1-s2.0-s0923250899800588-main.pdf

8/9/2019 1-s2.0-S0923250899800588-main.pdf

1/10

Heterogeneity of the eae genes in attaching/effacing Escherichia colifrom cattle: comparison with human strains

Bernard China, Etienne Jacquemin, Anne-Catherine Devrin,Vinciane Pirson, Jacques Mainil*

Chaire de bactériologie et de pathologie bactérienne, Faculté de médecine vétérinaire, Université de Liège,Sart Tilman, Liège, B-4000, Belgium

(Submitted 12 December 1998; accepted 10 March 1999)

Abstract — Enteropathogenic (EPEC) and enterohaemorrhagic (EHEC) Escherichia coli isolated from cattlewere studied by DNA colony hybridization to subtype their intimin-encoding (eae) gene with probes derivedfrom the variable parts of the eaeα gene of the human EPEC strain E2348/69, the eaeγ gene of the human

O157:H7 EHEC strain ATCC43888, and the eae gene of the bovine O26:H- EHEC strain 193, whose eaegene was first cloned and sequenced during this work. The EPEC and EHEC had been isolated fromdiarrhoeic calves (143 EPEC and 48 EHEC) and from healthy animals at the slaughterhouse (10 EPEC and 34EHEC). The 191 bovine EPEC and EHEC isolated from diseased calves were positive with the Eae probe (55and 27% respectively) and with the Eaeγ probe (9 and 73% respectively), whereas 52 EPEC (36%) werenegative with the Eaeα, Eae, and Eaeγ probes. The results were different for the 44 bovine EPEC and EHECisolated from healthy cattle at slaughterhouses: most tested positive with the Eaeγ probe (80 and 82%respectively) and the remaining (20 and 18% respectively) with the Eae probe. Nine O26 human EHEC testedpositive with the Eae probe and seven O111 with the Eaeγ probe. The bovine and human EPEC and EHEC

belonging to these two serogroups gave identical results: the 18 bovine and human O26 isolates testedpositive with the Eae probe, whereas the 13 O111 isolates were positive with the Eaeγ probe. In contrast, theisolates belonging to other serogroups (O5, O15, O18, O20, and O118) gave more variable results. The eae andeaeγ, but not the eaeα, variants were thus distributed amongst bovine EPEC and EHEC. The eae variantseemed to be more frequently associated with the presence of clinical signs in calves, but one third of EPECfrom diarrhoeic calves carried an eae gene variant other than the α, , or γ variants. In addition, the use of thesegene probes did not enable differentiation between bovine and human EHEC belonging to the same Oserogroup. © Elsevier, Paris

eae gene / Escherichia coli / locus of enterocyte effacement / cloning / gene probe

1. Introduction

Enteropathogenic (EPEC) and enterohaemor-rhagic (EHEC) Escherichia coli cause enteritis

and haemorrhagic enterocolitis in man and invarious animal species [7, 8, 14, 24, 25, 27, 31].They are often regrouped under the name of attaching/effacing E. coli (AEEC) on the basis of production of a common histopathological le-

sion, characterized by the effacement of themicrovilli of the enterocytes, by intimate attach-ment to the enterocyte membrane, and by accu-mulation of actin filaments under the area of adherence of the bacteria [26]. In addition,EHEC, but not EPEC, produce Shiga toxins andharbour a ca. 60-MDa plasmid [27]. Productionof the attaching/effacing (AE) lesion is con-

* Correspondence and reprintsTel.: 32 4 366 4090Fax: 32 4 366 4056 [email protected] Abbreviations: AE, attaching/effacing; AEEC, attaching/effacing E. coli; BEHEC, bovine EHEC; BEPEC, bovineEPEC; DEPEC, dog EPEC; EHEC, enterohaemorrhagicE. coli; EPEC, enteropathogenic E. coli; HEHEC, humanEHEC; HEPEC, human EPEC; IPTG, isopropyl-beta-thiogalactoside; LEE, locus of enterocyte effacement; PE-PEC, pig EPEC; REPEC, rabbit EPEC.

Res. Microbiol. 150 (1999) 323−332© Elsevier, Paris

8/9/2019 1-s2.0-S0923250899800588-main.pdf

2/10

trolled by several genes grouped together onthe bacterial chromosome to form a pathogenic-ity island, the locus of enterocyte effacement, orLEE [20]. These genes code for a type III secre-tion system, for several type III-secreted pro-

teins, and for an outer membrane protein, in-timin, which mediates the intimate adherence of the bacteria to the enterocyte cytoplasmic membrane [27].

The eae gene which codes for intimin was firstcloned from the human EPEC (HEPEC) strainE2348/69 of serotype O127:K-:H6 [17]. Other eaegenes have been cloned from O157:H7 humanEHEC (HEHEC) strains [6, 40], from rabbitEPEC (REPEC) strains, including the O15:H-strain RDEC-1 [3], from the dog EPEC (DEPEC)

strain 4221 [4], and from the O45 porcine EPEC(PEPEC) strain 86–1390 [4]. These eae genes arehighly homologous in their proximal twothirds, but much less so in their terminal part.

