6.5 subunit encoded by apcF gene.
This subunit formed a complex with the composition ~~~~~~~~~~~~~~~~~~~~ of PBS
core of Synechococcus PCC6301 [43]. Both of these genes, apcD and apcF encode
minor components of the PBS core which are believed to play important roles in
energy transfer and in the structural asymmetry required to assemble the core on the
thylakoid surface. However from the mutagenesis study of apcD and apcF in
Synechococcus PCC7002 [36] demonstrated that the czAPsB and p16.5 subunits play
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 36/140
2 0
important role in energy transfer from PBS to PSI and PSI1 reaction center but are not
obligately required for PBS assembly and function.
The core membrane linker phycobiliprotein, denoted LCM, is
the apcE gene product. It is the largest chromoprotein in the PBS and has a molecular
mass that varies from 70-128 kDa depending on the organism [42]. Two copies of
this polypeptide occur in the PBS core. This polypeptide has been proposed to play
extremely important roles in attachment of PBS to the thylakoid membrane and in the
transfer of excitation energy from the PBS to the chlorophyll a associated with PSI1
[36]. The apcE gene of Synechococcus PCC7002 has been insertionally inactivated
or completely deleted. No intact PBS could be isolated from this mutant, although
both APC and PC are synthesized in essentially normal amounts. These result
showed that the LCM polypeptide plays a central role in the PBS assembly and
architecture [36].
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 37/140
2 1
Allophycocyanin
common features
a-APC
PCB 82
----------__-------- I---__---------------160 amino acid residues
P-APC
PCB 82________________________________________ 58-167 amino cid esidues
Figure 2.9 General features of allophycocyanin subunits (a and p
subunits). The broken lines represent the linear polypeptide
chain of allophycocyanin and the PCB-binding sites are
indicated by bars (one per subunit at homologous positions)
[421*
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 38/140
2 2
2.3.2.2 Phycobiliprotein constituting PBS rod
There are three types of phycobiliproteins found in the
PBS rod structure; phycocyanin (PC), phycoerythrin (PE) and phycoerythrocyanin
(PEC) [36]. Tw o types of phycobiliprotein complex are required to assemble the
peripheral rods. The first complex is (c@)bLa hexameric subassemblies that
contained only PC, PE or PEC in association with the appropriate rod-linker
polypeptides. The second type of complex is (ap)bLac hexameric subassembly,
composed of a constitute PC type and its associated rod-core linker polypeptide at the
core-proximal end of the rod. The position of these phycobiliprotein subassemblies
within the rod is determined by their linker polypeptides and correlates with their
absorption properties such that complexes absorbing higher energy wavelengths are
more distal from the core [42].
Although many cyanobacteria do not synthesize either PE
or PEC, all cyanobacteria have been found to produce PC [38]. Hexameric
complexes of PC and linker polypeptides, (cI~~P~~)~L~ or (c~~~~~~)~Lac, are required
to assemble the peripheral rods, typically one complex of the latter type and two to
four of the former type are found in a rod. Phycocyanobilin (PCB) is the
chromophore typically found associated with the subunits of PC at Cys 84 for a-
subunit and Cys 85 for P-subunit as shown in Figure 2.10. The blue colored, deeply
red-fluorescent C-phycocyanin (C-PC) is the predominant form and it contains only
three PCB chromophores per (ap) monomer. The other forms of PC that found in
some red algae and cyanobacteria are R-phycocyanins. These are R-PC-I, R-PC11 and
R-PC-III in which one or two PCB is replaced by PEB and R-PC-IV in which PCB
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 39/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 40/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 41/140
2 5
two PCBs on the P-subunit [45]. PEC encoded bypee& genes is induced under low-
light conditions and occupies the core-distal position in the rods of phycobilisome.
2.3.3 Linker polypeptide
The assembly of the PBPs into PBS is now known to depend on the
presence of a small number of polypeptides known as linker polypeptides [29,33,34].
Some of these polypeptides, first reported to be PBS components by Tandeau de
Marsac and Cohen-Bazire [46], are required for assembly of typical PBS. It is
presently believed that the linker polypeptides interact with the PBPs by binding to
the trimers or hexamers in the central cavity of these torus-shaped molecules [36]. In
addition to their roles in the assembly of PBPs into phycobilisomes, the linker
polypeptides produce subtle changes in spectroscopic properties of the PBPs to
which they bind [33,34,37]. These minor spectroscopic changes are believed to be
extremely important in producing a unidirectional transfer of excitation energy from
the periphery of the PBS to the core and from the core to the PSI1 reaction centers
embedded in thylakoid membranes [37]. Zilinskas and Greenwald (1986) [47] have
discussed the function of three classes of linker polypeptides, not all of which are
colorless. Group I ( 70-120 K ) attaches the PBS to the thylakoid membranes and
contain PCB. Group II ( 30-70 K ) maintain rods structure by linking hexamers.
Group III ( 25-30 K ) attach rod to the APC core of the PBS, and appear to terminate
elongation of rods [47].
According to their functions and location in the PBS, linker
polypeptides also can be divided into two groups [42]: the linker polypeptides found
in PBS core and the linker polypeptides found in PBS rod. Two types of linker
polypeptides are found in PBS core, the small core linker polypeptides (L,) and the
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 42/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 43/140
2 7
2.3.4 Chromophore
The brilliant colors of the phycobiliproteins (PBP) originate from
covalently attached, linear tetrapyrrole prosthetic groups, known as phycobilins or
chromophores. To date, four types of chromophores have been identified: the blue-
colored phycocyanobilin (PCB), the red-colored phycoerythrobilin (PEB), the
yellow-colored phycourobilin (PUB) and the purple-colored phycobiliviolin (PXB)
with the absorption maxima of 590-670, 535-567, 498 and 568 nm, respectively.
Figure 2.11 shows the structures and modes of attachment to the PBP polypeptide.
As many as three chromophores may be found attached to a single a- or P-type
polypeptide [34,37]. Phycobilin are generally bound to the polypeptide chain at the
conserved position(s) either by one cysteinyl thioether linkage through the vinyl
substituent on the pyrrole ring A of the tetrapyrrole or occasionally by two cysteinyl
thioether linkages through the vinyl substituent on both the A and the D pyrrole rings.
The different absorption properties of the phycobilins are predominantly caused by
differences in the number of conjugated double bonds and the side chains in the
tetrapyrrole prosthetic groups [42].
Figure 2.11 Phycobilin and their peptide linkages in phycobiliproteins [50].
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 44/140
2 7
2.3.4 Chromophore
The brilliant colors of the phycobiliproteins (PBP) originate from
covalently attached, linear tetrapyrrole prosthetic groups, known as phycobilins or
chromophores. To date, four types of chromophores have been identified: the blue-
colored phycocyanobilin (PCB), the red-colored phycoerythrobilin (PEB), the
yellow-colored phycourobilin (PUB) and the purple-colored phycobiliviolin (PXB)
with the absorption maxima of 590-670, 535-567, 498 and 568 nm, respectively.
Figure 2.11 shows the structures and modes of attachment to the PBP polypeptide.
As many as three chromophores may be found attached to a single a- or P-type
polypeptide [34,373. Phycobilin are generally bound to the polypeptide chain at the
conserved position(s) either by one cysteinyl thioether linkage through the vinyl
substituent on the pyrrole ring A of the tetrapyrrole or occasionally by two cysteinyl
thioether linkages through the vinyl substituent on both the A and the D pyrrole rings.
The different absorption properties of the phycobilins are predominantly caused by
differences in the number of conjugated double bonds and the side chains in the
Figure 2.11 Phycobilin and their peptide linkages in phycobiliproteins [50].
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 45/140
2 8
Most of the studies on chromophore biosynthesis have been carried
out in the red alga C’anidium caldarium [35]. Heme, protoporphyrin IXa and
biliverdin were shown to be intermediates in phycocyanobilin (PCB) biosynthesis in
this alga [5 11. Using increasing pure fraction of cell extract from C. caldarium, it was
shown that biliverdin could be converted to PCB via 15,16-dihydrobiliverdin IXa
and phycoerythrobilin as shown in Figure 2.12 [51]. The biosynthesis of other
chromophores such as phycourobilin and phycobiliviolin is not known at the present
moment.
