1-s2.0-s0960852413013655-main

8/21/2019 1-s2.0-S0960852413013655-main

1/7

Engineering and adaptive evolution ofEscherichia coliW for L-lactic acid

fermentation from molasses and corn steep liquor without additional

nutrients

Yongze Wang a, Kunpeng Li a, Feng Huang a, JinhuaWang a,, Jinfang Zhao a, Xiao Zhao a, Erin Garza a,b,Ryan Manow b, Scott Grayburn b, Shengde Zhou a,b,

a Hubei Provincial Cooperative Innovation Center of Industrial Fermentation, Key Laboratory of Fermentation Engineering, Ministry of Education, College of Bioengineering,

Hubei University of Technology, Wuhan 430068, PR Chinab Department of Biological Sciences, Northern Illinois University, DeKalb, IL 60115, USA

h i g h l i g h t s

AnEscherichia coliW derivative, WYZ-L, was engineered for production ofL(+)-lactic acid.

WYZ-L produced 97 g L1 L(+)-lactic acid from 100 g L1 sucrose with an optical purity of 99%.

WYZ-L effectively fermented the combined wastes of molasses and corn steep liquor into L(+)-lactic acid without other nutrients.

a r t i c l e i n f o

Article history:

Received 10 May 2013

Received in revised form 16 August 2013

Accepted 19 August 2013

Available online 27 August 2013

Keywords:

Adaptive evolution

Escherichia coli

L(+)-Lactic acid

Molasses

Sucrose fermentation

a b s t r a c t

TheD-lactic acid producing strain, Escherichia coli HBUT-D, was reengineered for L(+)-lactic acid fermen-

tation by replacing the D-lactate dehydrogenase gene (ldhA) with an L(+)-lactate dehydrogenase gene

(ldhL) fromPedicoccus acidilactici, followed by adaptive evolution in sucrose. The resulting strain, WYZ-

L, has enhanced expression of the sucrose operon (cscAandcscKB). In 100g L1 of sucrose fermentation

using mineral salt medium, WYZ-L produced 97 g L1 ofL(+)-lactic acid, with a yield of 90%, a maximum

productivity of 3.17 g L1 h1 and an optical purity of greater than 99%. In fermentations using sugarcane

molasses and corn steep liquor without additional nutrients, WYZ-L produced 75 g L1 ofL(+)-lactic acid,

with a yield of 85%, a maximum productivity of 1.18 g L1 h1, and greater than 99% optical purity. These

results demonstrated that WYZ-L has the potential to use waste molasses and corn steep liquor as a

resource for L(+)-lactic acid fermentation.

2013 Elsevier Ltd. All rights reserved.

1. Introduction

Compared to traditional petroleum-based plastics, biodegrad-

able polylactic acid (PLA) is an environmentally friendly polymer

with potential applications in food packaging, and in the medical

and agrochemical industries (Datta and Henry, 2006; Garlotta,

2001; Wang et al., 2010). To enable PLA to compete with other

polymers, a readily available inexpensive feedstock is needed for

cost-effective production of optically pure L-lactic acid by micro-

bial fermentation. Starch-based, cellulosic biomass-derived, and/

or sugarcane molasses-based substrates have been evaluated for

L-lactic acid fermentation by lactic acid bacteria (Aniguchi et al.,

2005; Ilmn et al., 2007; Karp et al., 2011; Kotoyoshi et al., 2010;

Naveena et al., 2004; Nakasaki and Adachi, 2003; Patel et al.,

2004; Phrueksawan et al., 2012; Roble et al., 2003; Sakai and Ezaki,

2006; Shinkawa et al., 2011; l Shi et al., 2012). However, since

starch-based substrates compete with food resources, and cellu-

losic biomass-derived substrates require complicated pretreat-

ment/hydrolysis processing, sucrose-rich sugarcane molasses

(waste products) and other waste molasses containing simple

sugars would be a preferred substrate for L-lactic acid production,

provided that the biocatalysts are sucrose positive (Scr+).

Many lactic acid bacteria are sucrose positive. However, most of

them, if not all, require complex nutrient supplements due to their

inability to synthesize certain amino acids and B vitamins (Hofven-

dahl and Hahn-Hagerdal, 2000). In contrast, enteric bacteria such

as Escherichia coli and Klebsiella oxytoca have simple nutrient

requirements and often achieve fermentation yields of greater than

90%. Although K. oxytoca is sucrose positive and has been engi-

neered for D-lactic acid fermentation (Sangproo et al. 2012), the

0960-8524/$ - see front matter 2013 Elsevier Ltd. All rights reserved.http://dx.doi.org/10.1016/j.biortech.2013.08.114

Corresponding authors at: Department of Biological Sciences, Northern Illinois

University, DeKalb, IL 60115, USA. Tel.: +86 13971203423; fax: +1 815 753 7842.

E-mail addresses: [email protected] (J. Wang), [email protected] (S.

Zhou).

Bioresource Technology 148 (2013) 394400

Contents lists available at ScienceDirect

Bioresource Technology

j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / b i o r t e c h
http://dx.doi.org/10.1016/j.biortech.2013.08.114mailto:[email protected]:[email protected]://dx.doi.org/10.1016/j.biortech.2013.08.114http://www.sciencedirect.com/science/journal/09608524http://www.elsevier.com/locate/biortechhttp://www.elsevier.com/locate/biortechhttp://www.sciencedirect.com/science/journal/09608524http://dx.doi.org/10.1016/j.biortech.2013.08.114mailto:[email protected]:[email protected]://dx.doi.org/10.1016/j.biortech.2013.08.114http://crossmark.crossref.org/dialog/?doi=10.1016/j.biortech.2013.08.114&domain=pdf

8/21/2019 1-s2.0-S0960852413013655-main

2/7

majority of E. coli strains, however, are sucrose negative (Scr)

(Jahreis et al., 2002; Sahin-Toth et al., 1999). Consequently, the lac-

tic acid and 3-hydroxyl propionate (3-HP) strains engineered from

E. coliK12, B, W3110 and/or their derivatives are unable to utilize

sucrose (Chang et al., 1999; Dien et al., 2001; Kwak et al. 2013;

Mazumdar et al., 2010; Utrilla et al., 2012; Zhou et al., 2003; Zhu

et al., 2007). In addition, the sucrose utilization operon from

E. coliKO11, a presumably W derivative, was cloned and expressed

into the W3110 strain for successful production of D-lactic acid

(SZ63), but was unsuccessful for L-lactic acid production (SZ85)

due to instability of the cscgene-encoding plasmid (Shukla et al.

2004). Alternative biocatalysts, with simple nutrient requirements

and the ability to use sucrose, are needed for L-lactic acid produc-

tion using sugarcane molasses and other waste sugars as an inex-

pensive substrate.

E. coliW, Scr+ strain (Lee et al., 1997) containing chromosomal

sucrose utilization genes, would be a suitable candidate forL-lactic

acid fermentation using waste molasses. Furthermore, the chromo-

somal sucrose operon (cscAK, cscB, cscR) and its regulation have

been described in details (Sabri et al., 2013). Briefly, the sucrose op-

eron consists of three structure genes (cscAK,cscB) and a regulator

gene (cscR). The cscB gene encodes for sucrose permease; cscA

encodes for sucrose hydrolase that splits sucrose into glucose-1-

phosphate and fructose; cscK encodes for fructokinase that con-

verts fructose into fructose-6-phosphate. However,cscA andcscK

are located in one operon (cscAK). Both cscAK andcscB are regu-

lated by a CscR regulator.

Previously, we have engineered an E. coli W derived strain,

HBUT-D, for the homofermentative production of D-lactic acid,

through chromosomal deletion of the competing fermentation

pathway genes (adhE, frdABCD, pta, pflB, aldA) and the repressor

gene (cscR) of the sucrose operon (Wang et al., 2012). In this paper,

we report reengineering the HBUT-D strain for L-lactic acid fermen-

tation by replacing the endogenous ldhA gene with an exogenous

ldhL gene from Pedicoccus acidilactici, followed by adaptive

evolution of the resulting strain, HBUT-L, to enhance sucrose fer-

mentation. The evolved strain, WYZ-L, was able to produce

7 5 g L 1 of optically pure L-lactic acid from sugarcane molasses

and corn steep liquor (CSL) waste without additional nutrient sup-

plementation, with a yield of 85% and a maximum volumetric pro-

ductivity of 1.18 g L1 h1.