A recent study [2] has even identified fivevariants of the eae gene in HEPEC and HEHEC,which are to some extent serotype-associated: αin EPEC strains of O55:H6, O127:H6 (includingthe reference strain E2348/69), O142:H6, andO142:H34 serotypes; in EPEC strains of O26:H-, O111:H-, O114:H2, O119:H2, O119:H6,

and O128:H2 serotypes and in HEHEC strainsof O26:H11 and O111:H8 serotypes; γ in EPEC of O55:H- and O55:H7 serotypes and in EHECstrains of O157:H7 serotype; δ in EPEC strainsof O86:H34 serotype, and a still untyped one inEPEC strains of O127:H40 serotype. Accordingto their sequence the eae genes of the REPECand PEPEC strains belong to group , whereasthe eae gene of the DEPEC strain belongs togroup δ [2–4]. Bovine EPEC (BEPEC) and EHEC(BEHEC) strains also harbour eae-relatedgenes [5, 9, 11, 12, 16, 23, 34, 37, 39], but none

has been cloned so far, nor of course has theirheterogeneity been studied.

The purpose of this study was as follows: i) toclone and sequence the eae gene from an O26BEHEC strain isolated from a calf with diar-rhoea; ii) to derive gene probes from the vari-able parts of different eae genes; and iii) to typeand compare the eae genes of a collection of

EPEC and EHEC strains isolated from diar-rhoeic calves, healthy adult cattle, and humans.

2. Materials and methods

2.1. Bacteria

The eae gene was cloned from the O26:K-:H-BEHEC strain 193 originally isolated in 1962from a diarrhoeic calf in the USA [22]. Collec-tions of E. coli strains were subsequently stud-ied by colony hybridization to determine thevariants of the eae gene present: 143 BEPEC and48 BEHEC strains isolated from 2- to 8-week-oldcalves with clinical diarrhoea [11, 23]; 10 BEPECand 34 BEHEC strains isolated from healthy

cattle at slaughterhouses [11]; and 16 HEHECstrains received from Dr D. Piérard (AZ-VUB,Brussels, Belgium). The definition of EPECmust, however, be taken with some caution, asEHEC can lose their stx genes in vitro or invivo [18, 19, 23]. Twenty-one BEPEC and BE-HEC strains from diarrhoeic calves and 18 fromhealthy cattle had been serotyped previously:they belonged to the O5, O15, O18, O20, O26,O111, and O118 serogroups [23] (unpublisheddata). The HEHEC strains belonged to O26(nine isolates) or O111 (seven isolates) sero-goups (Piérard, personal communication).

Three strains were used as positive controlsfor the gene probes: the HEPEC strainE2348/69, carrying an eaeα gene, the REPECstrain RDEC1, carrying an eae gene, and theO157:H7 HEHEC strain ATCC43888 strain, car-rying an eaeγ gene [2]. The BEHEC strain 193carrying a still uncharacterized eae gene was thefourth control strain. Strain HS was the negativecontrol for all probes [22, 23, 28].

2.2. Cloning and sequencing of the eae

gene

Total DNA of strain 193 was extracted(Qiagen genomic-tip, Qiagen, Hilden, Ger-many) and submitted to partial restriction bythe Sau3A enzyme. The restriction fragmentsfrom 5 to 15 kb were eluted (Geneclean, Bio101,Vista, USA) and ligated into the BamHI site of the pUC19 plasmid. After electroporation of the

324 China et al.

8/9/2019 1-s2.0-S0923250899800588-main.pdf

3/10

E. coli DH5α strain, the recombinant cloneswere selected on LB agar supplementedwith 5-bromo-4-chloro-3-indolyl-beta-D-galac-to-sidase (X-gal), isopropyl-beta-thio-galacto-side (IPTG) and ampicillin (100 µg/mL). White

colonies were subsequently assayed by DNAhybridization with the gene probe derived fromthe constant part of the eae gene [17]. Subcloneswere derived from a probe-positive recombi-nant clone to obtain a restriction map and thesequence of the bovine eae gene using theSanger method [35] and a T7 sequencing kit(Pharmacia, Uppsala, Sweden).

2.3. Gene probes

The probe corresponding to the constant part

of the eae gene (Eae probe) was derived byrestriction as described before [23] from thepCVD434 recombinant plasmid carrying theeaeα gene from the HEPEC strain E2348/69 [17].The probe for the variable part of the eae gene of the O26:K-:H- BEHEC strain 193 (later identi-fied as an Eae probe) was derived as describedin the Results section. These two probes wererecovered after digestion by appropriate restric-tion endonucleases, agarose gel electrophoresis,and elution (Geneclean, Bio1O1, Vista, USA).