Although it has been known for a long time that the chromophores
are attached covalently through a thioether linkage to a specific cysteine residues
[52], little information is available concerning the mechanism of chromophore
attachment to the polypeptide backbone in PBPs. Recently two genes (cpcE and
cpcF) in the PBS rod operon of S’nechococcus 7002 were cloned, sequenced and
inactivated [53]. The phenotype of CpcE‘ and CpcF- mutants showed a specific
reduction in chromophore attachment of a-PC. This suggested that the CpcE and
CpcF polypeptides were necessary for the chromophore attachment of a-PC [53,45].
Subsequently, it was demonstrated that the CpcE/CpcF polypeptides function as a-
phycocynobilin lyase, enzyme involved in chromophore attachment [54].
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 46/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 47/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 48/140
31
Table 2.1 Abbreviations for the biliprotein subunits and for linker
polypeptides [3 51.
Type of polfpeptide
Phycoerythrin subunits
Phycoerythrocyanin subunits
R-Phycocyanin subunits
C-Phycocyanin subunits
Allophycocyanin subunitsAllophycocyanin B a subunit
P-type core biliprotein subunit
Rod linker polypeptides
Linker attaching rod elements to core
Core linker polypeptides
Linker attaching core to membrane
Abbreviation
aPE, pPE,yPE
aPEC7 PPEC
a RPC
2RPC
czpc, ppc
CLAP, PAP
aAPB
P
MW
LRMW
LRC
MW
L c
MW
LC M
MW
PE, phycoerythrin; PEC, phycoerythrocyanin; RPC, R-phycocyanin; PC, C-
phycocyanin; AP, allophycocyanin; APB, allophycocyanin-B; L, linker polypeptide;
MW, apparent molecular weight; R, rod; C, core; M, thylakoid membrane.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 49/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 50/140
3 3
The species of the transcripts encoding PBS components varies in
different cyanobacteria (about 5-9 species), and the distribution of genes within these
species is also variable. The organization and transcription patterns for genes
encoding PBS components of several cyanobacteria were recently summarized by
Bryant (199 1) as shown in Figure 2.13 and Figure 2.14 [3 61. From these transcription
patterns, there are two distinct transcriptional units, monocistronic unit of which only
one gene is transcribed as separate unit and polycistronic unit of which more than one
gene are cotranscribed in the same transcriptional unit.
The cpc operons are composed of genes encoding PBS rod
components and sometime also contain genes encoding polypeptides that are
involved in chromophore attachment to cl” -subunit [32,45,53,54]. The cpcG gene(s)
encoding the L ac is contained in the large operon in Anabaena PCC 7120 whereas in
Synechococcus PCC7002, the cpcG gene forms a separate transcription unit. In all
cyanobacteria studied to date, the cpcA gene encoding the cl” subunit is located
downstream from the cpcB gene encoding ppc subunit. The same order of genes as
seen in the cpeBA operon encoding the PPE and aPE subunits [57,58] and for pecBA
operon [45]. The genes encoding the PC or PEC subunits are typically followed by
genes encoding the La linker polypeptides and/or the genes for chromophore
attachment to the a-subunit. Additionally, in some species of cyanobacteria, there are
more than one copy of cpcBA genes, e.g. three copies for Calothrix PCC7601 [60],
two copies for S’nechococcus PCC6301 [61] and Pseudanabaena PCC7409 [62].
The reverse order is found in all apt operons, the apcA gene
encoding the aAPC is found upstream to the apcB gene encoding the PAP’ [36]. The
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 51/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 52/140
Figure 2.13 The organization and transcription of genes encoding phycobilisome
component of cyanobacteria S’nechococcus PCC7002, 5’ynechococcus
PCC6301 and Anabaena PCC7120 [36]. The width of the arrows is
proportional to abundance of transcripts.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 53/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 54/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 55/140
3 8
23.7 Regulation of phycobilisomes bv environments
Because cyanobacteria are found in many different ecological
niches and can be found in locations which exhibit widely fluctuating chemical and
physical parameters including nutrient availability, light intensity and light
wavelength, they have evolved specialized mechanisms to exist in those fluctuating
environments. Alteration of PBS components is one such mechanism found when
cyanobacteria are exposed to those environments.
2.3.7.1 Control of the PBS size and number by light intensity
As for all photosynthetic organisms, an inverse correlation
exits between the amount of light harvesting pigments and the light intensity that
reaches the cells [50]. The PBS size and the number of PBS are strictly regulated by
ix-radiance with the size of the PBS being inversely related to the irradiance. In
Anacystis nidulans, pigment concentration and thylakoid content vary inversely with
the light intensity [56]. It was found that upon transferring cells from high intensity to
low intensity light, the phycocyanin and chlorophyll content per cell of A. nidulans
increased. An immediate response was also seen for the two phycobilisome rod
linker polypeptides. The increase in phycocyanin and rod linker polypeptide results in
the size of the antenna, first increases (by elongation of phycobilisome rods) followed
by an increase in number of phycobilisomes per unit area of thylakoid membrane
[56]. The phycocyanin/allophycocyanin ratio can vary over a two fold range as a
result of an increase in the number of phycocyanin hexamers and of the two rod-
associated linker polypeptides (LR) [63]. In contrast, it has also been shown that
growth of Synechococcus 6301 at successively higher light intensities results in PBS
with shorter rods [64].
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 56/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 57/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 58/140
4 1
Tandeau de Marsac (1977) studied in PE-containing
(group II) chromatic adaptation Synechocystis 6701. The growth of this strain under
green light results in a stimulation of green light-absorbing PE and the synthesis of
PE associated rod-linkers [69]. In the group III strains, red light promotes the
synthesis of second phycocyanin species, phycocyanin-2 which is repressed by green
light, while expression of phycocyanin-1 is light-wave length independent. From the
many physiological and biochemical studies Tandeau de Marsac and Houmard
concluded some features for strain of group III [ 121. They found that there is no
specific turnover of phycocyanin and phycoerythrin and acclimation occurring via de
ylovo synthesis during the adaptation process. Only the distal part of phycobilisomes,
the rod, is modified while the core being unchanged. Moreover under the red light,
rods contain only phycocyanin-1 and phycocyanin-2 while under green light, they
contain both phycocyanin-1 and phycoerythrin in which specific linker polypeptides
being associated with each of these phycobiliproteins. In additional the pigment
content of darkness grown cells is equivalent to that found in cells grown under red
light.
The transcriptional studies on PBS components by light
quality in Fremyella diplosiphon was studied by Oelmuller et al. (1988) [70]. It was
found that the levels of transcripts encoding APC, the core linker polypeptide and the
constitutive phycocyanin subunit remained the same while the levels of other
transcripts changed dramatically. Transcripts encoding the inducible phycocyanin
subunits are barely detected in green light grown cells and very abundant in red light
grown cell corresponding to their protein while the level of phycoerythrin mRNA
approximately IO-fold more in green light than in red light grown cells which
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 59/140
4 2
corresponded to their protein. These results showed that the changing of each PBP
level to light quality related with the RNA encoding them.
2.3.7.3 Regulation of the PBS bv nutrient
A dramatic response i.e. decrease in abundance of pigment
molecules is exhibited by cyanobacteria when the level of the nutrient such as
carbon, nitrogen and sulphur are limited during growth [50]. The first quantitation of
pigment levels during nutrient-limited growth was performed by Allen and Smith
(1969) [71]. Cultures of A na cy stis n id da ns maintained for 30 hours in medium
devoid of nitrogen had no detectable PC while the levels of carotenoids and
chlorophyll did not change. During sulphur and nitrogen starvation, there is a rapid
degradation of the PBS. Degradation of the PBS could provide the cell with amino
acids used for synthesis of proteins important for acclimation process. These amino
acids may also be converted into carbon skeletons and used to produce other cellular
constituents [50]. The use of phycobiliproteins as amino acid storage molecules may
be important for marine cyanobacteria, since nitrogen is frequently limited in marine
environments [72].