2. Methods

2.1. Strains, plasmids, media and growth conditions

TheE. coli strains, plasmids and primers used in this study are

listed in Table 1.E. coliHBUT-D (DfrdBC,DadhE,Dpta,DpflB,DcscR,

DaldA)(Wang et al., 2012), a D-lactic acid producing derivative of

E. coli W (ATCC 9637), was used for engineering the L-lactic acid

strain HBUT-L and WYZ-L (Table 1). During strain construction,

the cultures were grown at 37 C in LuriaBertani (LB) broth (per

liter: 10 g tryptone, 5 g yeast extract, and 5 g sodium chloride),

on LB plates (2% agar); or in NBS mineral salts medium (Causey

et al., 2003), on NBS plates (2% agar), supplemented with 2% glu-

cose or 2% sucrose. Ampicillin (50 lg mL1) or kanamycin

(50lg mL1) was added as needed for plasmid and/or strain selec-

tion. For selection of theldhAdeletion strain from HBUT-D and the

ldhLintegration strain from HBUT-D (DldhA), the cells were inocu-lated into 10 ml screw-cap tubes filled completely with NBS med-

ium (2% glucose), incubated at 37 C for 48 h, the ldhA deletion

strain showed no fermentative growth and the ldhL strain regained

fermentative growth. The engineeredE. coliHBUT-L, and its adap-

tively evolved derivative WYZ-L, were maintained daily on NBS

plates containing 2% sucrose.

2.2. Genetic methods

Standard methods were used for transformation and electro-

poration (Miller, 1992; Sambrook and Russell, 2001). The Red

recombinase system, with plasmids pKD4, pKD46, and pFT-A

(Table 1) was used for deletion of the ldhA gene and integration

of the ldhL gene as follows: a hybrid primer pair was designed

Table 1

E. coli strains, plasmids and primers used in this study.

Strains Relevant characteristics Sources

HBUT-D E. coli W, 4frdBC, 4adhE, 4pta, 4pflB, 4cscR, 4aldA Wang et al. (2012)

HBUT-D-4ldhA HBUT-D, 4ldhA, lost fermentative growth This study

HBUT-L HBUT-D-4ldhA, 4ldhA::ldhL, regained fermentative growth This study

WYZ-L HBUT-L, adaptively evolved mutant with improved growth& lactic acid production in sucrose fermentation This study

Plasmid

pKD4 FRT-kan-FRT cassette Datsenko and Wanner (2000)

pKD46 bla, red recombinase, temperature-dependent replication Datsenko and Wanner (2000)

pFT-A bla, flp, temperature-dependent replication Posfai et al. (1999)

PrimersCloning/integrationldhL-P1 CCTATTATTTATGGCGGTGTCGTTT This study

Cloning/integrationldhL-P2 CAGTTCGCTGACTGTAAGTTGTTGC This study

DeleteldhA-P1 ATGAAACTCG CCGTTTATAG CACAAAACAG TACGACAAGA AGTACGTGTGTAGGCTGGAGATGCTTC1 This study

DeleteldhA-P2 TTAAACCAGTTCGTTCGGGCAGGTTTCGCCTTTTTCCAGATTGCTTAAGTAGCCATATGAATATCCTCCTTAG1 This study

Verify 4ldhA-P1 ATGAAACTCG CCGTTTATAG CA This study

Verify 4ldhA-P2 TTAAACCAGTTCGTTCGGGCA This study

Verify integrationldhL-P1 GGTTCTAGTTACGCATTCG This study

Verify integrationldhL-P2 CTTCTTCTTTTCGTCATCG This study

rrsAqPCR primer-1 CGGTGGAGCATGTGGTTTAA Manow et al. (2012)

rrsAqPCR primer-2 GAAAACTTCCGTGGATGTCAAGA Manow et al. (2012)

cscA_qrtF1 GTCCGGACATTCCCACATATAG Sabri et al. (2013)

cscA_qrtR1 AGGCAACACGGGGCAGATCCTG Sabri et al. (2013)

cscB_F1 ATCCGTCTTCAAATACAGCGTGG Sabri et al. (2013)

cscB_R1 CAGCACAATCCCAAGCGAACTGG Sabri et al. (2013)

cscK_F1 GCCGGGTTACTCACAGGTCTG Sabri et al. (2013)

cscK_R1 TTCGCCGTTACTGCAAGCGCT Sabri et al. (2013)

The underlined sequence is homologous to the flanked sequence of the FRT-kan-FRT cassette in pKD4.

Y. Wang et al. / Bioresource Technology 148 (2013) 394400 395
http://-/?-

8/21/2019 1-s2.0-S0960852413013655-main

3/7

for the ldhA deletion, with primer-N (65 bp) containing 45 bp of the

N-terminal end of the ldhA coding sequence and a 20 bp P1 se-

quence of pKD4 (P1-FRT-kan-FRT-P2); primer-C (65 bp) containing

45 bp complementary to the C-terminal end ofldhAand a 20 bp P2

sequence of pKD4 (P1-FRT-kan-FRT-P2) (Wang et al., 2012; Zhou

et al., 2003). The FRT-kan-FRT cassette was amplified by PCR using

XmnI digested pKD4 as the template and the above hybrid primer

pair (Datsenko and Wanner, 2000). After purification (Qiagen PCR

purification kit), the amplified DNA was electroporated into the

pKD46 transformed E. coli HUBT-D by a Micropulser (Bio-Rad)

using the vendors Ec2 procedure (2.5 KV). Kanamycin resistant

colonies were selected and verified by PCR. The antibiotic marker

(kan) was then removed from the chromosome with a FRT recog-

nizing site-specific recombinase (flipase) by using a temperature-

conditional helper plasmid (pFT-A) (Posfai et al., 1999). The ldhA

deletion was then verified by analysis of PCR product size using

verification primers (Table 1), resulting in strain HBUT-D (DldhA)

which showed no fermentative cell growth.

For ldhL integration, an integration primer pair was designed

with the N-terminal primer containing 20 bp that are homologous

to an upstream region of the ldhA promoter, and the C-terminal

primer containing 20 bp homologous to a downstream region of

the ldhA terminator. The L-(+)-lactate dehydrogenase gene (ldhL)

ofPediococcus acidilactici was amplified by PCR using the integra-

tion primer pair and E. coliSZ85 chromosomal DNA as the template

(a strain containing integratedldhL) (Zhou et al., 2003). The ampli-

fied DNA fragment contained theldhLcoding region flanked by the

promoter and terminator of the E. coli ldhA gene. This hybrid DNA

fragment (promoterldhA-ldhL-terminatorldhA) was then transformed

into E. coli HBUT-D-DldhA (pKD46). The ldhL integrated mutant

was selected through regaining fermentative cell growth, and ver-

ified by PCR, resulting in strain HBUT-L.

2.3. Adaptive evolution

E. coli HBUT-L was streakedon NBS plates containing 2% sucrose

and incubated at 37 C overnight. Four colonies were inoculatedinto a 250-ml flask containing 200 ml NBS sucrose (2%) medium,

and incubated for 12 h (37 C, 150 rpm). This culture was inocu-

lated (inoculums: 50mgL1of cell dry weight) into a 500-ml fer-

mentation flask (FleakerTM, Corning) containing 350 ml NBS

medium with 10% sucrose. Fermentations were maintained at

37 C, 100 rpm, and pH7.0 by automatic addition of 6 N KOH. Upon

no further KOH addition (indication of no more acid production),

bacterial cells from the fermentation vessel were transferred to a

new vessel (50 mgL1of cell dry weight) with fresh medium

(NBS, 10% sucrose) to start another round of fermentation. This

process was sequentially repeated for four weeks to facilitate

selection of rapidly growing mutants in sucrose environments. In

the end, a single colony was isolated from the vessel and tested

for 100 g L

1 sucrose fermentation.

2.4. Quantitative real time PCR (RT-qPCR)

HBUT-L and WYZ-L cells were grown for 24 h in 50 ml screw-

capped tubes containing NBS with 10% sucrose. The cells were pel-

leted, and immediately frozen at 80 C. The frozen cell pellet was

lysed using two volumes of lysis solution (89 mM Tris pH 7.40,

89 mM LiCl, 45 mM EDTA, 0.85% sodium dodecyl sulfate, 21 mM

dithiothreitol). The lysate (0.47 mL) was transferred to a 1.5 mL

centrifuge tube, where it was dispersed with a sterile plastic pestle,

and extracted with 0.84 ml of a 1:1 mixture of acid phenol (pH

4.3)-chloroform on a labquake (Barnstead Thermolyne) for

10 min. After centrifugation (21,000g, 10 min), the pellet was

extracted twice with chloroform. The aqueous supernatant of the

three extractions was combined and precipitated by ethanol (Sam-

brook and Russell, 2001).