The probes for the variable parts of the eaeα

gene (Eaeα probe) and of the eaeγ gene (Eaeγprobe) were derived by polymerase chain reac-tion (PCR) (figure 1) from the O127:K-:H6HEPEC strain E2348/69 and from the O157:H7HEHEC strain ATCC43888, respectively, withthe following primers: B75 (TAAAGTGAT-GAAGGGGGAT) and B76 (ATTGGGTG-GAGAGAAAAGC) for the Eaeα probe and B73(TACTGAGATTAAGGCTGATAA) and B74(AGGAAGAGGGTTTTGTGTT) for the Eaeγprobe (Gibco BRL Life Technologies, Merelbeke,Belgium).

The PCR mixture included one unit of Dy-nazyme (Finnzymes, Espoo, Finland), five µL of 2mM dNTPs (Pharmacia, Uppsala, Sweden),five µL of 10 × buffer (Tris-HCl 100mM pH8.8,MgCl2 15mM, KCl 500 mM, Triton X-100 1%),0.5 µL of each primer (40mM), and 5 µL of DNAtemplate in a total volume of 50 µL, and wascovered by 30 µL of mineral oil (Sigma-Aldrich,

Bornem, Belgium). The reaction conditions werethe following: 94 °C for 5 min followed by 30cycles at 94 °C for 30 s, 50 °C for 30 s, and 72 °Cfor 30 s, in a DNA thermocycler (Perkin ElmerCetus, Norwalk, UK).

The DNA fragment amplified with primersB73 and B74 represented the Eaeγ probe andhad a size of ca. 0.8 kb. The DNA fragmentamplified with primers B75 and B76 had a sizeof ca. 0.95 kb and was subsequently digestedwith the HinfI restriction enzyme (figure 1). Thetwo generated fragments were separated byelectrophoresis in agarose gel. The largest re-striction fragment (ca. 0.7 kb), corresponding tothe Eaeα probe, was eluted from the gel(Geneclean, Bio1O1, Vista, USA).

2.4. Colony hybridization

The gene probe fragments were radioactivelylabelled with a-32P-dCTP (Amersham, LittheChallont, UK) by random priming with dCTPlabelling beads (Pharmacia, Uppsala, Sweden).The colony hybridization assays during thecloning of the eae gene of the BEHEC strain andfor the study of the subtype(s) of eae genesamong the collections of EPEC and EHECstrains were performed as previously de-

scribed [23].

3. Results

3.1. Cloning of the eae genefrom O26:K-:H-BEHEC strain 193

Two of the recombinant clones obtainedtested positive with the Eae probe (pCUR3 andpCUR4). After sequencing of the extremities of the cloned DNA fragments and comparisonwith the published sequences of eae genes, oneof them was considered as carrying the wholeeae gene (pCUR3), whereas the second onecarried only the 3’ end of the gene (pCUR4)(figure 1). The pCUR3 insert was a 10-kb DNAfragment from which subclones were derivedusing restriction endonucleases according toalready published restriction maps of eae genes.The restriction map of the pCUR3 insert had

eae Genes in bovine attaching/effacing E. coli 325

8/9/2019 1-s2.0-S0923250899800588-main.pdf

4/10

similarities with the restriction maps of theother eae genes for approximately 2 kb (figure 1).

3.2. Sequencing of the eae genefrom O26:K-:H-BEHEC strain 193

From pCUR5, pCUR6, pCUR22, pCUR25,and pCUR27 (figure 1), overlapping subcloneswere derived using AluI, HincII, PstI, and RsaIrestriction endonucleases to generate shortDNA fragments which were subsequently se-quenced. An open reading frame of 2 814 bpwas observed corresponding to a protein of 938amino acids (Genebank Access NumberAF043226). Comparison with the other eae genesequences published revealed 99.9% overall

identity with the eae gene, but only 83% withthe eaeα and eaeγ genes (table I). In the proximaltwo-thirds (1.8 kb), the BEHEC eae gene had 94,100, and 93% identity with the eaeα, eae , andeaeγ genes. The degree of identity dropped to62–77% in the distal third (1.0 kb) with the eaeα,eaeγ, and eaeδ genes, but not with the eae gene

(table I, figure 2).

3.3. Derivation of a gene probefrom the eae gene of O26:K-:H-BEHEC strain 193

The probe for the variable part of the eae geneof strain 193 was thus named Eae. This probewas a ca. 0.4-kb long DNA fragment derivedfrom the pCUR25 recombinant plasmid after

Figure 1. Restriction map and subclones of the pCUR3 recombinant plasmid DNA insert carrying the eae gene of the O26 BEHECstrain 193 (1 = start codon ; 939 = stop codon ) and derivation of the Eae probe. Restriction sites above the line of pCUR3 were conserved compared to the restriction maps of the eaeα gene of the HEPEC strain E2348/69 and of the eaeγ gene of

O157:H7 HEHEC strains; restriction sites below the line were not. The pCUR25H fragment was used as an Eae probe; the Eaeα(amplification with primers B75 and B76 and restriction by HinfI) and Eaeγ (amplification with primers B73 and B74) probe fragmentsare also presented.