It is well known that subjecting cells to nitrogen starvation
results in the degradation of PBS rods [71,73,74,75]. Phycobilisome degradation is
an orderly and stepwise process, at least in Synechococcus 6301 and Synechococcus
7492. Upon nitrogen starvation, the most distal hexamer in the PBS rods (attached by
30 kDa rod linker) is degraded first, followed by the hexamer attached by the 33kDa
rod linker and so on [74,75]. Such a bleaching response is also observed upon
sulphur starvation in Synechococcus 7942 [74].
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 60/140
4 3
In contrast, Calothrix PCC7601 has developed a unique
strategy to cope with sulphur starvation. In addition to the constitutive and red light-
inducible PC gene cluster, a sulphur starvation-inducible PC gene cluster also exists
[12]. Thus, it is obvious that cyanobacteria possess a multitude of strategies to cope
with nutrient starvation,
2.4 Studies of PBS in Spirulina platensis
At present, the information on PBS in S. platensis is very limited. PBS
structure of S. platensis is hemidiscoidal PBS comprised three core and six rod
cylinder [76]. PC and APC are only two PBPs found in S. platensis [7]. These PBPs
have been resolved by gel electrophoresis [77] and both phycocyanin and
allophycocyanin appear to be oligomeric complexes composed of at least two
different subunits. The a and p subunits of phycocyanins showed mobilities
corresponding to molecular weights of ca. 44000. Allophycocyanin was found to be
composed of subunits with molecular weight of ca. 18,000 and 20,000 to give an
oligomer with a minimum molecular weight of ca. 38,000. Absorption and
fluorescence spectra were similar to those reported for phycocyanins and
allophycocyanins isolated from other cyanobacteria [77].
Phycocyanin of 5‘. platensis may serve also as a storage material since it
has been found that the phycocyanin concentration was highest when S. platensis was
cultivated under favorable nitrogen concentrations [78]. If the level of available
nitrogen in the medium decreased, or the cultures were completely deprived of
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 61/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 62/140
Chapter 3
Material and methods
3.1 Strains and plasmids
3.1.1 Cyanobacterium strain
Cyanobacterium used in this work was Spirulina platensis Cl, a kind
gift from Prof. Dr. Avigad Vonshak, Algal Biotechnology, Ben-Gurian University of
the Negev, Israel.
3.1.2 Bacterial strains
The bacteria used as recipient for propagation of different plasmids
during this work was Escherichia coli DH5a (supE44, Alac U169, ($80, ZacZAM15),
hsdR17, recA1, endAl, gyrA96,thil, relA1}[80,81].
The recipient strain used to propagate recombinant lambda
bacteriophages was E. coli XLl-Blue MRA(P2) {A(mcrA)183, A(mcrCB-hsdSMR-
mrr)l73, endAl, supE44, thi-1, gyrA96, relA1, lac (P2 lysogen)} [82].
3.1.3 Plasmids
Plasmid pGEM4, containing amplicillin resistance gene was used for
subcloning the cpcBA genes.
Plasmid pGEM7Z+, containing amplicillin resistance gene was used
for subcloning the DNA fragments in DNA sequencing.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 63/140
4 6
Plasmid pPM564 containing partial cpcA gene of 5’. platensis Cl, was
used as a source of cpcA probe for isolation of cpcBA genes from S. platensis Cl
(Cheevadhanarak, unpublished data).
3.2 Chemicals
All chemicals were of reagent and molecular biology grade.
3.3 Enzymes
Restriction enzymes used in cloning were purchased from either Boehringer
Mannheim or BRL company. The ligase was obtained from Promega company. The
lysozyme, RNaseA and DNaseI were obtained from Sigma chemical company.
3.4 Media and culture condition
Unless specifically stated all the media were sterilized for 15 min at 15
p.s.i., 120 OC.
3.4.1 Cyanobacteria
3.4.1.1 Culture medium, Zarrouk’s medium [83]
For the solid medium, 3% sterilized agar was added into the
sterilized medium (with 2x concentration) for 1.5% final concentration.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 64/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 65/140
48
Co(N03)*.6H*O
3.4.1.2 Culture condition
4.4
S. platensis Ci was grown at 35’C with shaking at 150 rpm
in Zarrouk’s medium under illumination of incandescent lamps ( 80 pE me2 S” ). For
stock culture, cells were transferred every two weeks into Zarrouk’s medium. A 10
ml of stock culture was used to start new culture in 100 ml of Zarouk’s medium in
250 ml flask. Cultures at the exponential phase (OD560=0.45 or 4-5 days after
inoculation) were harvested and used as source of genomic DNA.
3.4.2 Bacteria
3.4.2.1 Culture medium is LB-medium (Luria-Bartoni Medium)
Sambrook, et al., 1989 [84]
For the solid media, 8 g L-’ (soft-agar medium) or 15 g L-’
of bacto-agar (agar medium) was added before sterilization.
In g L-’
Bacto-tryptone 1 0
Bacto-yeast extract 5
NaCl 1 0
pH adjusted to 7.0
3.4.2.2 Storage and culture
For storage of E. coli strains, sterile glycerol was added to
overnight culture into 15% glycerol concentration. The mixture was aliquoted in to
eppendorf tubes and then stored at -7O’C. These stock tubes (50 ~1) were used to start
overnight cultures in bottles containing 5 ml of LB (supplemented with appropriate
antibiotics when necessary) at 37’C in 250 rpm shaking incubator.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 66/140
4 9
3 5 Primers/Synthesis nucleotides
The primers were synthesized by Bio Service Unit, National Center for
Genetic Engineering and Biotechnology and used for sequencing.
Sequence number : 1739 : 5’-ATTGAATTCACCTAACTACGCGGCAG-3’
Sequence number : 1740 : 5’-ATTGAATTCTAGCAGCTTCCAGACCA GC-3’
Sequence number : 2483 : 5’-TCGCCACACACCGCACCA-3’
Sequence number : 2484 : 5’-ACAATTGCGCCGTGGTCC-3’
Sequence number : 2485 : 5’-CGCTGCTGGTGAAGCTAA-3’
3.6 Buffers and solutions (Sambrook, et al. 1989) [84]
3.6.1 TE buffer pH8.0
10 mM Tris.Cl (pH 7.4)
1 mM EDTA (pH 8.0)
Sterilize by autoclave
3.6.2 10 x TBE buffer (stock solution, L-l)
Tris base 108 g
Boric acid 55 g
0.5 M EDTA (pH 8.0) 20 ml
3.6.3 STET
0.1 M NaCl
10 mM Tris.Cl (pH 8.0)
1 mM EDTA (pH 8.0)
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 67/140
5 0
5% Triton X-100
Sterilize by autoclave
3.6.4 Lysozyme solution
Lysozyme (Sigma L6876) was dissolved at a concentration
of 10 mg/ml in 10 mM Tris.Cl (pH 8.0).
3.6.5 Ribonuclease A (RNase A) stock solution
RNase A (Sigma RSOOO) was dissolved at a concentration
of 10 mg/ml in 10 mM Tris.Cl (pH 7.5), 15 mM NaCl. The solution was heated at
100°C for 15 min, then allowed to cool slowly to room temperature, aliquoted and
stored at -2OOC.
3.6.6 DNase I stock solution
DNase I (Sigma D4263) was dissolved at a concentration of
1 mg/ml in TM buffer, aliquoted and stored at -2O’C .
3.6.7 DNaseI working solution
To remove contaminate DNA, the fresh DNase I solution
was prepared by diluting stock solution to 50 pg/ml concentration in double distilled
water (DDW).