The ethanol precipitated nucleic acid was treated with DNase to

remove residual chromosomal DNA, and was used as a template to

synthesize cDNA with random decamer primers and M-MuLV re-

verse transcriptase using the manufacturers (Promega) protocol,

except the reaction was carried out at 42 C. Quantitative real-time

PCR was performed with 6 replicates (two biological replicates,

each with three technical replicates) in a Stratagene Mx3000P

instrument (Agilent Technologies) with SYBR green assays (Manow

et al., 2012). Data was collected at the end of the annealing step.

The cycle threshold (Ct) for each sample was generated by MxPro

RT-qPCR software (Stratagene). The E. coli 16 s ribosomal gene

(rrsA) was used as the normalizing gene.

2.5. Treatment of molasses and corn steep liquor

Sugarcane molasses (consisting of 48% total sugars; of those

sugars, 51.7% are sucrose, 30.6% are fructose and 17.7% are glucose)

was obtained from Liuzhou Sugar-refinery (Guangxi, PR China).

Corn steep liquor (CSL waste water containing 1% nitrogen) and

starch-based molasses (composed of glucose), the waste productsof corn-based glucose processing plants, were provided by Weifang

Shengtai Pharmaceutical, LTD (Shangdong, PR China). Sugarcane

molasses, starch-based molasses and corn steep liquor were stored

at 4 C upon being received. Without pretreatment, the molasses

and corn steep liquor were diluted with diH2O, sterilized by mem-

brane filter (0.45 lm) and autoclave (121 C, 15 min), respectively,

and then combined to achieve the required sugar concentration for

fermentation.

2.6. Fermentations

Seed cultures were prepared by inoculating 6 fresh colonies

from NBS-sucrose plates into 2-liter flasks containing 500 ml of

NBS medium with a 2% sucrose or molasses (equivalent to 2% totalsugars), and incubated at 37 C, 150 rpm, for 12-15 h to achieve an

OD600 nmof1.6 (dry cell weight 1.2 g L1). These 500 ml bacterial

cultures were inoculated (10%, v/v) into a 7-L fermentor (BIOSTAT

B plus, German) containing 5 L NBS medium with 100 g L1 sugar

and 1 mM betaine, or a 5 L mixture of molasses (sugar equivalent

of 100-120 g L1) and corn steep liquor without additional nutrient

supplements. The fermentation was carried out at 37 C, 200 rpm,

and pH 7.0 by automatic addition of 6 N KOH. 5 ml samples were

taken periodically for analysis of cell growth, sugar consumption

and lactic acid production. Fermentations were repeated three

times.

2.7. Analyses

Cell growth was estimated by OD600 nmusing a spectrophotom-

eter (UNICO 2802 PC). One optical density unit (OD600 nm) ofE. coli

HBUT-D and its derivative cells was equivalent to 0.75 g L1 dry

cell weight. Fermentation samples were taken and centrifuged

(4 C, 10,000 rpm, 5 min). The supernatant was filtered using a

0.45 lm membrane, and was used for analysis of sugars, organic

acids, and optical purity ofL-lactic acid. The concentrations of sug-

ars and organic acids were analyzed by high performance liquid

chromatography (Agilent 1200) equipped with a refractive index

detector and an UV detector using a Bio-rad HPX 87H column with

4 mM H2SO4 as the mobile phase (injection volume 10ll,

0.4 ml min1 mobile phase, 45 C column temperature). Optical

isomers of D() and L(+)-lactic acids were analyzed by HPLC using

a chiral column (SUMITOMO OA-5000, Japan).

396 Y. Wang et al. / Bioresource Technology 148 (2013) 394400

8/21/2019 1-s2.0-S0960852413013655-main

4/7

2.8. Sucrose hydrolyase (invertase) activity assay

HBUT-L and WYZ-L cells were grown in screw-cap tubes con-

taining 50 ml NBS medium with 2% sucrose (37 C, 200 rpm,

16 h). The cells were pelleted by centrifugation (4 C, 5000 rpm,

10 min), washed and resuspended into 20 ml phosphate buffer

(0.1 M, pH 6.5), then sonicated (3 s, cooled on ice for 10 s, repeated

for 10 times) by a JY92-II sonicator (Scientz Biotechnology CO. LTD,

Ningbo, PR China). The crude enzyme was obtained after removing

the cell debris by centrifugation (4 C, 5000 rpm, 10 min). The

invertase was assayed using the method described bySabri et al

(2013). The invertase activity (U) was expressed as volumetric

enzymatic activity (nanomole of glucose released per min per ml

of growing cells) and specific enzymatic activity (nanomole of glu-

cose released per min per milligram of protein).

3. Results and discussion

3.1. Replacing D-lactate dehydrogenase (ldhA) with L-lactate

dehydrogenase (ldhL)

E. coliHBUT-D (DfrdBC,DadhE,Dpta,DpflB,DcscR,DaldA),a bio-catalyst previously engineered fromE. coli W (ATCC 9637) (Wang

et al., 2012), was able to ferment sucrose into D-lactic acid with

an 85% of the theoretical yield (1.05 g lactic acid g1 sucrose, or 1

sucrose => 4 D-lactic acid). HBUT-D was used to engineer a deriva-

tive for L-lactic acid fermentation using sucrose-rich molasses. To-

ward this goal, the D-lactic acid pathway was eliminated by

deleting the endogenous D-lactate dehydrogenase gene (ldhA).

The resulting strain, designated HBUT-D-DldhA, was able to grow

aerobically but failed to grow fermentatively, due to the loss of

the NADH oxidation route through D-lactate dehydrogenase.

To regain fermentative growth and lactic acid production, an

L(+)-lactate dehydrogenase gene (ldhL) of Pediococcus acidilactici

was amplified and integrated into E. coli HBUT-D-DldhA, resulting

in strain E. coliHBUT-L (DldhA::ldhL). The integrated DNA fragmentcontained the ldhLcoding sequence (AT......TAA) flanked by the pro-

moter and terminator of the E. coli ldhA gene (Zhou et al., 2003).

The expression and regulation ofldhL in HBUT-L would presumably

be similar, if not exactly the same, as those of ldhA in HBUT-D,

without an expected impact on the expression of other gene(s).

Consequently, HBUT-L should be as effective as HBUT-D in fer-

menting glucose and/or sucrose into lactic acid, provided that both

L(+)-lactate dehydrogenase and D()-lactate dehydrogenase have a

similar affinity to pyruvate.

3.2. L(+)-lactic acid fermentation by E. coli HBUT-L

100 g L1 of glucose was initially used to evaluate E. coliHBUT-L

for L(+)-lactic acid fermentation in NBS medium. As shown inFig. 1A and Table 2, the fermentation was completed in 48 h,

achieving a lactic acid titer of 97 g L1, a yield of 96%, and a

maximum volumetric productivity of 3.44 g L1 h1. These

achieved titer and yield were comparable to those obtained by

HBUT-D for D-lactic acid fermentation under the same conditions

(Wang et al., 2012). However, the average volumetric productivity

( 2 g L 1 h1) was twice that of HBUT-D (1 g L1 h1). These results

demonstrated that HBUT-L was as efficient, if not better, than the

HBUT-D strain for glucose fermentation, suggesting that ldhL

successfully replaced the ldhA gene without a negative impact on

glucose-to-lactic acid fermentation.

The HBUT-L strain was then evaluated for 100 g L1 sucrose fer-

mentation in mineral salts medium (NBS). Results are shown in

Fig. 1B and Table 2. The sucrose fermentation was complete in96 h, twice as long as that of glucose fermentations. The achieved

lactic acid titer (60 g L1), yield (74%), and maximum volumetric

productivity (1 g L1) were 62%, 22%, and 250% lower than those

of 100 g L1 of glucose fermentation, respectively. The lower titer

and yield were attributed mostly to the incomplete utilization of

fructose, resulting in accumulation of fructose up to 2 5 g L 1 in

the medium (Fig. 1B). Nevertheless, not taking the unutilized fruc-tose into account, the product yield based on sugar metabolized

was comparable to that of glucose fermentations.