326 China et al.

8/9/2019 1-s2.0-S0923250899800588-main.pdf

5/10

RsaI restriction and cloned into the SmaI site of pUC19 plasmid (pCUR25H) (figure 1). Theprobe fragment was obtained by restriction of pCUR25H with BamHI and EcoRI.

3.4. Study of the heterogeneity of the eae genesamong BEPEC, BEHEC, and HEHEC strains

All strains were first tested with the Eaeprobe corresponding to the constant part of theeae genes and subsequently with the threeprobes derived from the variable parts of the eaegenes coding for the intimins α, , and γ. TheEaea probe hybridized with all 235 EPEC andEHEC isolates from cattle and 16 from humans.The Eaea probe tested positive with none of theisolates except for the positive control, but the

Eae and the Eaeγ probes tested positive withmost bovine and all human isolates (table II) inaddition to the positive controls. No cross-hybridization results were observed.

The 191 BEPEC and BEHEC isolated fromdiseased calves were mainly positive with theEae probe (78 EPEC, 55%; 13 EHEC, 27%) andhalf of the remaining with the Eaeγ (13 EPEC,9%; 35 EHEC, 73%). This means that 52 EPEC

(36%) were negative with the Eaeα, Eae, andEaeγ probes. The results were different for the44 BEPEC and BEHEC isolated from healthycattle at slaughterhouses: most tested positivewith the Eaeγ probe (80 and 82%, respectively)and the remaining (20 and 18%, respectively)with the Eae probe. The 16 HEHEC were alsodivided into two groups: nine were positivewith the Eae probe and seven with the Eaeγprobe (table II).

3.5. Association between serogroups and eae genesubtype among BEPEC, BEHEC, and HEHEC

The strains belonging to serogroups commonto humans and cattle gave identical results

Table I. Identity between the eae gene of the O26 BEHEC strain 193 and the eaeα [17], eae [3], eaeγ [6, 40], and eaeδ [4] genevariants.

% Identity with the respective eae variant

eae Gene Strain Overall Proximal Distal(2.8 kb) (1.8 kb) (1.0 kb)

eaeα E2348/69 (HEHEC) 83 % 94 % 62 %eae RDEC1 (REPEC) 99.9 % 100 % 98 %eaeγ EDL933 (HEHEC) 83 % 93 % 65 %eaeδ 4221 (DEPEC) NA NA 77 %

NA, not accessible.

Figure 2. Phylogenetic tree representation of the sequences of the distal third (1.0 kb) of the different eae gene variants. Gene bank access numbers: RDEC1 = U60002; 193 = AF043226; 4221 = U66102; E2348/69 = AF022236; O157:H7 = AF071034.


8/9/2019 1-s2.0-S0923250899800588-main.pdf

6/10

(table III): the O26 bovine (nine isolates) andhuman (nine isolates) EPEC and EHEC testedpositive with the Eae probe, whereas the O111 bovine (six isolates) and human (seven isolates)EPEC and EHEC were positive with the Eaeγ

probe. On the other hand, the isolates fromother serogroups, regarded as cattle-specific (O5and O118) or less frequently identified (O15,O18, O20), gave more variable results. TheseBEPEC and BEHEC were often positive with theEae probe when isolated from diarrhoeiccalves and with the Eaeγ probe when isolatedfrom healthy cattle (table III).

4. Discussion

AEEC, either enterohaemorrhagic (EHEC) orenteropathogenic (EPEC), cause enteric diseases

in humans and in animals. The zoonotic risk of EPEC has never really been estimated. How-ever, their host specificity is generally believedto be high, since most EPEC from humans andfrom the various animal species belong to spe-cific serotypes (groups) and/or produce specificcolonization factors [7, 8, 14, 23, 25, 27, 31].

The situation is different for EHEC, which aremainly isolated from humans and ruminants;human infections have indeed been traced tocontaminated beef and dairy products in sev-eral cases [21, 27]. Based on serotyping, threecategories of EHEC strains could be previouslydistinguished: those mainly associated with dis-ease in calves (e.g., serogroups O5, O118), thoseassociated with disease in calves and humans(e.g., serogroups O26, O103, O111), and those

Table II. Colony hybridization results of bovine and human EPEC and EHEC with gene probes derived from the variable 3′ ends of theeae genes coding for intimins α (Eaeα probe), (Eae probe), and γ (Eaeγ probe).

Type of isolate(no. isolates) No. isolates positive with the probe (%)

No. isolates negativewith the three probes

Origin Pathotype Eaeα Eae Eaeγ (%)

Diarrhoeic calves (191) EPEC (143) – 78 (55) 13 (9) 52 (36)EHEC (48) – 13 (27) 35 (73) –

Healthy cattle (44) EPEC (10) – 2 (20) 8 (80) –EHEC (34) – 6 (18) 28 (82) –

Humans (16) EHEC (16) – 9 (55) 7 (45) –

Table III. Correlation between serogroup O of bovine and human AEEC strains and probe hybridization results (strains are EHECunless otherwise stated).