3.6.8 TM buffer (L-l)
1 M Tris.Cl (pH 7.5) 50 ml
MgS04.7H20 2g
Sterilize by autoclave
3.6.9 SM buffer (L-r)
NaCl 5.8 g
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 68/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 69/140
5 2
3.6.15 Denaturing solution
1.5 M NaCl
0.5 M NaOH
3.6.16 Neutralizing solution
1.5 M NaCl
0.5 M Tris-HCl pH 7.2
0.001 M EDTA
3.6.17 100 x Denhard’s solution
2% (w/v) BSA (bovine serum albumin/Fraction V;Sigma)
2% (w/v) Ficoll (Type 400, Phamacia)
2%(w/v) PVP (polyvinylpyrrolidone)
The solution was filtered and stored at -20°C.
3.6.18 Heat denatured sheared calf thvmus DNA
The calf thymus DNA was dissolved in DDW at the
concentration of 10 mg/ml. This solution was stirred by a magnetic bar on a magnetic
stirrer for 16-l 8 hr at 4OC. Subsequently, the DNA was sheared by sonication. After
the viscosity of solution became low, the solution was then boiled for 10 min and
cooled on ice. The solution was stored at -2O’C in small aliquots.
3.6.19 Transformation Buffer I (TFB I) 1851
30 mM Potassium Acetate
100 mM Rubidium Chloride
10 mM CaC12.2H20
50 mM MnCL4H20
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 70/140
5 3
15%v/v Glycerol
sterilize.
Adjusted to pH 5.8 with 0.2 M Acetic acid and filter
3.6.20 Transformation Buffer II (TFB II) 1851
10 mM MOPS
75 mM CaC12.2H20
10 mM Rubidium chloride
15%v/v Glycerol
Adjusted to pH 6.0 with KOH and filter sterilize.
3.6.21 6 x gel loading buffer
0.25% bromophenol blue in 40% water
stored at 4°C
3.7 Molecular biology techniques
Most of the molecular biology techniques used have been described in
detail by Sambrook, et al (1989) unless otherwise stated.
3.7.1 General procedures
3.7.1.1 Phenol extraction
The phenol extraction was performed to remove proteins
from preparations of nucleic acids. An equal volume of phenol:chloroform solution
was added to the DNA solution. The mixture was vortexed vigorously for 10 se t and
then spun at room temperature in a microcentrifuge for 5 min. The top aqueous phase
containing the DNA was removed carefully using a 200 1 .11 pipettor and transferred to
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 71/140
5 4
a new tube. The phenol extraction was repeated until the DNA solution was clear or a
white precipitate was not present at the aqueous/organic interface.
3.7.1.2 Chloloroform extraction
The phenol eitraction was followed by chloroform
extraction to remove remain phenol in DNA solution. The equal volume of
phenol:chloroform solution was replaced by chloroform:isoamyl alcohol (24: 1)
solution and added to the DNA solution.
3.7.1.3 Ethanol precipitation
In a 1.5 ml microcentrifuge tube, a 0.1 volume of 3 M
sodium acetate, pH 5.2 and 2 volumes of cold ethanol was added to the solution of
DNA, mixed by flicking the tube several times with a finger and placed in a -20°C
freezer for at least 30 min. Then the solution was centrifuged at 4’C for 30 min at
14,000 rpm and the supernatant was poured off. The tube was added with 1 ml of
70% ethanol and inverted several times. The DNA was pelleted by centrifugation at
4’C for 5 min at 14,000 rpm and air dried pellet was dissolved in TE buffer or TDW.
3.7.1.4 Measurement of DNA concentration
The amount of DNA was quantitated by spectrophotometric
measurement. The reading at 260 nm of diluted DNA solution was calculated for the
concentration of nucleic acid in the sample. For double-stranded DNA, an OD260 of 1
corresponds to approximately 50 pg/ml was used for calculation. An estimate the
purity of DNA was assessed by the ratio between the reading at 260 nm and 280 mn
(OD2&OD280). This ratio of the pure DNA should have been 1.8. If there were any
contaminates such as phenol or protein, the OD260/OD 280 would be significantly less
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 72/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 73/140
56
Photographs of the gels were made using an Tominon MP-4 Polaroid camera with a
red filter.
3.7.1.7 DNA elution
The DNA fragments were eluted from the gel by using silica
matrix of Prep-A-Gene DNA purification kit (Bio-Rad, USA), following the
procedure from the company.
3.7.2 Plasmid extraction
3.7.2.1 Small scale
The boiling method was used for making small scale
preparation of plasmid DNA from E. coli.
A 1.5 ml of overnight culture in an eppendorf tube was
centrifuged at 12,000 g for 30 se t at room temperature. After removing the medium,
the bacterial pellet was resuspended in 450 pl of STET (0.1 M NaCl, 10 mM Tris.Cl
pH 8.0, S%Triton X-100), added 50 ~1 of a freshly prepared solution of lysozyme (10
mg/ml in 10 mM Tris.Cl pH 8.0) and mixed by vortexing for 3 sec. The tube was
placed in a boiling water bath for exactly 40 set, the bacterial lysate then was
centrifuged immediately at 12,000 g for 10 min at room temperature. The pellet of
bacterial debris was removed from the eppendorf tube with sterile toothpick. For the
plasmid DNA precipitation, a 40 ~1 of 2.5 M sodium acetate (pH 5.2) and 500 ~1 of
isopropanol was added to the supernatant, mixed and placed for 10 min at room
temperature. The plasmid DNA was recovered by centrifugation for 30 min at 4 ‘C,
rinsed with 1 ml of cold 70% ethanol and recentrifuged for 5 min at 4OC. The air
dried pellet was resuspended in 50 ~1 of DDW.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 74/140
5 7
The DNA solution was used directly for restriction analysis
(5 ul per reaction).
3.7.2.2 Large scale
The large amounts of pure plasmid was prepared by using
the QIAGEN kit (Germany).
A 0.5 ml of overnight culture of recombinant plasmid or
glycerol stock culture was inoculated in 100 ml of LB medium containing amplicillin
at the concentration of 100 pg/ml in 250 ml flask. The culture was incubated on a
rotary shaker at 37 ‘C, 200 rpm, 12 to 16 hr. The cells were harvested by centrifuged
at 6,000 r-pm at room temperature for 10 min. The QIAGEN protocol as
recommended by the company was followed. This method gave high plasmid yields.
3.7.3 Bacterial transformation
3.7.3.1 Preparation of the competent cells
The competent E. coli cells were prepared by using the
rubidium chloride method [85]. The single colony of E. coli strain DHScx was
inoculated in 10 ml of LB broth, incubated overnight at 37’C. A 100 ml of LB in a
250 flask was inoculated with 1 ml of overnight culture and incubated at 37°C with
agitation. Approximately 2-2.5 hr after inoculation, the ODsso of the culture was
around 0.5 and the culture was transferred to two 50 ml sterile centrifuge tubes,
chilled on ice for 5 min. The cell pellet was centrifuged at 4,000 r-pm for 10 min at
4’C, resuspended in 4 ml of ice cold transformation buffer I (TFB I, see section
3.6.19) by gently shaking on ice. The cell pellet was recentrifuged and resuspended in
4 ml of ice cold transformation buffer II (TFB II, see section 3.6.20) by gently
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 75/140
5 8
shaking on ice. The 200 ~1 of competent cells was dispensed into prechilled
eppendorf centrifuge tubes and freezed immediately at -7O’C .
3.7.3.2 Bacterial transformation
The introduction of plasmid DNA into E. coli cells was
done by using chemical transformation. The competent cells were allowed to thaw on
ice and each 100 ul of them was dispensed into an eppendorf tube containing plasmid
or recombinant plasmid DNA. The tube was gently swirled to mix and placed on ice
for 30 min. The cells were heat shocked by placing tube into 42°C water bath for 2
min and then cold shocked by immediately replacing tube on ice. A 1 ml of LB was
added into each tube which then agitated on a rotary shaker at 37°C for 1 hr. The
transformed cells of 100 to 200 ~1 was transferred onto the agar LB medium with 100
ug/ml of amplicillin, gently spread, inverted and incubated at 37’C. The transformed
bacteria could be appeared within 16 hr after incubation. The plates containing
transformants were either stored at 4’C or picked up and grown overnight in LB
medium for further screening.