Although fructose accumulation (

8/21/2019 1-s2.0-S0960852413013655-main

5/7

acid through glycolysis and lactate dehydrogenase. The accumula-

tion of fructose during fermentation implies that the expression of

the fructokinase gene (cscK), if not all of the sucrose genes, needsimprovement for efficient fermentation of 100 g L1 of sucrose by

HBUT-L.

3.3. Adaptive evolution of HBUT-L for enhanced sucrose fermentation

Instead of enhancing the expression of the cscKgene individu-

ally, a traditional adaptive evolution approach was used to select

random mutations for enhanced sucrose fermentation. As shown

in Fig. 2A and B, in the initial round of adaptive evolution cell

growth was slow with a doubling time of 24h, and a max

OD600 of 2.1 achieved at 96 h. Although the lactic acid titer

reached 41 g L1 after 168 h, little, if any, lactic acid was produced

for the first 48 h. This result verified the inefficient sucrose fermen-

tation by HBUT-L in a down-sized fermentation vessel. In the fol-lowing three rounds of adaptive evolution, however, cell growth

(cell mass) was improved significantly, with an increase of 74%,

18%, and 46%, respectively. Lactic acid production was also en-

hanced with an increase of 19%, 7%, and 45%, respectively, in each

round. These results indicated that certain mutation(s) presumably

occurred during adaptive evolution, which resulted in improved

sucrose utilization, cell growth and lactic acid production from

sucrose.

At the end of the 4th round of adaptive evolution, single colo-

nies were isolated from the fermentation broth. Five of these colo-

nies, together with the HBUT-L parent, were compared in screw-

cap tubes for anaerobic cell growth and lactic acid production from

sucrose. As expected, the cell growth and lactic acid production of

those adaptive colonies were enhanced compared to those ofHBUT-L (data not shown). However, there was no significant differ-

ence between the five colonies. One of the colonies was selected for

further evaluation and designated E. coliWYZ-L.

3.4. Enhanced sucrose fermentation by WYZ-L

The adaptively evolved strain, E. coli WYZ-L, was evaluated for

L(+)-lactic acid production using 7 L fermentors containing 5 L

NBS medium with 100 g L1 sucrose. As shown inFig. 1C andTa-

ble 2, WYZ-L completed the fermentation in 48 h, achieved a titer

o f 9 7 g L 1, a yield of 90%, and a maximum volumetric productivity

of 2.51g L1 h1. The time needed to complete fermentation was

significantly shorter, while product titer, yield and volumetric pro-

ductivity were higher than those obtained by the HBUT-L strain(Table 2). The decreased fermentation time and increased volumet-

ric productivity was attributed to the improved cell growth ofWYZ-L, which had faster growth rate and remained in log growth

phase longer, and resulted in higher cell density (OD600 5.82 vs

2.85), compared to that of HBUT-L. The improvement of product ti-

ter and yield was likely derived from the improved fructose utiliza-

tion. As shown in Fig. 1C, although there was 1 5 g L 1fructose

accumulation after 24 h, this fructose, however, was reutilized

by WYZ-L thereafter, resulting in less than 3 g L1 of fructose

remaining in the fermentation broth.

To determine if the improved sucrose fermentation was derived

from the improved expression of the sucrose utilization genes, par-

ticularly the fructokinase gene (cscK), quantitative real time PCR

(RT-qPCR) was used to compare the relative expressions of sucrose

genes in HBUT-L and WYZ-L. As expected, the expressions ofcscA

(sucrose hydrolase or invertase),cscB(sucrose permease), andcscK(fructokinase) were enhanced by 13, 31 and 20-fold, respectively,

Table 2

Summary ofL-lactic acid production from glucose, sucrose and molasses.

E. coli Substratea

(100g L1)

Mediumb Growth

(dry cell weight)

(g L1)

L-lactic acid producedc Vol. productivityd

(g L1 h1)

Spec.

productivity

(g g1 h1)

By-product (acetate)

(g L1)

Titer

(g L1)

Yield

(%)

Optical purity (%) Max Average Max Average

HBUT-L Glucose NBS 3.60 97 96 99.5 3.44 2.04 0.96 0.57 0.2

HBUT-L Sucrose NBS 2.85 60 74 99.3 0.98 0.77 0.34 0.27 0.6

WYZ-L Sucrose NBS 5.82 97 90 99.6 3.17 1.83 0.54 0.31 4.2

WYZ-L Starch molasses CSL n/a 84 97 99.2 2.51 1.00 n/a n/a 2.1

WYZ-L Sugarcane molasses CSL n/a 75 85 99.5 1.18 0.48 n/a n/a 2.8

a The starchmolasses, mainly composed of glucose, was added to make 100 g L1 of glucose equivalent. The sugarcane molasses substrate was added to make 120 g L1

total sugar.b NBS is a mineral salt medium; CSL is the corn steep liquor containing 1% organic nitrogen, a waste product of a corn based glucose plant.c The lactic acid yield was calculated based on sugar metabolized (theoretically, one glucose or fructose molecules produces two lactic acids, and one sucrose molecule

produces four lactic acids).d The maximum volumetric and specific productivities were calculated based on the most productive 24 h. The average volumetric and specific productivities were

calculated from the start to the maximum lactate titer achieved during fermentation.

0 5 10 15 20 250

2

4

6

8

A

Time (day)

Cellgrowth(OD600)

0 5 10 15 20 250

10

20

30

40

5060

70

80

B

Time (days)

Lacticacid(g/L

)

Fig. 2. Adaptive evolution ofE. coli HBUT-L for efficient sucrose fermentation. (A)

Cell growth; (B) Lactic acid produced.


8/21/2019 1-s2.0-S0960852413013655-main

6/7

in the evolved strain WYZ-L, compared to those in the parent

HBUT-L strain. Considering the structure of the csc operon in

E. coli W: a bi-directional promoter drives expression of the two

transcription units;cscAandcscKare in the same operon, and cscBis transcribed separately (Sabri et al. 2013). This might explain why

cscA and cscKhave similar transcript levels, while cscB transcript

level is higher.

To verify the enhanced csc expression resulted in increased

activities of the corresponding enzymes, sucrose hydrolyase

(invertase) was selected as an example for enzymatic activity as-

say. The results showed that the evolved strain WYZ-L had a 228

U volumetric and 1753 U specific invertase activity, which are

2.3 fold and 1.7 fold higher than those of the parent HBUT-L (99

U volumetric and 1013 U specific activity), respectively, Therefore,

we speculated that the improved transcription of the csc catabolic

genes most likely results in increased translation and increased en-

zyme activity. This might allow enhanced transport of sucrose into

the cell (cscBactivity) followed by improved sucrose cleavage (cscAactivity) and in particular, improved fructose phosphorylation

(cscK activity). The latter activity might substantially improve fruc-

tose utilisation, a supposition supported by the decrease in fruc-

tose accumulation observed during fermentation (Fig. 2C). Both

glucose-1-P and fructose-6-P could then be metabolized into lactic

acid through glycolysis and lactate dehydrogenase, supporting the

observation of increased lactate production.

3.5. Fermentation of molasses

E. coli WYZ-L was evaluated for L(+)-lactic acid fermentation

from the combined wastes of starch-based molasses (equivalent

to 100 g L1 glucose) and corn steep liquor without supplementa-

tion of additional nutrients. The results in Fig. 3A and Table 2showed that the fermentation ceased at 75 h with 80% sugar

fermented, achieving a product titer of 84 g L1 and a yield of

97%. These titer and yield were comparable to those achieved in

glucose fermentation in NBS mineral salts medium. However, the

maximum and average volumetric productivities were 37% and

100% lower than those obtained in glucose fermentation in NBS

medium. This lower productivity was likely due to the inhibitors

present in molasses that slow down cell growth (not measured

by OD600

due to dark color of the molasses). The incomplete sugar

utilization during fermentation might be attributed to the unfer-

mentable short oligomers present in starch-based molasses.

Without additional nutrient supplementations, the combined

waste of sucrose-rich sugarcane molasses and corn steep liquor

was further evaluated for L(+)-lactic acid production by WYZ-L.

The results were shown inFig. 3B andTable 2. In 150 h fermenta-

tion, 7 5 g L 1 L(+)-lactic acid was produced with a yield of 85%

and a maximum volumetric productivity of 1.18 g L1 h1. This

volumetric productivity was about one third of that obtained in su-

crose fermentation in NBS mineral salts medium (3.17 g L1 h1).

Again, we speculated that the inhibitors might be present in the

molasses and could result in less cell growth and low productivity.