Serogroup O Eae probeNo. positive isolates/no. isolates tested

Diarrhoeic calves Healthy cattle Humans

O5 Eae 4/4 1/4 –Eaeγ – 3/4 –

O15 Eae 2/2 – –Eaeγ – – –

O18 Eae 2/3a – –Eaeγ 1/3 – –

O20 Eae – 1/2 –Eaeγ – 1/2 –

O26 Eae 6/6 b 3/3 9/9Eaeγ – – –

O111 Eae – – –Eaeγ 1/1 5/5 7/7

O118 Eae 6/6 – –Eaeγ – 4/4 –

aBoth are EPEC. bFive are EPEC and EHEC is strain 193.

328 China et al.

8/9/2019 1-s2.0-S0923250899800588-main.pdf

7/10

carried by healthy cattle but associated withdisease in humans (serogroup O157) [21, 27].But the first two categories are becoming lessand less clearly defined as the range of sero-groups and serotypes isolated from both cattle

and humans widens continuously.Other criteria than the serotype must be used

to compare AEEC from identical serotypes iso-lated from humans and cattle: the genetic deter-minants of the AE lesion and of the cytotoxinssuch as Shiga toxins and enterohaemolysins, orthe whole bacterial genome [21, 27, 36]. Com-parison of the whole bacterial genome is time-consuming and needs sophisticated equipment.Comparison of the Shiga toxins and of theenterohaemolysins is easier, but their encodinggenes are phage- and plasmid-located, respec-tively, and can be lost in vitro and in vivo [18,19, 23]. Comparison of the genes located withinthe LEE is another possibility, as several vari-ants of the eae gene coding for the intimin and of different type III-secreted proteins have beenrecently recognized [1, 2, 13, 29, 32].

The eae gene and its product, intimin, play acentral role in the pathogenesis of AEEC and inthe production of the AE lesion by mediatingthe intimate attachment of the bacteria to theenterocyte cytoplasmic membrane and, at least

in part, the host and tissue specificity of theinfection, and in the diagnosis of AEEC which is based upon the detection of the eae gene in the bacteria either by gene probe or by PCR [10, 15,17, 27]. Since the recognition of several vari-ants [2–4, 6, 17, 40], the eae gene could also serveas a molecular epidemiological marker in thepublic health problem of tracing human infec-tions and of comparing AEEC from differentorigins.

This study thus sought to answer two ques-tions: i) are the different variants of the eae genepresent in bovine AEEC strains? and ii) do bovine and human AEEC belonging to identicalserotypes carry the same variant(s) of the eaegene?

The cloning and sequencing of the eae genefrom one BEHEC indicates that strain 193 car-ries a variant, like the REPEC. The existence of the variant amongst bovine AEEC was con-

firmed by the colony hybridization assay usinga gene probe derived from the variable part of this gene (pCUR25H or Eae probe). Con-versely, a collection of REPEC [33] tested posi-tive with this probe (unpublished data). Keep-

ing in mind the always possible loss of the stxgenes by some of the strains here defined asEPEC, the eae variant is actually more oftenpresent in EPEC from diarrhoeic calves (55%)than in EHEC from diarrhoeic calves (27%) andEPEC and EHEC from healthy cattle (20 and18% respectively). Given the results with the αand γ probes on EPEC from diarrhoeic calves (0and 9% of positive isolates respectively), onethird of them possess still another variant, pos-sibly the eaeδ variant, which was not included inthis work, or the recently described eaee variant(Oswald, personal communication). Hence,with the exception of EPEC from diarrhoeiccalves, the eaeγ variant is the most frequentlydetected (73 to 82%) and all isolates are positivefor either the eae variant or the eaeγ variant(table II).

Although the number of strains with sero-grouping results is small, bovine and humanAEEC belonging to the same serogroup giveidentical results irrespective of their origin: theO26 isolates were positive for the variant and

the O111 isolates for the γ variant. No O157strains, which are also positive for the γ variantaccording to published results [2], were tested, because O157 EHEC are rarely isolated fromhumans or from cattle or beef products inBelgium (Daube and Piérard, personal commu-nications). Apart from the O26 and O111 iso-lates, specific associations between serogroupsand intimin types do not seem to exist amongst bovine AEEC (table III), in contrast to humanAEEC [2]. Complete serotyping may, however,reveal such specific associations.

If these results are confirmed on a largernumber of bovine AEEC, they could meaneither that the and the untyped intimins aremore cattle-specific than the γ intimin as far asdisease production is concerned, in contrast tohumans, or that the three intimin types areinvolved in disease in calves, with possiblediffering tissue specificity (small intestine or


8/9/2019 1-s2.0-S0923250899800588-main.pdf

8/10

colon for instance), as already observed for theα and γ intimins in humans and in animalmodels [38]. It is also possible, however, thatneither hypothesis is correct, since intiminspecificity may reside in a few amino acid

sequences and because only DNA sequencing,and not the typing methods used so far (probes,PCR), could discriminate between bovine andhuman and γ intimins. However, it is possiblethat O26 and O111 BEHEC and HEHEC areclonally related and that no method will distin-guish between them. Indeed, evidence forclonality was recently observed between O26,O103, O111, and O157 HEHEC within the sameserogroup [36].

