1. supplementary figures and legends - media.nature.com · pappu, r. et al. promotion of lymphocyte...

1. Supplementary Figures and Legends

Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins

expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of

mRNA for two integrins, CD11b/integrin αM and CD18/integrin β2, in the

RAW264.7 murine monocytoid cell line. The expression of CD11b/integrin αM was

increased to two-fold by the treatment of S1P, whereas that of CD18/integrin β2

was slightly increased (~1.2 fold) only in the presence of high-dose of S1P (10-6

M). Error bars represent SEM (n = 3 for each).

SUPPLEMENTARY INFORMATION

doi: 10.1038/nature07713

www.nature.com/nature 1

Supplementary Fig. 2. Differentiation of CX3CR1-EGFP+ and CSF1R-EGFP+

cells into TRAP+ mature osteoclasts. Femoral bone tissues of heterozygous

CX3CR1-EGFP knock-in mice (a) and CSF1R-EGFP transgenic mice (b).

Fluorescent images for EGFP (left panels), staining for TRAP (tartrate-resistant

acid phosphatase) (middle panels), and overlay (with transmission image) (right

panels). Scale bar represents 20 µm.

doi: 10.1038/nature07713 SUPPLEMENTARY INFORMATION


Supplementary Fig. 3. In vivo migratory behavior of CSF1R-EGFP positive

cells in calvaria bone tissues visualized using intravital two-photon imaging.

Summary of the mean velocities of CSF1R-EGFP positive cells, in the presence

of vehicle (black boxes) or the S1P1 agonist SEW2871 (5 mg/kg) (red circles).

Data points (n = 211 for vehicle and n = 308 for SEW2871) represent individual

cells compiled from 4 independent experiments. Intravital two-photon images of

mouse skull bone tissues of CSF1R-EGFP transgenic mice in the absence or

presence of SEW2871 are shown in Supplementary Videos 5 and 6, respectively.



Supplementary Fig. 4. Effect of SEW2871 on the composition of peripheral

mononuclear cells (PMC). PMC collected from mice 1 hour after administration

of vehicle (left panel in a) or SEW2871 (5 mg/kg) (right panel in a) were stained

with anti-CD3 (PE-Cy7) and anti-CD11b (FITC). Cell counts are shown in b. V,

vehicle; SEW, SEW2871; T, CD3+ T cell; Mo, CD11b+ monocytoid cell. Error bars

represent SEM (n = 3 for each).



Supplementary Fig. 5. Loss of S1P1 expression in CD11b+ myeloid cells in

the cS1P1-/- mice. Conventional RT-PCR detection (a) and real-time quantitative

PCR analysis (b) of S1P1 mRNA in total mononuclear cells (MNC) and MNCs

sorted using CD11b-microbeads (Milteny Biotec), from wild-type and conditional

(CD11b+ lineage-specific) S1P1 knockout (cS1P1-/-) mice. Primers used for

detecting S1P1 (a) were the same ones used in Fig. 1 (the sequences are listed in

Supplementary Table 4). c, Immunohistochemical analysis of S1P1 in femoral

bone tissues from control and cS1P1-/- mice. Staining for S1P1 (green) was

merged with transmission (Nomarski image). Scale bar represents 20 µm.



Supplementary Fig. 6. Histological examination combined with

computational quantification for measuring osteoclast attachment ratio to

the bone surface. Left panel, dual fluorescent imaging of bone trabeculae and

osteoclasts with two-photon microscopy. Osteoclasts were visualized by

fluorescence-based TRAP staining with ELF97 substrate (green) and bone

trabeculae were detected by 2nd harmonic emission (cyan). Right panel,

computational segmentation of the image (F. K., submitted). Blue areas represent

bone trabeculae (2nd harmonic fluorescence signal) and red and green areas

show TRAP-positive osteoclasts that are attached to or detached from bone

trabeculae, respectively. Bone-osteoclast interfaces were automatically detected

and are shown as white lines between the red and blue areas.