In addition, 1 0 g L 1 fructose accumulated after 150 h fermenta-

tion, which contributed to the lower yield of sugarcane molasses

fermentation. The inhibited growth on molasses medium indicates

that improved growth characteristics would be preferred for

molasses fermentation to lactate. This might be achieved by fur-

ther adaptive evolution experiments using molasses rather than

pure sucrose in order to improve tolerance to molasses toxicity.

4. Conclusion

The E. coli W derivative, HBUT-D, was engineered for L-lactic

acid production from sucrose through gene replacement and adap-

tive evolution. The resulting strain WYZ-L has the potential for

cost-effective production of L(+)-lactic acid from 100 g L1 of su-

crose using mineral salts medium; achieving a titer of 97 g L1

L(+)-lactic acid, a productivity of 1.83-3.17 g L1

h1

, a yield of90%, and an optical purity >99%. Furthermore, WYZ-L can be used

for the production of optically pure L(+)-lactic acid using molasses

and corn steep liquor without additional nutrient supplements, a

great approach to converting organic wastes into green chemicals.

Acknowledgements

This research was supported by the Natural Science Foundation

of Hubei Province (Grant No. 2011CDB076), Hubei University of

Technology and the Chutian Scholar Program of Hubei Province,

P.R. China; and Northern Illinois University, USA.

References

Aniguchi, M.T., Oshina, M.H., Anabe, S.T., Iguchi, Y.H., Akai, K.S., 2005. Production of

L-lactic acid by simultaneous saccharification and fermentation using

unsterilized defatted rice bran as a carbon source and nutrient components.

Food Sci. Technol. Res. 11, 400406.

Causey, T., Zhou, S., Shanmugam, K., Ingram, L., 2003. Engineering the metabolism of

Escherichia coli W3110 for the conversion of sugar to redox-neutral andoxidized products: homoacetate production. Proc. Natl. Acad. Sci. USA 100 (3),

825832.

Chang, D.E., Shin, S., Rhee, J.S., Pan, J.G., 1999. Homofermentative production of D-

or L-lactate in metabolically engineered Escherichia coli RR1. Appl. Environ.Microbiol. 65, 13841389.

Datsenko, K.A., Wanner, B.L., 2000. One-step inactivation of chromosomal genes in

Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97 (12),66406645.

Datta, R., Henry, M., 2006. Lactic acid: recent advances in products, processes and

technologies a review. J. Chem. Technol. Biotechnol. 81 (7), 11191129.

Dien, B.S., Nichols, N.N., Bothast, R.J., 2001. RecombinantEscherichia coliengineered

for production of L-lactic acid fromhexose and pentose sugars. J. Ind. Microbiol.Biotechnol. 27, 259264.

0 24 48 72 96 120 1440

20

40

60

80

100 A

Time (h)

GlucoseandLacticacid(g/L)

0 24 48 72 96 120 1440

10

20

30

40

50

60

70

80

B

Time (h)

Sugar

andLacticacid(g/L)

Fig. 3. Fermentations of combined wastes of molasses and corn steep liquor

without additional nutrients by WYZ-L. (A) Starch-based molasses (mainly

glucose); (B) Sugarcane molasses (mainly sucrose). Symbols: unfilled triangle,

glucose; filled circle, lactic acid; star, acetic acid by-product; unfilled square,

sucrose; filled triangle, fructose.

Y. Wang et al. / Bioresource Technology 148 (2013) 394400 399
http://refhub.elsevier.com/S0960-8524(13)01365-5/h0005http://refhub.elsevier.com/S0960-8524(13)01365-5/h0005http://refhub.elsevier.com/S0960-8524(13)01365-5/h0005http://refhub.elsevier.com/S0960-8524(13)01365-5/h0005http://refhub.elsevier.com/S0960-8524(13)01365-5/h0010http://refhub.elsevier.com/S0960-8524(13)01365-5/h0010http://refhub.elsevier.com/S0960-8524(13)01365-5/h0010http://refhub.elsevier.com/S0960-8524(13)01365-5/h0010http://refhub.elsevier.com/S0960-8524(13)01365-5/h0010http://refhub.elsevier.com/S0960-8524(13)01365-5/h0010http://refhub.elsevier.com/S0960-8524(13)01365-5/h0015http://refhub.elsevier.com/S0960-8524(13)01365-5/h0015http://refhub.elsevier.com/S0960-8524(13)01365-5/h0015http://refhub.elsevier.com/S0960-8524(13)01365-5/h0015http://refhub.elsevier.com/S0960-8524(13)01365-5/h0015http://refhub.elsevier.com/S0960-8524(13)01365-5/h0020http://refhub.elsevier.com/S0960-8524(13)01365-5/h0020http://refhub.elsevier.com/S0960-8524(13)01365-5/h0020http://refhub.elsevier.com/S0960-8524(13)01365-5/h0020http://refhub.elsevier.com/S0960-8524(13)01365-5/h0025http://refhub.elsevier.com/S0960-8524(13)01365-5/h0025http://refhub.elsevier.com/S0960-8524(13)01365-5/h0025http://refhub.elsevier.com/S0960-8524(13)01365-5/h0030http://refhub.elsevier.com/S0960-8524(13)01365-5/h0030http://refhub.elsevier.com/S0960-8524(13)01365-5/h0030http://refhub.elsevier.com/S0960-8524(13)01365-5/h0030http://refhub.elsevier.com/S0960-8524(13)01365-5/h0030http://-/?-http://refhub.elsevier.com/S0960-8524(13)01365-5/h0030http://refhub.elsevier.com/S0960-8524(13)01365-5/h0030http://refhub.elsevier.com/S0960-8524(13)01365-5/h0030http://refhub.elsevier.com/S0960-8524(13)01365-5/h0025http://refhub.elsevier.com/S0960-8524(13)01365-5/h0025http://refhub.elsevier.com/S0960-8524(13)01365-5/h0020http://refhub.elsevier.com/S0960-8524(13)01365-5/h0020http://refhub.elsevier.com/S0960-8524(13)01365-5/h0020http://refhub.elsevier.com/S0960-8524(13)01365-5/h0015http://refhub.elsevier.com/S0960-8524(13)01365-5/h0015http://refhub.elsevier.com/S0960-8524(13)01365-5/h0015http://refhub.elsevier.com/S0960-8524(13)01365-5/h0010http://refhub.elsevier.com/S0960-8524(13)01365-5/h0010http://refhub.elsevier.com/S0960-8524(13)01365-5/h0010http://refhub.elsevier.com/S0960-8524(13)01365-5/h0010http://refhub.elsevier.com/S0960-8524(13)01365-5/h0005http://refhub.elsevier.com/S0960-8524(13)01365-5/h0005http://refhub.elsevier.com/S0960-8524(13)01365-5/h0005http://refhub.elsevier.com/S0960-8524(13)01365-5/h0005http://-/?-

8/21/2019 1-s2.0-S0960852413013655-main

7/7

Garlotta, D., 2001. A literature review of poly(lactic acid). J. Polymers Environ. 9 (2),

6384.

Hofvendahl, K., Hahn-Hagerdal, 2000. Factors affecting the fermentative lactic acid

production from renewable resources. Enzyme Microb. Technol. 26, 87107.

Ilmn, M., Koivuranta, K., Ruohonen, L., Suominen, P., Penttil, M., 2007. Efficient

production of l-lactic acid from xyloseby Pichia stipitis. Appl. Environ. Microbiol.73, 117123.

Jahreis, K., Bentler, L., Bockmann, J., Hans, S., Meyer, A., Siepelmeyer, J., Lengeler,

J.W., 2002. Adaption of sucrose metabolism in the Escherichia coli wild-typestrain EC3132. J. Bacteriol. 184 (19), 53075316.

Karp, S.G., Igashiyama, A.H., Siqueira, P.F., Carvalho, J.C., Vandenberghe, L.P.S.,Thomaz-Soccol, V., Coral, J., Tholozan, J.L., Pandey, A., Soccol, C.R., 2011.

Application of the biorefinery concept to produce l-lactic acid from the soybean

vinasse at laboratory and pilot scale. Bioresour. Technol. 102, 17651772.

Kotoyoshi, N., So, S., Shunsuke, Y., 2010. L-lactic acid production from canned

pineapplesyrup by rapidsucrose catabolizing Lactobacillus paracaseiNRIC 0765.Food Sci. Technol. Res. 16, 239246.

Kwak, S., Park, Y.C., Seo, J.H., 2013. Biosynthesis of 3-hydroxypropionic acid from

glycerol in recombinantEscherichia coliexpressingLactobacillus brevis dhaB anddhaRgene clusters and E. coliK-12 aldH. Bioresource Technol. 135 (5), 432439.