In summary, the answer to the first question

is that the eae and eaeγ variants, but not theeaeα variant, are distributed amongst bovineAEEC. In addition, one third of the EPEC fromdiarrhoeic calves carry another variant of the eaegene. As to the second question, O26 and O111AEEC harbour, respectively, the same eae genevariants irrespective of their origin (cattle orhumans). Using gene probes derived from thevariable part of the genes, the typing of the eaegene variants was thus unable to differentiate between BEHEC and HEHEC within the sameserogroup. Other techniques should be used

and/or parameters should be looked at: forexample, other genes of the LEE or other targetssuch as the cytotoxin-encoding genes.

Moreover, in order to be practical, a typingmethod must not only be reproducible but alsoeasy and fast, and multiplex PCRs should bedeveloped for genes located within the LEE, justas some have already been developed for shi-gatoxigenic E. coli [10, 15, 30].

Résumé — Hétérogénéité des gènes eae dans des

souches bovines d’Escherichia coli : comparaisonavec des souches humaines. Des souches d’Escheri-chia coli entéropathogènes (EPEC) et entérohémorra-giques (EHEC) isolées de bovins ont été étudiées parhybridation ADN sur colonies pour le typage deleurs gènes eae, au moyen de sondes dérivées desparties variables du gène eaeα de la souche EPEChumaine E2348/69, du gène eaeγ d’une soucheEHEC humaine O157:H7 (ATCC43888) et du gène

eae d’une souche EHEC bovine O26:H- (193), dontle gène eae a été cloné et séquencé au cours de cetravail. Ces souches EPEC et EHEC avaient étéisolées de veaux malades (143 EPEC et 48 EHEC) oud’animaux sains à l’abattoir (10 EPEC et 34 EHEC).

Les 191 souches EPEC et EHEC bovines isolées deveaux malades sont positives avec la sonde Eae (55et 27 % respectivement) et avec la sonde Eaeγ (9 et73 % respectivement), mais 52 souches EPEC (36 %)donnent des résultats négatifs avec les sondes Eaeα,Eae et Eaeγ. Les 44 souches EPEC et EHEC isoléesd’animaux sains à l’abattoir donnent des résultatsdifférents : la majorité (80 et 82 % respectivement)sont positives avec la sonde Eaeγ et les autres (20 et18 % respectivement) avec la sonde Eae. Neuf sou-ches EHEC humaines O26 sont positives avec lasonde Eae et sept O111 avec la souche Eaeγ. Lessouches EPEC et EHEC bovines et humaines appar-

tenant à ces deux sérogroupes donnent des résultatsd’hybridation identiques : les dix-huit souches ap-partenant au sérogroupe O26 sont positives avec lasonde Eae, tandis que les treize souches apparte-nant au sérogroupe O111 le sont avec la sonde Eaeγ.Inversement, les souches appartenant à d’autres sé-rogroupes donnent des résultats variables. Les va-riants eae et eaeγ, mais non le variant eaeα, sont doncprésents parmi les souches EPEC et EHEC bovines.Le premier semble plus fréquemment associé avec laprésence de troubles cliniques chez de jeunes veaux.Cependant, un tiers des souches EPEC isolées de

veaux malades contiennent un variant du gène eaedifférent des variants α, ou γ. De plus, l’utilisationde ces sondes génétiques n’a pas permis de différen-cier les souches EHEC bovines et humaines appar-tenant au même sérogroupe O. © Elsevier, Paris

gène eae / Escherichia coli / locus d’effacement desentérocytes / clonage / sondes génétiques

Acknowledgments

The authors wish to thank Dr Georges Daube

from the Département des denrées alimentairesd’origine animale, Faculté de médecine vétéri-naire, Université de Liège, Liège, Belgium, DrEric Oswald from the Laboratoire associé Inrade microbiologie moléculaire, École nationalevétérinaire, Toulouse, France for helpful discus-sions, and Dr Denis Piérard from the Akame-disch Ziekenhuis, Vrije Universiteit, Brussels,Belgium for providing the HEHEC strains and

330 China et al.

8/9/2019 1-s2.0-S0923250899800588-main.pdf

9/10

their serotypes. This work was financially sup-ported by the Ministère fédéral des classesmoyennes et de l’agriculture, Brussels, Belgium(research contract 5740), the Fonds national dela recherche scientifique (Crédit aux chercheurs,

1995), and the University of Liège (Crédit duconseil de la recherche, 1996).

References

[1] Abe A., Kenny B., Stein M., Finlay B.B., Characterization of twovirulence proteins secreted by rabbit enteropathogenic Escherichiacoli , EspA and EspB, whose maximal expression is sensitive to hostbody temperature, Infect. Immun. 65 (1997) 3547–3555.