3.7.4 Subcloning of DNA fragments
In order to construct recombinant plasmid DNA molecules, the
starting DNAs, interested DNA, plasmid DNA, were treated with appropriate
restriction endonucleases and incubated at appropriate temperature at least 1 hr. The
5’ phosphates were removed by treating with calf intestine phosphatase at 37’C for 1
hr to prevent self ligation. After the reaction of those enzymes was completed, they
were inactivated by heating at 75’C for 15 min. The desired DNA fragments were
isolated by agarose gel electrophoresis and recovered by using Prep-A-Gene DNA
Purification kit (Bio-Rad, USA) following the procedures from the company. The
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 76/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 77/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 78/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 79/140
6 2
3.8.3 Genomic library construction
S. platensis genomic DNA isolated as described above was partially
digested with Sau3A1, a restriction enzyme which gives compatible insert DNA with
the hDASHI1 arms of lambda DASHIIIBamHI Vector Kit (Stratagene, USA). The
lambda DASHII vector can accommodate inserts ranging from 9 to 23 kb, so the
digested DNA fragments were fractionated on 0.7% agarose gel and the fraction
containing 9 to 23 kb was isolated. These DNA fragments were recovered from the
gel with silica matrix of Prep-A-Gene DNA Purification kit (Bio-Rad, USA). The
ends of recovered DNA fragments were treated with calf intestine alkaline
phosphatase (CIAP) to prevent multiple inserts. The reaction of calf intestine alkaline
phosphatase was performed at 37’C for 1 hr, then EDTA was added to 5 mM final
concentration and heated at 75’C for 10 min to stop calf intestine alkaline
phosphatase activity. The calf intestine alkaline phosphatase was removed from
reaction by phenol-chloroform extraction. The treated DNA fragments was recovered
by precipitating with 1M final concentration LiCl and 2 volume absolute ethanol at -
20°C for 2 hr. The precipitated DNA was collected by centrifugation, 14,000 r-pm at
4°C for 30 min, and rinsed with 70% ethanol and absolute ethanol respectively. The
air dried DNA was dissolved in water. The concentration of the DNA was estimated
by visual comparison to the 0.25 pg/pl pMEIBamH1 12 kb test insert on 0.7%
agarose containing 1 pg/ml ethidium bromide.
The Sau3AI insert about 0.3 pg was ligated with 1 I-18 of the lambda
DASHIIIBamHI vector using T4 DNA ligase in total volume 5 pl at 4’C overnight
and then stored at -20°C. This ligation containing 1.3 pg of total DNA, which
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 80/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 81/140
6 4
ml LB agar. Plaques appeared after incubating at 37°C for 8-16 hr. Plates were stored
at 4OC for further screening.
3.8.5 Screening the DNA library
5’. platensis genomic ‘DNA library was screened using the
phycocyanin probe described in section 3.82. The screening involving the blotting
and hybridization was according to the protocol described by Amersham
International plc. (U.K.) for hybond N membranes.
The bacteriophage lambda were plated as described in section 3.8.4
to a density about 1000 plaques per 90 mm petri dish for 7 dishes. The nylon
membranes from Amersham were prepared in suitable size and carefully placed onto
the agar surface. The membranes and agar plates were orientated by using a sterile
needle (l&gauge) to punch 9 holes through the membrane and agar asymmetrically
around the outer edge. After 1 min the membrane was lifted and placed, colony side
up, on a pad of absorbent filter paper (Whatman 3MM) soaked in denaturing
solution, for 7 min. The membrane was then transferred, colony side up, onto a pad
of absorbent filter paper soaked in neutralizing solution, for 3 min. The neutralization
step was repeated with a fresh pad soaked in nutralizing solution. Finally the
membrane was washed with 2 x SSC and transferred onto a dry filter paper. After
drying, the DNA was fixed by baking at 80°C for 2 hr or UV crosslinking.
The membranes were prehybridized in a sealed hybridization bag
containing 6 x SSC, 5 x Denhard’s solution, 0.1% SDS and 100 pg/ml sonicated,
denatured calf thymus DNA at 65°C for 1 hr. For hybridization, the CX~~P labelled
probe (cpd gene of S. platensis) prepared with Prime-A-Gene Labeling System
(Promega, USA) was added into the bag that already cut open at one end. The bag
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 82/140
6 5
was resealed and incubated at 65’C, overnight. The membranes were then washed
twice in 2 x SSC, 0.1% SDS at room temperature for 10 min, once in 1 x SSC, 0.1%
SDS at 65’C for 10 min and twice in 0.1 x SSC, 0.1% SDS at 65’C for 10 min,
respectively. The membranes were kept det in a sealed plastic bag and exposed to an
X-ray film (Kodak) at -7O’C with intensifier screens. After autoradiography, plaques
from the areas of positive signals were isolated using a pastuer pipette and plated out
at a density of 200-300 plaques per 90 mm plate. Plaque lifts and hybridizations were
performed to confirm the previous result. Single positive clones were picked and
stored in SM buffer at 4°C for further characterization by restriction and Southern
blot analysis.
3.8.6 Preparation of DNA from bacteriophage
3.8.6.1 Preparation of clear lysate
A sterile pastuer pipette was used to pick up an agar plug
containing a single positive plaque and then inoculated into 50 ml LB broth
supplemented with 10 mM MgS04 and 200 1-11 of plating cells in 250 ml flask. The
culture was incubated for 10-l 6 hr at 37’C, 250 rpm. The culture then became cloudy
and subsequently cleared after lysis . Two ml of chloroform was added into the flask,
and the flask was incubated for 15 min at 37’C, 250 rpm. Bacterial debris was then
removed by centrifugation at 5,000 rpm for 10 min at room temperature. The
supernatant was transferred to a sterile bottle and 500 ~1 of 1M MgS04 was added.
This lysates could be stored at 4OC for several months.
3.8.6.2 DNA preparation
For phage DNA preparation, 10 ml of TM buffer and 320 ~1
DNaseI working solution were added to 10 ml lysate and then mixed by gentle
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 83/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 84/140
6 7
rinsed twice with DDW and then denatured in 0.5 M NaOH for 30 min with gentle
shaking. The gel was placed on nylon membrane prewetted with 10 x SSC. The DNA
was transferred onto the membrane by using Vacuum (Vacuum Blotter, Bio-Rad,
USA) for 90 min following the instruction manual. After the DNA was completely
transferred, the wells were marked with pencil. The membrane was rinsed with 2 x
SSC and the DNA was fixed by UV crosslinking or braking at 80°C for 2 hr.
The membrane was prehybridized in 6 x SSC, 5 x
Denhard’s solution, 0.1% SDS and 100 pg/ml sonicated, denatured carf thymus DNA
at 65’C for 1 hr then hybridized with the a3*P labeled cpcA probe at 65’C overnight.
After autoradiography, the positive signal from the various digested reaction of each
clone was characterize.
3.8.7.2 Cloning single positive fragment into plasmid
In order to construct recombinant plasmid DNA molecules,
interested DNA and plasmid DNA, were treated with appropriate restriction
endonucleases and incubated at appropriate temperature at least 1 hr. The 5’
phosphates of the end of plasmid DNA also treated with calf intestine phosphatase at
37’C for 1 hr to prevent self ligation of plasmid DNA. After the reaction of those
enzymes was complete, inactivated them by heating at 75OC for 15 min. The desired
DNA fragments were isolated by agarose gel electrophoresis and recovered by using
Prep-A-Gene DNA Purification kit (Bio-Rad, USA) following the procedures from
the company. The interested fragment about 0.2 to 0.3 pg was then ligated to 0.1 pg
of plasmid DNA using 2.5 units of T4 DNA ligase (Promega, USA) in a total volume
of 10 ~1. Half or all of the ligation mixture was used to transform E. coli DHSa as
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 85/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 86/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 87/140
7 0
3.8.10.3 Sequencing analysis
Sequencing of phycocyanin gene (cpcBA) of Spirulina
platensis Cl strain was performed by the dideoxy chain termination method using the
Sequenase Version 2.0 DNA Sequencing Kit (United States Biochemical, USA).