Lee, J., Lee, S.Y., Park, S., 1997. Fed-batch culture ofEscherichia coliW by exponentialfeeding of sucrose as a carbon source. Biotechnol. Techniques. 11 (1), 5962.

Manow, R., Wang, J., Wang, Y., Zhao, J., Garza, E., Iverson, A., Finan, C., Grayburn, S.,

Zhou, S., 2012. Partial deletion of rng (RNase G)-enhanced homoethanolfermentation of xylose by the non-transgenic Escherichia coli RM10. J. Ind.Microbiol. Biotechnol. 39 (7), 977985.

Mazumdar, S., Clomburg, J.M., Gonzalez, R., 2010. Escherichia colistrains engineeredfor homofermentative production of d-lactic acid from glycerol. Appl. Environ.

Microbiol. 76 (13), 43274336.

Miller, J.H., 1992. A Short Course In Bacterial Genetics: A Laboratory Manual And

Handbook For Escherichia coli And Related Bacteria. Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY.

Nakasaki, K., Adachi, T., 2003. Effects of intermittent addition of cellulase for

production of l-lactic acid from wastewater sludge by simultaneous

saccharification and fermentation. Biotechnol. Bioeng. 82, 263270.

Naveena, B., Altaf, M., Bhadrayya, K., Reddy, G., 2004. Production of L(+)- lactic acid

byLactobacillus amylophilus GV6 in semi-solid state fermentation using wheatbran. Food Technol. Biotechnol. 42, 147152.

Patel, M., Ou, M., Ingram, L.O., Shanmugam, K.T., 2004. Fermentation of sugar cane

bagasse hemicellulose hydrolysate to L(+)-lactic acid by a thermotolerant

acidophilicBacillus sp. Biotechnol. Lett. 26, 865868.Phrueksawan, P., Kulpreecha, S., Sooksai, S., Thongchul, N., 2012. Direct

fermentation of L(+)-lactic acid from cassava pulp by solid state culture of

Rhizopus oryzae. Bioprocess Biosystems Eng. 35, 14291436.Posfai, G., Koob, M.D., Kirkpatrick, H.A., Blattner, F.C., 1999. Versatile insertion

plasmids for targeted genome manipulations in bacteria: isolation, deletion,

and rescue of the pathogenicity island LEE of the Escherichia coli O157:H7genome. J. Bacteriol. 179, 44264428.

Roble, N.D., Ogbonna, J.C., Tanaka, H., 2003. L-lactic acid production from raw

cassava starch in a circulating loop bioreactor with cells immobilized in loofa

(Luffa cylindrica). Biotechnol. Lett. 25, 10931098.Sabri, S., Nielsen, L.K., Vickers, C.E., 2013. Molecular control of sucrose utilization in

Escherichia coliW, an efficient sucrose-utilizing strain. Appl. Environ. Microbiol.79 (2), 478487.

Sahin-Toth, M., Lengyel, Z., Tsunekawa, H., 1999. Cloning, sequencing, and

expression of cscA invertase from Escherichia coli B-62. Can. J. Microbiol. 45,

418422.Sakai, K., Ezaki, Y., 2006. Open l-lactic acid fermentation of food refuse using

thermophilic Bacillus coagulans and fluorescence in situ hybridization analysisof microflora. J. Biosci. Bioeng. 101, 457463.

Sambrook, J., Russell, D.W., 2001. Molecular Cloning: a Laboratory Manual. Cold

Spring Harbor Laboratory, Cold Spring Harbor, NY.

Sangproo, M., Polyiam, P., Jantama, S.S., Kanchanatawee, S., Jantama, K., 2012.

Metabolic engineering ofKlebsiella oxytoca M5a1 to produce optically pure d-lactate in mineral salts medium. Bioresource Technol. 119 (9), 191198.

Shi, Z., Wei, P., Zhu, X., Cai, J., Huang, L., Xu, Z., 2012. Efficient production of l-lactic

acid from hydrolysate of Jerusalem artichoke with immobilized cells ofLactococcus lactis in fibrous bed bioreactors. Enzyme Microb. Technol. 51,263268.

Shinkawa, S.,Okano, K.,Yoshida,S., Tanaka, T.,Ogino, C.,Fukuda,H., Kondo, A.,2011.

Improved homo l-lactic acid fermentation from xylose by abolishment of the

phosphoketolase pathway and enhancement of the pentose phosphate pathway

in genetically modified xylose-assimilating Lactococcus lactis. Appl. Microbiol.Biotechnol. 91, 15371544.

Shukla, V., Zhou, S., Yomano, L.P., Shanmugam, K.T., Preston, J.F., Ingram, L.O., 2004.

Production ofD()-lactic acid from sucrose and molasses. Biotechnol. Lett. 26,

689693.

Utrilla, J., Licona-Cassani, C., Marcellin, E., Gosset, G., Nielsen, L.K., Martinez, A.,

2012. Engineering and adaptive evolution of Escherichia coli for D-lactatefermentation revealsGatCas a xylose transporter. Metab. Eng. 14 (5), 469476.

Wang, Y., Tian, T., Zhao, J., Wang, J., Yan, T., Xu, L., Liu, Z., Garza, E., Iverson, A.,

Manow, R., Finan, C., Zhou, S., 2012. Homofermentative production of D-lactic

acid from sucrose by a metabolically engineered Escherichia coli. Biotechnol.Lett. 34 (11), 20692075.

Zhou, S., Causey, T.B., Hasona, A., Shanmugam, K.T., Ingram, L.O., 2003. Production of

optically pure d-lactic acid in mineral salts medium by metabolically

engineeredEscherichia coli W3110. Appl. Environ. Microbiol. 69 (1), 399407.Zhu, Y., Eiteman, M.A., DeWitt, K., Altman, E., 2007. Homolactate fermentation by

metabolically engineered Escherichia coli strains. Appl. Environ. Microbiol. 73(2), 453464.