[2] Adu-Bobie J., Frankel G., Bain C., Goncalves A.G., Trabulsi L.,Douce G.,Knutton S.,Dougan G.,Detection of intiminsα, , γ, andδ, four intimin derivatives expressed by attaching and effacingmicrobial pathogens, J. Clin. Microbiol. 36 (1998) 662–668.

[3] Agin T.S., Cantey J.R., Boedeker E.C., Wolf M.K., Characterizationofthe eaeA gene fromrabbit enteropathogenic Escherichia coli strainRDEC-1 and comparison to other eaeA genes from bacteria thatcause attaching and effacing lesions, FEMS Microbiol. Lett. 144(1996) 249–258.

[4] An H., Fairbrother J.M., Dubreuil J.D., Harel J., Cloning and cahra-cterization of the eae gene from a dog attaching and effacingEscherichia coli strain 4221, FEMS Microbiol. Lett. 148 (1997)239–245.

[5] Barrett T.B., Kaper J.B., Jerse A.E., Wachsmuth I.K., Virulencefactors in Shiga-like toxin-producing Escherichia coli isolated fromhumans and cattle, J. Infect. Dis. 165 (1992) 979–980.

[6] Beebakhee G., Louie M., DeAzavedo J., Brunton J., Cloning andnucleotide sequence of the eae gene homologue from enterohem-orrhagic Escherichia coli serotype O157:H7, FEMS Microbiol. Lett.91 (1992) 63–68.

[7] Beutin L., Escherichia coli as a pathogen in dogs and cats, Vet. Res.(1999) in press.

[8] Broes A., Les Escherichia coli pathogènes du chien et du chat, Ann.Méd. Vét. 137 (1993) 377–384.

[9] China B., Pirson V., Jacquemin E., Pohl P., Mainil J., , Pathotypes of verotoxigenic Escherichia coli isolates producing Attaching/Effacing(AE) lesions in the ligated intestinal loop assay in rabbits, Adv. Exp.Med. Biol. 412 (1997) 311–316.

[10] China B., Pirson V., Mainil J., Typing of bovine attaching and effacingEscherichia coli by multiplex in vitro amplification of virulence-associated genes, Appl. Environ. Microbiol. 62 (1996) 3462–3465.

[11] China B., Pirson V., Mainil, J., Prevalence and molecular typing of attaching and effacing Escherichia coli among calf populations inBelgium, Vet. Microbiol. 63 (1998) 249–259.

[12] Cray W.C.J.R., Thomas L.A., Schneider R.A., Moon H.W., Virulenceattributes of Escherichia coli isolated from dairy heifer feces, Vet.

Microbiol. 53 (1996) 369–374.[13] Elliott S.J., Wainwright L.A., McDaniel T.K., Jarvis K.G., Deng Y.K.,

Lai L.C., McNamara B.P., Donnenberg M.S., Kaper, J.B., The com-plete sequence of the locus of enterocyte effacement (LEE) fromenteropathogenic Escherichia coli E2348/69, Mol. Microbiol. 28(1998) 1–4.

[14] Fairbrother J.M., Les colibacilloses du porc, Ann. Méd. Vét. 137(1993) 369–375.

[15] Franck S.M., Bosworth B.T., Moon H.W., Multiplex PCR for entero-toxigenic, attaching and effacing, and Shiga toxin-producing Escheri-chia coli strains from calves, J. Clin. Microbiol. 36 (1998) 1795–1797.

[16] Goffaux F., Mainil J., Pirson V., Charlier G., Pohl P., Jacquemin E.,China B., Bovine attaching and effacing Escherichia coli possess apathogenesis island related to the LEE of human enteropathogenicEscherichia coli strain E2348/69, FEMS Microbiol. Lett. 154 (1997)415–421.

[17] JerseA.E.,Yu J.,TallB.D., Kaper J.B., A genetic locus of enteropatho-genic Escherichia coli necessary for the production of attaching and

effacing lesions on tissue cell cultures, Proc. Nat. Acad. Sci. USA 87(1990) 7839–7843.

[18] Karch H., Meyer T., Rüssmann H., Heesemann J., Frequent loss of Shiga-like toxin genes in clinical isolates of Escherichia coli uponsubcultivation, Infect. Immun. 60 (1992) 3464–3467.

[19] Karch H., Rüssmann H., Schmidt H., Schwarzkopf A., Heesemann J.,Long-term shedding and clonal turnover of enterohaemorrhagicEscherichia coli O157 in diarrheal disease, J. Clin. Microbiol. 33(1995) 1602–1605.

[20] McDaniel T.K., Jarvis K.G., Donnenberg M.S., Kaper J.B., A geneticlocus of enterocyte effacement conserved among diverse entero-bacterial pathogens, Proc. Nat. Acad. Sci. USA 92 (1995)1664–1668.

[21] Mainil J.G., Vero/Shigatoxins and vero/shigatoxigenic Escherichia coli in animals, Vet. Res. (1999) in press.