Double stranded DNA was used as the template for sequencing, following the
protocols described in the Sequenase Version 2.0 manual.
a. Preparation of sequencing reaction
The interested fragment containing cpcBA gene or partial
cpcBA gene subcloned into pGEM4 or pGEM7Z+ plasmid was first denatured using
alkaline-denaturation method. The DNA was denatured by adding 0.1 volumes of 2
M NaOH, 2mM EDTA and incubated for 30 min at 37°C. The DNA then neutralized
by adding 0.1 volumes of 3 M sodium acetate (pH 4.5-5.5) and precipitated with 2
volumes of ethanol, placed at -7O’C for 15 min. After washing the pelleted DNA
with 70% ethanol, it was dissolved in 6 ~1 of TDW and 2 ~1 of sequenase reaction
buffer and 2 ~1 of primer solution was added. The annealing of primer was carried
out by warming the mixture to 37’C for 30 min after that the DNA synthesis was
performed in two steps. In the first step, The primer was extended by sequenase
(bacteriophage T7 DNA polymerase contained no 3’--+5’ exonuclease activity), using
limiting concentration of the deoxynucleoside triphosphates (dGTP, dCTP, dTTP,
3.0 PM each), including radioactively labeled a3’S dATP (5 PM of lOOOCi/mmol)
for 3-5 min at room temperature. In the second step, the concentration of all
deoxynucleoside triphosphates was increased and a dideoxynucleoside triphosphate
was added. The reaction was terminated by the addition EDTA and formomide
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 88/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 89/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 90/140
73
that only two positive clones from the same original positive clone were obtained
after autoradiograph. These clones were designated hPC39A and hPC39B. The h
DNA from these clones was prepared as described in section 3.8.6 and used for
restriction mapping and Southern blot analysis. Although these clones transferred
from the same original positive clone, the restriction analysis by digestion of h DNA
of them with EcoRI as shown in Figure 4.1 indicated that they contained different
insert. This result indicated that there might be some contamination in original clone.
However the digested h DNA with EcoRI and CluI of both clones were transferred
into nylon membrane for Southern blot analysis. After hybridization and
autoradiograph, the positive fragment could not be found (Figure 4.2). This suggests
that there was no phycocyanin gene in these clones and the positive signal obtained
from the previous plaque hybridization should be false positive signal. The genomic
DNA~ library was rescreened several times with homologous probe, however the
positive clone containing phycocyanin gene could not be obtained.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 91/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 92/140
I
7 5
Figure 4.2 Southern blot analysis of recombinant lambda DNA of hPC39A and
hPC39B positive clones hybridized with homologous partial cpcA
probe. Lane A and B : DNA from hPC39A and hPC39B digested with
EcoRI. Lane C and D : DNA from hPC39A and hPC39B digested
with CM. Lane E : 400 bp partial cpcA fragments positive control.
Lane F : Lambda DNA digested with Hk&II and EcaRI.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 93/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 94/140
Figure 4.3 The autoradiograph of plaque hybridization of genomic DNA library II
of S. platensis Cl with homologous partial cpcA probe. A solid dot “0”
shows positive signal.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 95/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 96/140
79
- 0.9 kb
Figure 4.5 Southern blot analysis of recombinant lambda DNA of hPC30 (A),
C I EIKI S I E V SI/EV5 : I \ I \ I \ I \ I \
A B A B A B A B A B A B
-21.0 kb- 5.1 kb- 3.5 kb
- 2.0 kb- 1.5 kb
hPC39 (B) positive clones and h marker digested with Hindl1IIEcoR.I
(C) hybridized with homologous partial cpcA probe. SI:SalI,
EV:&oRV, EI:EcoRI, CI:CZuI.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 97/140
80
A B C D E
Figure 4.6 Southern blot
- 21.2 kb
- 5.1 kb
- 3.5 kb
g- 2.0 kb
analysis of genomic DNA of S . platensis C l digested
with EcoRV (A), BamHI (B), EC&I (C), ClaI (D) and HindlIIlEcoRI
h marker (E) probing with amplified partial cpcA fragments.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 98/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 99/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 100/140
8 3
4.1.2 Isolation of phycocvanin genes from partial genomic DNA library
During the rescreening of genomic DNA library I, the other
strategy was perused for isolating phycocyanin gene from S. platensis Cl. The partial
genomic library was employed as an alternative to whole genomic library as a source
of phycocyanin gene. The advantage of this library is the enrichment of possible
recombinant clones containing the desired gene(s). The Southern blot analysis of
genomic DNA of S. platensis Cl was performed to construct the restriction map and
to identify the site of the phycocyanin gene. The genomic DNA was completely
digested with various restriction enzymes, EcoRI, CZaI, BamHI and EcoRV. The
digested DNA fragments were transferred into nylon membrane and hybridized with
the cpcA probe as described in section 3.8.7.1. The result of Southern blot is shown
in Figure 4.6. Four single positive fragments were obtained. They were 2.7 kb CZaI,
4.2 kb EcoRV and high molecular weight BamHI and EcoRI fragments. The high
molecular weight BamHI and EcoRI fragments were too large to be cloned into the
plasmid vector. As a result, the 2.7 kb CZaI and 4.2 kb EcoRV fragments were chosen
for construction of partial genomic DNA library. A 20 ug of genomic DNA of S.
platensis Ci was completely digested with each restriction enzyme, CZaI and EcoRV.
The digestedDNAs
from each reaction were separated by electrophoresis in a 0.7%
agarose gel, subsequently, the 2.7 kb CZaI and 4.2 kb EcoRV fragments were isolated
from the gel using silica matrix of Prep-A-Gene DNA purification kit (Bio-Rad,
USA). Each 0.2 ug of 2.7 kb CZaI and 4.2 kb EcoRV fragments was cloned into
plasmid pGEM7Z+ and pGEM4, respectively. All of the ligation mixture was used to
transform E. coli DH5a. Because of the digested fragments were two base overhang
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 101/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 102/140
8 5
oligonucleotides (sequence number : 1739 and 1740, see section 3.5) designed from
the known sequence of the amplified partial cpcA gene were used as primers. The
procedure and conditions used for IPCR was described in section 3.8.9.1. The result
of IPCR is shown in Figure 4.8. The product of IPCR contained multiple bands,
however the expected 4.2 kb fragment was also obtained. The 4.2 kb EcoRV
fragment was eluted from the agarose gel and hybridized with homologous cpcA
probe. The result as shown in Figure 4.8 indicated that this fragment contained
phycocyanin gene. To increase the expected 4.2 kb fragment, this IPCR product was
used as the template for the next round of amplification. This template was amplified
by using usual polymerase chain reaction technique. The same oligonucleotides
primer as used in IPCR amplification were used. The result of this amplification gave
no distinct band instead a smear was seen (Figure 4.9). The PCR smearing might be
due to the excessive amounts of Taq DNA polymerase, inordinate long extension
times or cycling parameters. The amount of Tag DNA polymerase was decrease in
the later amplification and the first IPCR product used as the template, however the
PCR product is still smear. The amplification by using the first IPCR product and the
product of self ligation of 4.2 kb EcoRV fragment as the template was performed
several times. The amount of the template and Taq DNA polymerase and the
condition of amplification were varied, nevertheless the product was still smear.