http://refhub.elsevier.com/S0960-8524(13)01365-5/h0035http://refhub.elsevier.com/S0960-8524(13)01365-5/h0035http://refhub.elsevier.com/S0960-8524(13)01365-5/h0040http://refhub.elsevier.com/S0960-8524(13)01365-5/h0040http://refhub.elsevier.com/S0960-8524(13)01365-5/h0045http://refhub.elsevier.com/S0960-8524(13)01365-5/h0045http://refhub.elsevier.com/S0960-8524(13)01365-5/h0045http://refhub.elsevier.com/S0960-8524(13)01365-5/h0045http://refhub.elsevier.com/S0960-8524(13)01365-5/h0045http://refhub.elsevier.com/S0960-8524(13)01365-5/h0050http://refhub.elsevier.com/S0960-8524(13)01365-5/h0050http://refhub.elsevier.com/S0960-8524(13)01365-5/h0050http://refhub.elsevier.com/S0960-8524(13)01365-5/h0050http://refhub.elsevier.com/S0960-8524(13)01365-5/h0050http://refhub.elsevier.com/S0960-8524(13)01365-5/h0055http://refhub.elsevier.com/S0960-8524(13)01365-5/h0055http://refhub.elsevier.com/S0960-8524(13)01365-5/h0055http://refhub.elsevier.com/S0960-8524(13)01365-5/h0055http://refhub.elsevier.com/S0960-8524(13)01365-5/h0060http://refhub.elsevier.com/S0960-8524(13)01365-5/h0060http://refhub.elsevier.com/S0960-8524(13)01365-5/h0060http://refhub.elsevier.com/S0960-8524(13)01365-5/h0060http://refhub.elsevier.com/S0960-8524(13)01365-5/h0060http://refhub.elsevier.com/S0960-8524(13)01365-5/h0060http://refhub.elsevier.com/S0960-8524(13)01365-5/h0065http://refhub.elsevier.com/S0960-8524(13)01365-5/h0065http://refhub.elsevier.com/S0960-8524(13)01365-5/h0065http://refhub.elsevier.com/S0960-8524(13)01365-5/h0065http://refhub.elsevier.com/S0960-8524(13)01365-5/h0065http://refhub.elsevier.com/S0960-8524(13)01365-5/h0065http://refhub.elsevier.com/S0960-8524(13)01365-5/h0065http://refhub.elsevier.com/S0960-8524(13)01365-5/h0065http://refhub.elsevier.com/S0960-8524(13)01365-5/h0065http://refhub.elsevier.com/S0960-8524(13)01365-5/h0065http://refhub.elsevier.com/S0960-8524(13)01365-5/h0065http://refhub.elsevier.com/S0960-8524(13)01365-5/h0065http://refhub.elsevier.com/S0960-8524(13)01365-5/h0065http://refhub.elsevier.com/S0960-8524(13)01365-5/h0070http://refhub.elsevier.com/S0960-8524(13)01365-5/h0070http://refhub.elsevier.com/S0960-8524(13)01365-5/h0070http://refhub.elsevier.com/S0960-8524(13)01365-5/h0070http://refhub.elsevier.com/S0960-8524(13)01365-5/h0070http://refhub.elsevier.com/S0960-8524(13)01365-5/h0075http://refhub.elsevier.com/S0960-8524(13)01365-5/h0075http://refhub.elsevier.com/S0960-8524(13)01365-5/h0075http://refhub.elsevier.com/S0960-8524(13)01365-5/h0075http://refhub.elsevier.com/S0960-8524(13)01365-5/h0075http://refhub.elsevier.com/S0960-8524(13)01365-5/h0075http://refhub.elsevier.com/S0960-8524(13)01365-5/h0075http://refhub.elsevier.com/S0960-8524(13)01365-5/h0075http://refhub.elsevier.com/S0960-8524(13)01365-5/h0075http://refhub.elsevier.com/S0960-8524(13)01365-5/h0080http://refhub.elsevier.com/S0960-8524(13)01365-5/h0080http://refhub.elsevier.com/S0960-8524(13)01365-5/h0080http://refhub.elsevier.com/S0960-8524(13)01365-5/h0080http://refhub.elsevier.com/S0960-8524(13)01365-5/h0080http://refhub.elsevier.com/S0960-8524(13)01365-5/h0085http://refhub.elsevier.com/S0960-8524(13)01365-5/h0085http://refhub.elsevier.com/S0960-8524(13)01365-5/h0085http://refhub.elsevier.com/S0960-8524(13)01365-5/h0085http://refhub.elsevier.com/S0960-8524(13)01365-5/h0085http://refhub.elsevier.com/S0960-8524(13)01365-5/h0090http://refhub.elsevier.com/S0960-8524(13)01365-5/h0090http://refhub.elsevier.com/S0960-8524(13)01365-5/h0090http://refhub.elsevier.com/S0960-8524(13)01365-5/h0095http://refhub.elsevier.com/S0960-8524(13)01365-5/h0095http://refhub.elsevier.com/S0960-8524(13)01365-5/h0095http://refhub.elsevier.com/S0960-8524(13)01365-5/h0095http://refhub.elsevier.com/S0960-8524(13)01365-5/h0095http://refhub.elsevier.com/S0960-8524(13)01365-5/h0095http://refhub.elsevier.com/S0960-8524(13)01365-5/h0095http://refhub.elsevier.com/S0960-8524(13)01365-5/h0095http://refhub.elsevier.com/S0960-8524(13)01365-5/h0100http://refhub.elsevier.com/S0960-8524(13)01365-5/h0100http://refhub.elsevier.com/S0960-8524(13)01365-5/h0100http://refhub.elsevier.com/S0960-8524(13)01365-5/h0100http://refhub.elsevier.com/S0960-8524(13)01365-5/h0100http://refhub.elsevier.com/S0960-8524(13)01365-5/h0105http://refhub.elsevier.com/S0960-8524(13)01365-5/h0105http://refhub.elsevier.com/S0960-8524(13)01365-5/h0105http://refhub.elsevier.com/S0960-8524(13)01365-5/h0105http://refhub.elsevier.com/S0960-8524(13)01365-5/h0105http://refhub.elsevier.com/S0960-8524(13)01365-5/h0110http://refhub.elsevier.com/S0960-8524(13)01365-5/h0110http://refhub.elsevier.com/S0960-8524(13)01365-5/h0110http://refhub.elsevier.com/S0960-8524(13)01365-5/h0110http://refhub.elsevier.com/S0960-8524(13)01365-5/h0110http://refhub.elsevier.com/S0960-8524(13)01365-5/h0110http://refhub.elsevier.com/S0960-8524(13)01365-5/h0115http://refhub.elsevier.com/S0960-8524(13)01365-5/h0115http://refhub.elsevier.com/S0960-8524(13)01365-5/h0115http://refhub.elsevier.com/S0960-8524(13)01365-5/h0115http://refhub.elsevier.com/S0960-8524(13)01365-5/h0115http://refhub.elsevier.com/S0960-8524(13)01365-5/h0120http://refhub.elsevier.com/S0960-8524(13)01365-5/h0120http://refhub.elsevier.com/S0960-8524(13)01365-5/h0120http://refhub.elsevier.com/S0960-8524(13)01365-5/h0120http://refhub.elsevier.com/S0960-8524(13)01365-5/h0125http://refhub.elsevier.com/S0960-8524(13)01365-5/h0125http://refhub.elsevier.com/S0960-8524(13)01365-5/h0125http://refhub.elsevier.com/S0960-8524(13)01365-5/h0125http://refhub.elsevier.com/S0960-8524(13)01365-5/h0125http://refhub.elsevier.com/S0960-8524(13)01365-5/h0125http://refhub.elsevier.com/S0960-8524(13)01365-5/h0125http://refhub.elsevier.com/S0960-8524(13)01365-5/h0130http://refhub.elsevier.com/S0960-8524(13)01365-5/h0130http://refhub.elsevier.com/S0960-8524(13)01365-5/h0130http://refhub.elsevier.com/S0960-8524(13)01365-5/h0130http://refhub.elsevier.com/S0960-8524(13)01365-5/h0130http://refhub.elsevier.com/S0960-8524(13)01365-5/h0135http://refhub.elsevier.com/S0960-8524(13)01365-5/h0135http://refhub.elsevier.com/S0960-8524(13)01365-5/h0140http://refhub.elsevier.com/S0960-8524(13)01365-5/h0140http://refhub.elsevier.com/S0960-8524(13)01365-5/h0140http://refhub.elsevier.com/S0960-8524(13)01365-5/h0140http://refhub.elsevier.com/S0960-8524(13)01365-5/h0140http://refhub.elsevier.com/S0960-8524(13)01365-5/h0140http://refhub.elsevier.com/S0960-8524(13)01365-5/h0145http://refhub.elsevier.com/S0960-8524(13)01365-5/h0145http://refhub.elsevier.com/S0960-8524(13)01365-5/h0145http://refhub.elsevier.com/S0960-8524(13)01365-5/h0145http://refhub.elsevier.com/S0960-8524(13)01365-5/h0145http://refhub.elsevier.com/S0960-8524(13)01365-5/h0145http://refhub.elsevier.com/S0960-8524(13)01365-5/h0145http://refhub.elsevier.com/S0960-8524(13)01365-5/h0150http://refhub.elsevier.com/S0960-8524(13)01365-5/h0150http://refhub.elsevier.com/S0960-8524(13)01365-5/h0150http://refhub.elsevier.com/S0960-8524(13)01365-5/h0150http://refhub.elsevier.com/S0960-8524(13)01365-5/h0150http://refhub.elsevier.com/S0960-8524(13)01365-5/h0150http://refhub.elsevier