[22] Mainil J.G., Duchesnes C.J., Whipp S.C., Marques L.R.M., O’BrienA.D., Casey T.A., Moon H.W., Shiga-like toxin production and

attaching and effacing activity of Escherichia coli associated with calf diarrhea, Am. J. Vet. Res. 48 (1987) 743–748.

[23] Mainil J.G., Jacquemin E., Kaeckenbeeck A., Pohl P., Associationbetween the effacing gene (eae) and the Shiga-like toxin-encodinggenes in Escherichia coli isolates from cattle, Am. J. Vet. Res. 54(1993) 1064–1068.

[24] Mainil J., Pohl P., Les souches attachantes et effaçantes d’Escherichiacoli d’origine bovine, Ann. Méd. Vét. 138 (1994) 419–429.

[25] Milon A.,Oswald E.,DeRycke J.,Rabbit EPEC: a model forthe studyof enteropathogenic Escherichia coli , Vet. Res. (1999) in press.

[26] Moon H.W., Whipp S.C., Argenzio R.A., Levine M.M., Gianella,R.A., Attaching and effacing activities of rabbit and human entero-pathogenic Escherichia coli in pig and rabbit intestines, Infect. Im-mun. 53 (1983) 1340–1351.

[27] Nataro J.P., Kaper J.B., Diarrheagenic Escherichia coli , Clin. Micro-biol. Rev. 11 (1998) 142–201.

[28] O’Brien A.D., Laveck G.D., Thompson M.R., Formal S., Productionof Shigella dysenteriae type 1-like cytotoxin by Escherichia coli , J.Infect. Dis. 146 (1982) 763–769.

[29] Paton A.W., Manning P.A., Woodrow M.C., Paton J.C., Translocatedintimin receptors (Tir) of shigatoxigenic Escherichia coli isolatesbelonging to serogroups O26, O111, and O157 react with serafrom patients with hemolytic-uremic syndrome and exhibit markedsequence heterogeneity, Infect. Immun. 66 (1998) 5580–5586.

[30] Paton A.W., Paton J.C., Detection and characterization of shiga-toxigenic Escherichia coli using multiplex PCR assays for stx1, stx2,enterohemorrhagic Escherichia coli hlyA, rfbO111, and rfbO157, J.Clin. Microbiol. 36 (1998) 598–602.

[31] Peeters J., Les Escherichia coli entéropathogènes (EPEC) du lapin,Ann. Méd. Vét. 137 (1993) 361–368.

[32] Perna N., Mayhew G.F., Posfai G., Elliot S., Donnenberg M.S., Kaper J.B., Blattner F.R., Molecular evolution of a pathogenicity island fromenterohaemorrhagic Escherichia coli , Infect. Immun. 66 (1998)3810–3817.

[33] Pohl P.H., Peeters J.E., Jacquemin E.R., Lintermans P.F., Mainil, J.G.,Identification of eae sequences in enteropathogenic Escherichia coli strains from rabbits, Infect. Immun. 61 (1993) 2203–2206.

[34] Sandhu K.S., Clarke R.C., McFadden K., Brouwer A., Louie M.,Wilson J., Lior H., Gyles C.L., Prevalence of the eaeA gene inverotoxigenic Escherichia coli strains from dairy cattle in SouthwestOntario, Epidemiol. Infect. 116 (1996) 1–7.

[35] Sanger F., Nicklen S., Coulson A., DNA sequencing with chainterminating inhibitors, Proc. Nat. Acad. Sci. USA 74 (1977)5463–5467.


8/9/2019 1-s2.0-S0923250899800588-main.pdf

10/10

[36] Schmidt H., Geitz C., Tarr P.I., Frosch M., Karch H., Non-O157:H7pathogenic Shiga toxin-producing Escherichia coli : phenotypic andgenetic profiling of virulence traits and evidence for clonality, J.Infect. Dis. 179 (1999) 115–123.

[37] Smith H.R., Willshaw G.A., Scotland S.M., Thomas A., Rowe B.,Properties of Vero cytotoxin-producing Escherichia coli isolatedfrom human and non-human sources, Zentralbl. Bakteriol. 278

(1993) 436–444.

[38] Tzipori S., Gunzer F., Donnenberg M.S., de Montigny L., Kaper J.B.,Donohue-Rolfe A., The role of the eaeA gene in diarrhea and

neurological complications in a gnotobiotic piglet model of entero-hemorrhagic Escherichia coli infection, Infect. Immun. 63 (1995)3621–3627.

[39] Wieler L.H., Vieler E., Erpenstein C., Sclapp T., Steinrück H.,Bauerfeind H., Byomi A., Baljer G., Shiga toxin-producing Escheri-chia coli (STEC) from bovines: association of adhesion with thecarriage of eae and other genes, J. Clin. Microbiol. 34 (1996)

2980–2984.[40] Yu J., Kaper J.B., Cloning and characterization of the eae gene of enterohaemorrhagic Escherichia coli O157:H7, Mol. Microbiol. 6(1992) 411–417.

332 China et al.

1-s2.0-s0923250899800588-main.pdf

Documents