Since the phycocyanin genes were successfully isolated from h
genomic DNA library II, further attempt to isolate phycocyanin genes by IPCR
technique was then ceased.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 103/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 104/140
8 7
Figure 4.9
A B C D E F
21.0 kb-
2.0 kb-
Amplification of IPCR product by using PCR technique. Lane A :
Hi&III and &MU digested lambda DNA. Lane B-F : Amplified
products using IPCR product at various concentration as template and
known sequences of amplified partial cpcA gene as primers.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 105/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 106/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 107/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 108/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 109/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 110/140
9 3
PAsp85 and PAsp39, at which the chromophores aCys84, pCys82 and pCys153,
respectively are held in the arched configuration of C-phycocyanin of Mastigocladus
laminosus [99] are also conserved in the phycocyanin amino acid sequence of S.
platensis Cr. The PArg57 which builds a salt bridge with a side chain of the a-84
chromophore of C-phycocyanin of A4. Zaminosus was also found at the same position
in the primary structure of the phycocyanin of S. platensis Cl.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 111/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 112/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 113/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 114/140
9 7
-35 -10
Spi TTTAATAAATTTTAACAAACTAAAAGGCACTGGCAGTGTATAAAT'GATATTTGAAGGGG------- -----
Ana ATTCACAATTTGTAACAAAATAAGGATCTATAGCATTGTATPAAC'AT AAGCTGGAGGGG
Cya TTTGATAAATTGTAACAAACAAAGTTAAAAAAA CACGATATAAMUdTATATAGCAATC
E. coli
consensus
TTGACA TATAAT
Figure 4.14 Comparison of the promoter sequences found upstream of the
transcriptional start sites of cpcB4 from Anabaena 7120 (Ana),
Cyanophora paradoxa (Cya) and putative promoter of 5’. platensis Cl
(Spi). Nucleotides which are identical in all sequences are indicated by
an *. The “ - 10” and “-35” regions are underlined. The transcriptional
start sites of both organisms and the possible transcriptional start site
of S. platensis are indicated by arrows.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 115/140
98
-35 -10
Spi (cpcBA) TTTAATAAATTTTAACYAACTAAAAGGCACTGGCACTGGCAGTGTATAAATG
Ana (cpcBA) ATTCACAATTTGTAACAAAATAAGGATCTATAGCATTGTATAAACA
Syn (cpcB1Al) -GTAATGTTTAAATGCCGGCAGACGTTGTATAACATTTACCTAA
Syn (cpcBZA2) -GCCAAGGTGAAAAACAAGCAAAAATAGCT-GACACTCTTAATTGG
Cal (cpcBlA1) ---CAATTCGTAATAAACACGATC-CAACGATATAGTATAAACAA
Cal (cpcBZA2) --ACA-AA?iTTTGCACAAAATTTAACACAAAG-CAATTGCTTTAA
* *
Figure 4.15 Comparison of the promoter sequences found upstream of the
transcriptional start sites of cpcBA from cyanobacteria Anabaena 7120
(Am), Synechococcus PCC 7002 (Syn), Calothrix PCC 7601 (Cal> and
putative promoter of S. platensis Cr (Spi). Nucleotides which are
identical in all sequences are indicated by an*. The ‘-10’ and ‘-35’
regions are underlined. The rightward most base of each sequence is
the transcriptional start site.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 116/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 117/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 118/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 119/140
10 2
(4Spi
Syn
SYSRYTVAYE QLSGQLQRIN AWGGRVISVT PA
SNATYFVSYE KLNATLQRVH AQGGRIVSIT PA
Spi -AITTQASRL GTTAFQESSL VELRPNWSRD NAQEVIRAVY RQLLGNDYLM
Syn MAITVASSRL GTAPFSNAAP VELRPDGDRD QVQAVIRAVY RQVLGNDYIM
Spi SSERLTSAES LLCDGSITVR ELVRCVAKSE LYKKKFFYPN FQTRVIELNY
Wn KSERLTAAES LLVNGSISVR DF'VRAVAKSE LYKTKFFYNN FQTRVIELHC
Spi KHLLGRAPYD ESEWFHLDL YQNEGYDADG D
S yn KHLLGRAPYS EAEVIEHLDR YETQGYDADV D
Figure 4.18 Comparison of deduced amino acid of partial cpcH (A) and cpcl (B) of
S. platensis Cl (Spi) with C terminal of cpcH and N terminal of cpcl
genes of Synechococcus PCC 6301 (Syn), respectively. The identical
amino acids are shown in boldface type.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 120/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 121/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 122/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 123/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 124/140
Chapter 5
Conclusion and Suggestion
5.1 Conclusion
The cpc genes encoding phycobilisome rod components were not obtained
either from partial genomic DNA library screening or from cloning by inverse
polymerase chain technique, but were obtained from hDASHI1 genomic DNA. From
this h genomic DNA library, the genes encoding the phycobilisome rod components,
cpcB and cpcA genes encoding phycocyanin a and p subunits, and cpcH and cpcl
encoding rod-rod linker polypeptides of S. platensis Ci were cloned. The complete
sequences of cpcB , cpcA and partial sequences of cpcH and cpcl genes were
determined. These genes form an operon cpcBAHI with possible cpcD downstream
of cpcl. There is one putative transcriptional start site in the upstream and one
putative termination site in the downstream of the cpcBA genes. The cpcBA genes
present as a single copy per genome. The promoter region of the cpc operon
resembles the consensus promoter sequences of E. coli.
The organization of genes is arranged in the following order cpcB , cpcA ,
cpcH, cpcI and there should be also cpcD which showed similarity to some other
cyanobacteria. The deduced amino acid sequences of cpc genes products are similar
to those products of either cyanobacteria and red algae. The identity of deduced
amino acid sequence products of cpcB and cpcA genes compared to those of
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 125/140
107
Synechococcus PCC7601, Synechococcus elongatus, Pseudanabeana PCC7409 and
Agaothamnion neglectum were 82.5, 81.9, 79.6 and 70.3% for cpcB gene and 79.6,
75.3, 79.6 and 70.3% for cpcA gene, respectively. For cpcH and cpcl genes, the
identity of partial amino acid sequences ‘between S. platensis Cr and Synecococcus
PCC6301 were 53.1% and 69.5% respectively. The predicted masses of the
phycocyanin subunit apoprotein are 19,111 and 18,000 daltons for p and a subunits,
respectively.
5. 2 agestion
1. To confirm whether the obtained genes are the cpc genes of S. platensis
Cl, the immunochemical method using antibodies against phycocyanin could be used
to screen E. coli colony which contain cpc genes.
2. The primer extension should be performed to analyze the transcriptional
start site of cpc genes.
3. From the Southern blot analysis of h positive clones, the 9 kb EcoRI
fragment of h39 positive clone could be subcloned and sequenced to obtain the
complete cpcBAHID operon.
4. If the non-produce phycocyanin mutant can be constructed and the
transformation system of S. platensis Cr is performable, the study of the expression
of cpc genes in S. platensis Cr can be done, which will provide information for
understanding the physiology and biochemistry of phycocyanin at molecular level.
5. The constructed ?L genomic DNA library is valuable as genomic DNA
source for isolation of the other genes of S. platensis Cl.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 126/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 127/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 128/140
110
1 8 .
1 9 .
2 0
21.
22.
23 .
24 .
25 .
Van Eykelenburg, C., 1980, “Rapid reversible macromorphological changes in
Spirulina platensis,” Naturwissenschaften, Vol. 67, pp. 200-201.
Becker, E.W., 1978, “The legislative background for utilization of microalgae
and other types of single cell protein,” Archives of Hydrobiology, Vol. 11, pp.
56-64.
Hedenskog, G. and Hofsten, A.V., 1970, “The ultrastructure of Spirulina
platensis-a new source of microbial protein,” Physiology Plant, Vol. 23, pp.
209-216.
Holmgren, P.R., Hostetter, H.P. and Scholes, V.E., 197 1, “Ultrastructural
observation of crosswalls in blue green alga Spirulina major,” Journal of
Phycology, Vol. 7, pp. 309-3 11.
Van Eykelenburg, C ., 1979, The ultra structure of Spirulina platensis in
relation to temperature and light intensity,” Antonic van Leeuwenhoek
Journal of Microbiological Serology, Vol. 45, pp. 369-390.
Herdman, M., Janvier, M., Rippka, R. and Stanier, R.Y., 1979, “Genome size
of cyanobacteria,” Journal of Genetic Microbiology, Vol. 111, pp. 73-85.
Chamorro, G., Salazar, M, Favila, L. and Bourges, H., 1996, “Pharmacology
and toxicology of Spirulina alga,” Reviews of Investigative Clinic, Vol. 48,
No. 5, pp. 389-399.