Supplementary Fig. 7. Absence of effects of S1P on RANKL-induced

osteoclastogenesis in vitro. a, Representative images of osteoclast precursor

RAW264.7 cultured for four days with RANKL (50 ng/ml) in the absence (left

panel) or presence (10-8 M) (right panel) of S1P. Scale bar represents 50 µm. b,

Number of nuclei within TRAP-positive multinucleated (more than 4 nuclei) cells

per visual field. Error bars represent ± SEM (n = 5 for each). More than 1000

nuclei were counted in ten visual fields



Supplementary Fig. 8. Model of S1P-directed chemotaxis of osteoclast

precursor monocytes. Before they can undergo terminal maturation on the bone

surface, a subset of osteoclast precursors detaches and re-enters the blood

circulation due to the presence of an S1P gradient. Treatment with S1P1 agonists,

such as SEW2871, further mobilize osteoclast precursors, leading to inhibition of

osteoclastogenesis. RANKL signaling down-regulates the expression of S1P1,

inhibiting osteoclast precursor re-exit into the circulation, enhancing osteoclast

maturation and function.



Supplementary Fig. 9. Effect of FTY720 on the composition of peripheral

mononuclear cells (PBMC) and bone marrow cells (BM). PBMC (a) and BM

cells (c) collected from the mice 4 hour after administration of vehicle or FTY720

(3 mg/kg) were stained with anti-CD3 (PE-Cy7) and anti-CD11b (FITC). The

corresponding cell counts are shown in b and d. V, vehicle; FTY, FTY720; T,

CD3+ T cell; Mo, CD11b+ monocytes (in b). Error bars represent SEM (n = 3 for

each). e, Immunofluorescent detection of F4/80+ monocytes (red) and B220+ B

cells (green) in mouse femoral bone tissues treated with vehicle (left) or FTY720

(right). Nuclei were labeled with Hoechst 33342 (blue). Scale bars represent 20



µm. Corresponding cell counts are shown in f. FTY720 appears to act as a

"functional agonist" that promotes exit of OP monocytes from bone marrow,

although this drug has been reported to act as a "functional antagonist" for

lymphocyte egress from secondary lymphoid organs by down-regulating S1P1

expression24, 25. The difference may lie in evidence showing that the functional

effect of S1P or FTY720 varies depending on the cell type or organ under

study31-33.



Supplementary Fig. 10. Differential temporal effect of FTY720 and SEW2871

on the mobilization of CD11b+ OP/monocytoid cells. PBMC collected from the

mice treated with SEW2871 (SEW, 5 mg/kg, i.v.) or FTY720 (FTY, 3 mg/kg, i.p.)

for 1, 5, and 20 hours, were stained with anti-CD11b (FITC). SEW2871, a

self-active S1P1 receptor agonist, was injected intravenously, and the monocytoid

cell-mobilizing effect was visible within 1 hour and less prominent after 4 hours.

On the other hand, FTY720 was injected by intraperitoneally and needs

metabolism (phosphorylation) for activation. The effect of FTY720 occurred more

slowly and lasted longer, diminishing after 20 hours).



2. Supplementary Tables

Supplementary Table 1. FACS analysis of MNCs from CX3CR1-EGFP

(heterozygous) knock-in and CSF1R-EGFP transgenic mice. Data are shown as

mean ± SEM.

CX3CR1-EGFP CSF1R-EGFP

In total MNCs

EGFP+ cells 25.9 ± 0.8 % 56.3 ± 4.8 %

In EGFP+ cells

RANK 66.5 ± 3.4 % 50.6 ± 5.5 %

CD11b+ 95.7 ± 6.6 % 92.2 ± 8.4 %

CD11c+ 38.9 ± 2.8 % 30.3 ± 5.0 %



Supplementary Table 2. FACS analysis of CD11b+ MNCs in bone marrow,

spleen and liver, treated with SEW2871, FTY720 or vehicles. Data are shown as

mean ± SEM.

vehicle SEW2871 P value

Bone marrow 47.1 ± 1.3 % 32.9 ± 1.6 % p = 0.0007

Spleen 15.5 ± 0.8 % 18.7 ± 0.2 % p = 0.17

Liver 29.6 ± 0.4 % 32.5 ± 0.2 % p = 0.15

vehicle FTY720 P value

Bone marrow 47.1 ± 1.3 % 34.1 ± 2.1 % p = 0.0017



Supplementary Table 3. Uterine weight of control and ovariectomized mice.