.com/S0960-8524(13)01365-5/h0150http://refhub.elsevier.com/S0960-8524(13)01365-5/h0150http://refhub.elsevier.com/S0960-8524(13)01365-5/h0155http://refhub.elsevier.com/S0960-8524(13)01365-5/h0155http://refhub.elsevier.com/S0960-8524(13)01365-5/h0155http://refhub.elsevier.com/S0960-8524(13)01365-5/h0155http://refhub.elsevier.com/S0960-8524(13)01365-5/h0155http://refhub.elsevier.com/S0960-8524(13)01365-5/h0155http://refhub.elsevier.com/S0960-8524(13)01365-5/h0160http://refhub.elsevier.com/S0960-8524(13)01365-5/h0160http://refhub.elsevier.com/S0960-8524(13)01365-5/h0160http://refhub.elsevier.com/S0960-8524(13)01365-5/h0160http://refhub.elsevier.com/S0960-8524(13)01365-5/h0160http://refhub.elsevier.com/S0960-8524(13)01365-5/h0160http://refhub.elsevier.com/S0960-8524(13)01365-5/h0160http://refhub.elsevier.com/S0960-8524(13)01365-5/h0160http://refhub.elsevier.com/S0960-8524(13)01365-5/h0160http://refhub.elsevier.com/S0960-8524(13)01365-5/h0160http://refhub.elsevier.com/S0960-8524(13)01365-5/h0165http://refhub.elsevier.com/S0960-8524(13)01365-5/h0165http://refhub.elsevier.com/S0960-8524(13)01365-5/h0165http://refhub.elsevier.com/S0960-8524(13)01365-5/h0165http://refhub.elsevier.com/S0960-8524(13)01365-5/h0165http://refhub.elsevier.com/S0960-8524(13)01365-5/h0165http://refhub.elsevier.com/S0960-8524(13)01365-5/h0165http://refhub.elsevier.com/S0960-8524(13)01365-5/h0170http://refhub.elsevier.com/S0960-8524(13)01365-5/h0170http://refhub.elsevier.com/S0960-8524(13)01365-5/h0170http://refhub.elsevier.com/S0960-8524(13)01365-5/h0170http://refhub.elsevier.com/S0960-8524(13)01365-5/h0170http://refhub.elsevier.com/S0960-8524(13)01365-5/h0175http://refhub.elsevier.com/S0960-8524(13)01365-5/h0175http://refhub.elsevier.com/S0960-8524(13)01365-5/h0175http://refhub.elsevier.com/S0960-8524(13)01365-5/h0175http://refhub.elsevier.com/S0960-8524(13)01365-5/h0175http://refhub.elsevier.com/S0960-8524(13)01365-5/h0175http://refhub.elsevier.com/S0960-8524(13)01365-5/h0175http://refhub.elsevier.com/S0960-8524(13)01365-5/h0175http://refhub.elsevier.com/S0960-8524(13)01365-5/h0170http://refhub.elsevier.com/S0960-8524(13)01365-5/h0170http://refhub.elsevier.com/S0960-8524(13)01365-5/h0170http://refhub.elsevier.com/S0960-8524(13)01365-5/h0165http://refhub.elsevier.com/S0960-8524(13)01365-5/h0165http://refhub.elsevier.com/S0960-8524(13)01365-5/h0165http://refhub.elsevier.com/S0960-8524(13)01365-5/h0165http://refhub.elsevier.com/S0960-8524(13)01365-5/h0160http://refhub.elsevier.com/S0960-8524(13)01365-5/h0160http://refhub.elsevier.com/S0960-8524(13)01365-5/h0160http://refhub.elsevier.com/S0960-8524(13)01365-5/h0160http://refhub.elsevier.com/S0960-8524(13)01365-5/h0160http://refhub.elsevier.com/S0960-8524(13)01365-5/h0155http://refhub.elsevier.com/S0960-8524(13)01365-5/h0155http://refhub.elsevier.com/S0960-8524(13)01365-5/h0155http://refhub.elsevier.com/S0960-8524(13)01365-5/h0155http://refhub.elsevier.com/S0960-8524(13)01365-5/h0155http://refhub.elsevier.com/S0960-8524(13)01365-5/h0155http://refhub.elsevier.com/S0960-8524(13)01365-5/h0150http://refhub.elsevier.com/S0960-8524(13)01365-5/h0150http://refhub.elsevier.com/S0960-8524(13)01365-5/h0150http://refhub.elsevier.com/S0960-8524(13)01365-5/h0150http://refhub.elsevier.com/S0960-8524(13)01365-5/h0150http://refhub.elsevier.com/S0960-8524(13)01365-5/h0145http://refhub.elsevier.com/S0960-8524(13)01365-5/h0145http://refhub.elsevier.com/S0960-8524(13)01365-5/h0145http://refhub.elsevier.com/S0960-8524(13)01365-5/h0145http://refhub.elsevier.com/S0960-8524(13)01365-5/h0140http://refhub.elsevier.com/S0960-8524(13)01365-5/h0140http://refhub.elsevier.com/S0960-8524(13)01365-5/h0140http://refhub.elsevier.com/S0960-8524(13)01365-5/h0135http://refhub.elsevier.com/S0960-8524(13)01365-5/h0135http://refhub.elsevier.com/S0960-8524(13)01365-5/h0130http://refhub.elsevier.com/S0960-8524(13)01365-5/h0130http://refhub.elsevier.com/S0960-8524(13)01365-5/h0130http://refhub.elsevier.com/S0960-8524(13)01365-5/h0125http://refhub.elsevier.com/S0960-8524(13)01365-5/h0125http://refhub.elsevier.com/S0960-8524(13)01365-5/h0125http://refhub.elsevier.com/S0960-8524(13)01365-5/h0120http://refhub.elsevier.com/S0960-8524(13)01365-5/h0120http://refhub.elsevier.com/S0960-8524(13)01365-5/h0120http://refhub.elsevier.com/S0960-8524(13)01365-5/h0115http://refhub.elsevier.com/S0960-8524(13)01365-5/h0115http://refhub.elsevier.com/S0960-8524(13)01365-5/h0115http://refhub.elsevier.com/S0960-8524(13)01365-5/h0110http://refhub.elsevier.com/S0960-8524(13)01365-5/h0110http://refhub.elsevier.com/S0960-8524(13)01365-5/h0110http://refhub.elsevier.com/S0960-8524(13)01365-5/h0110http://refhub.elsevier.com/S0960-8524(13)01365-5/h0105http://refhub.elsevier.com/S0960-8524(13)01365-5/h0105http://refhub.elsevier.com/S0960-8524(13)01365-5/h0105http://refhub.elsevier.com/S0960-8524(13)01365-5/h0100http://refhub.elsevier.com/S0960-8524(13)01365-5/h0100http://refhub.elsevier.com/S0960-8524(13)01365-5/h0100http://refhub.elsevier.com/S0960-8524(13)01365-5/h0095http://refhub.elsevier.com/S0960-8524(13)01365-5/h0095http://refhub.elsevier.com/S0960-8524(13)01365-5/h0095http://refhub.elsevier.com/S0960-8524(13)01365-5/h0090http://refhub.elsevier.com/S0960-8524(13)01365-5/h0090http://refhub.elsevier.com/S0960-8524(13)01365-5/h0090http://refhub.elsevier.com/S0960-8524(13)01365-5/h0085http://refhub.elsevier.com/S0960-8524(13)01365-5/h0085http://refhub.elsevier.com/S0960-8524(13)01365-5/h0085http://refhub.elsevier.com/S0960-8524(13)01365-5/h0080http://refhub.elsevier.com/S0960-8524(13)01365-5/h0080http://refhub.elsevier.com/S0960-8524(13)01365-5/h0080http://refhub.elsevier.com/S0960-8524(13)01365-5/h0075http://refhub.elsevier.com/S0960-8524(13)01365-5/h0075http://refhub.elsevier.com/S0960-8524(13)01365-5/h0075http://refhub.elsevier.com/S0960-8524(13)01365-5/h0075http://refhub.elsevier.com/S0960-8524(13)01365-5/h0070http://refhub.elsevier.com/S0960-8524(13)01365-5/h0070http://refhub.elsevier.com/S0960-8524(13)01365-5/h0065http://refhub.elsevier.com/S0960-8524(13)01365-5/h0065http://refhub.elsevier.com/S0960-8524(13)01365-5/h0065http://refhub.elsevier.com/S0960-8524(13)01365-5/h0060http://refhub.elsevier.com/S0960-8524(13)01365-5/h0060http://refhub.elsevier.com/S0960-8524(13)01365-5/h0060http://refhub.elsevier.com/S0960-8524(13)01365-5/h0055http://refhub.elsevier.com/S0960-8524(13)01365-5/h0055http://refhub.elsevier.com/S0960-8524(13)01365-5/h0055http://refhub.elsevier.com/S0960-8524(13)01365-5/h0055http://refhub.elsevier.com/S0960-8524(13)01365-5/h0050http://refhub.elsevier.com/S0960-8524(13)01365-5/h0050http://refhub.elsevier.com/S0960-8524(13)01365-5/h0050http://refhub.elsevier.com/S0960-8524(13)01365-5/h0045http://refhub.elsevier.com/S0960-8524(13)01365-5/h0045http://refhub.elsevier.com/S0960-8524(13)01365-5/h0045http://refhub.elsevier.com/S0960-8524(13)01365-5/h0040http://refhub.elsevier.com/S0960-8524(13)01365-5/h0040http://refhub.elsevier.com/S0960-8524(13)01365-5/h0035http://refhub.elsevier.com/S0960-8524(13)01365-5/h0035

1-s2.0-s0960852413013655-main

Documents