Hayashi, K., Hayashi, T. and Kojima, I., 1996, “A natural sulfated
polysaccharide, calcium spirulan, isolated from Spirulina platensis: in vitro and
ex vivo evaluation of anti-herpes simplex virus and anti-human
immunodeficiency virus activities,” AIDS Research of Human Retroviruses,
Vol. 12, No. 15, pp. 1463-1471.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 129/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 130/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 131/140
1 1 3
4 2 Sidler, W., 1994, “Phycobilisome and Phycobiliprotein Structures,” in The
Molecular Bioligy of cyanobacteria, Edited by Brayant, D.A., Dordrecht,
Academic Publishers, pp. 139-2 16..
43 . Ley, A.C., Butler, W.L., Bryant, D.A. and Glazer, A.N., 1977, “Isolation and
function of allophycocyanin B of Porphyridium cruentum,” Plant Physiology,
Vol. 59, pp. 974-980.
44. Lundell, D.J. and Glazer, A.N., 1983, Molecular architecture of a light-
harvesting antenna. Core substructure in Synechococcus 630 1 phycobilisome:
two new allophycocyanin and allophycocyanin B complexs,” Journal of
Biological Chemistry, Vol. 258, pp. 902-908.
45 . Swanson, R.V., de Lorimier, R. and Glazer, A.N., 1992, “Genes Encoding the
phycobilisome Rod Substructure Are Clustered on the Anabaena Chromosome:
Characterization of the Phycoerythrocyanin operon,” Journal of Bacteriology,
Vol. 174, No. 8, pp. 2640-2647.
46 . Bryant, D.A., Glazer, A.N. and Eiserling, F.A., 1976, “Characterization and
structural properties of the major biliproteins of Anaebaena sp,” Archives of
Microbiology, Vol. 110, pp. 61-75.
47. Zilinskas, B.A. and Greenwald, L.S., 1986, “Phycobilisome structure and
function,” Photosynthesis Reserch, Vol. 10, pp. 7-35.
48. Maxson, P., Sauer, K., Zhou, J., Bryant, D.A. and Glayzer, A.N., 1989,
“Spectroscopic studies of cyanobacterial phycobilisomes lacking core
polypeptides,” Biochemica et Biophysics Acta, Vol. 977, pp. 40-5 1.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 132/140
114
49 . de Lorimier, R., Bryant, D.A. and Stevens, S.E. Jr., 1990, “Genetic analysis of
a 9 kDa phycocyanin-associates linker polypeptide,” Biochimica et Biophysics
Acta, Vol. 1019, pp. 29-41.
50 . Grossman, A.R., Schaefer, M.R., Chiang, G.G., 1933, “The phycobilisome, a
light-Harvesting Complex Responsive to Environmental Conditions,”
Microbiology Reviews, Vol. 57, No. 3, pp. 725-749.
5 1. Rhie, G. and Beale, S.I., 1994, “Regulation of Heme Oxygenase Activity in
Cyanidium caldarium by light, Glucose, and Phycobilin Precursors,” The
Journal of biological chemistry, Vol. 269, No. 13, pp. 9620-9626.
5 2 Willium, V.P. and Glazer, A.N., 1978, Structural studies on phycobiliproteins.
I. Bilin-containing peptides of C-phycocyanin,” The Journal of Biological
Chemistry, Vol. 253, pp. 202-211.
53 . Zhou, J., Gasparich, G.E., Stirewalt, de Lorimier, R. and Bryant, D.A., 1992,
“The cpcE and cpcF Genes of Synechococcus sp. PCC7002,” The Journal of
Biological Chemistry, Vol. 267, No. 23, pp. 16138-16145.
54 . Fairchild, C.D., Zhao, J., Zhou, J., Colson, S.E., Bryant, D.A. and Glazer, A.N.,
1992, “Phycocyanin a-subunit phycocyanobilin lyase,” Proceeding of The
National Academy of Science of The United States of America,” Vol. 89,
pp. 7017-7021.
55. Fuglistaller, P., Suter, F. and Zuber, H., 1985, Linker polypeptides of the
phycobilisome from the cyanibacterium Mastigocladus Zaminosus: Amino acid
sequences and relationships. Biological Chemistry Hoppe-Seyler, Vol, 366,
pp. 993-1001.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 133/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 134/140
116
62 . Dubbs, J.M. and Bryant, D.A., 1987, “Organization of the genes encoding
phycoerythrin and the two differentially expressed phycocyanins in the
cyanobaterium Pseudanabaena sp. PCC 740,” Progress in Photosynthesis
Research, Vol. 5, pp. 765-768. ’
63. Grossman, A.R., 1990, “Chromatic adaptation and the events involved in
phycobilisome biosynthesis,” Plant Cell Environmental, Vol. 13, pp. 65 l-
666.
64 . Lonneborg, A., Lind, L.K., Kalla, S.R., Gustafsson, P. and Oguist, G., 1985,
“Acclimination process in the light-harvesting system of Cyanobacterium
Anacystis nidulans following a light shift from white to red light,” Plant
Physiology, Vol. 78, pp. 1 l-l 14.
65 . Rap, S., Wyman, K., Siegelman, H.W. and Falkowski, P.G., 1983, “Adaptation
of the cyanobacterium Microcystis aeruginosa to light intensity,” Plant
Physiology, Vol. 72, pp. 829-832.
66 . Garnier, F., Dubaeq, J.P. and Thomas, J.C., 1994, “Evidence For a Transient
Association of New Proteins with the Spirulina maxima Phycobilisome in
Relation to light Intensity,” Plant Physiology, Vol. 106, pp. 747-754.
67 . Garnier, F. and Thomas, J.C., 1993, “Light regulation of phycobilliproteins in
Spirulina maxima,” Bullentin de’ Institut oceanograique Monaco: no
special, Vol. 12, pp. 41-48.
68 . de Lorimier, R.M., Smith, R.L. and Stevens, S.E. Jr, “Phycobilisome structure
and gene expression by light intensity,” Plant Physiology, Vol. 98, pp. 1003-
1010.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 135/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 136/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 137/140
119
83.
84.
8.5 .
86
87.
88.
89.
90.
Zarrouk, C., 1996, Construction a 1’ Etude d’ une Cyanophycae Influence de
divers Facteurs Physiques et Chimi ques sur las Croissance et la Photosysthes
de Spirulina maxima, Thesis, University of Paris, 84 p.
Sambrook, J., Fritsch, E.F. and Maniatis, T., 1989, Molecular Cloning. A
Laboratory Manual. 2nd ed., New York, Cold Spring Harbor Laboratory Press,
pp. 1.1-18.88.
Hanahan, D., 1983, “Studies on transformation of Escherichia coli with
plasmids,” Journal of Molecular Biology, Vol. 166, No. 4, pp. 557-580.
Glatron, M.F. and Rapoport, G., 1972, “Biosynthesis of the parasporal
inclusion of Bacillus thuringiensis : half-life of its corresponding messenger
RNA,” Biochime, Vol. 54, pp. 1291-1301.
Marzel, D., Houmard, J. and Tandeau de Marsac, N., 1988, “A multigene
family in Caothrix sp. PCC 7601 encodes phycocyanin, the major component
of the cyanobacterial light-harvesting antenna,” Molecular and General
Genetics, Vol. 211, pp. 296-304.
Davis, L.G., Dibner, M.D. and Battey, J.F., 1986, Basic methods in Molecular
Biology, New York, Elsevier, 388 p.
O&man, H., Gerber, A.S. and Hartl, D.L., 1988, “Genetic application of an
inverse polymerase chain reaction,” Genetics, Vol. 120, pp. 62 l-623.
Deshnium, P., 1992, Molecular cloning of the gene for Al2 desaturase from
Spirulina platensis Italy strain, Master of Science Thesis, Biotechnology
Program, King Mongkut’s Institute of Technology Thonburi, 80 p.
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 138/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 139/140
8/6/2019 2 Molecular Cloning and Characterization of the Phycocyanin Genes From Spirulina Platensis c1
http://slidepdf.com/reader/full/2-molecular-cloning-and-characterization-of-the-phycocyanin-genes-from-spirulina 140/140