Uterine weight (mg)

Mice Mean SEM.

Sham-operated, vehicle 98.6 20.8

Sham-operated, FTY720 116.3 52.0

Ovariectomized, vehicle 15.9 4.4

Ovariectomized, FTY720 15.5 2.9

Differences between the ovariectomized and sham-operated mice were

statistically significant (p < 0.01), whereas difference between the mice treated

with vehicle and those with FTY720 were not statistically different (p > 0.05).



Supplementary Table 4. Primer pairs used for RT-PCR to detect mRNA of S1P

receptors. The expected molecular weight in base pairs (b.p.) is indicated. The

presence of mRNA for GAPDH was detected as a control.

Forward (5’-3’) Reverse (5’-3’) b.p.

S1P1 GCTGCTTGATCATCCTAGAG GAAAGGAGCGCGAGCTGTTG 318

S1P2 CCAAGGAGACGCTGGACATG TGCCGTAGAGCTTGACCTTG 511

S1P3 GCAACTTGGCTCTCTGCGAC GACGATGGTCACCAGAATGG 342

S1P4 GTGTATGGCTGCATCGGTCTGTG GGATTAATGGCTGAGTTGAACACG 485

S1P5 GTGGCGCTCGCCGCGTCGGTG GAAGGTGTAGATGATGGGATTCAG 625

GAPDH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA 452




3. Supplementary Video Legends

Supplementary Videos 1 and 2. In vitro chemotaxis of RAW264.7 cells toward

an S1P gradient detected using the EZ-Taxiscan device. Cells were loaded in the

upper chamber in the absence (Supplementary Video 1) or presence

(Supplementary Video 2) of S1P (10-8 M) and images were taken every minute for

2 hours. Scale bars represent 150 µm. Playback speed is 300x.

Supplementary Videos 3 and 4. Intravital two-photon imaging of mouse skull

bone tissues of CX3CR1-EGFP knock-in (heterozygous) mice. Sequential images

in the same visual field were acquired before (Supplementary Video 3) and 30

minutes after (Supplementary Video 4) intravenous injection of the potent S1P1

agonist, SEW2871 (5 mg/kg). CX3CR1-EGFP positive cells can be seen in green.

The microvasculature of bone marrow tissues was visualized by intravenous

injection of 70kDa dextran-conjugated Texas Red (red). Scale bars represent 50

µm. Playback speed is 300x.

Supplementary Videos 5 and 6. Intravital two-photon imaging of mouse skull

bone tissues of CSF1R-EGFP transgenic mice. Sequential images in the same

visual field were acquired before (Supplementary Video 5) and 30 minutes after

(Supplementary Video 6) intravenous injection of the potent S1P1 agonist,

SEW2871 (5 mg/kg). CSF1R-EGFP positive cells can be seen in green. The

microvasculature of bone marrow tissues was visualized by intravenous injection

of 70kDa dextran-conjugated Texas Red (red). Scale bars represent 50 µm.

Playback speed is 300x.

Supplementary Video 7.

Intravital two-photon imaging of mouse skull bone tissues of CX3CR1-EGFP

knock-in (heterozygous) mice, pre-treated with FTY720 (3 mg/kg, i.p.) 4 hours



before imaging. CX3CR1-EGFP positive cells can be seen in green. The

microvasculature of bone marrow tissues was visualized by intravenous injection

of 70kDa dextran-conjugated Texas Red (red). Scale bars represent 50 µm.

Playback speed is 300x.



4. Supplementary Notes

31. Pappu, R. et al. Promotion of lymphocyte egress into blood and lymph by

distinct sources of sphingosine-1-phosphate. Science 316, 295-298 (2007)

32. Pham, T. H. et al. S1P1 receptor signaling overrides retention mediated by

Gαi-coupled receptors to promote T cell egress. Immunity 28, 122-133

(2008)

33. Schwab, S. R. & Cyster, J. G. Finding a way out: lymphocyte egress from

lymphoid organs. Nat. Immunol. 8, 1295-1301 (2007)



1. supplementary figures and legends - media.nature.com · pappu, r. et al. promotion of lymphocyte...

Documents