1-s2.0-s0264410x10003476-main

7/30/2019 1-s2.0-S0264410X10003476-main

1/8

Vaccine 28 (2010) 35403547

Contents lists available at ScienceDirect

Vaccine

j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / v a c c i n e

Production and efficacy of an Aeromonas hydrophila recombinant S-layer proteinvaccine for fish

Saravanane Poobalane a,, Kim D. Thompson a, Lszl Ard b, Noel Verjan c, Hyun-Ja Han c,Galina Jeney b, Ikuo Hirono c, Takashi Aoki c, Alexandra Adams a

a Institute of Aquaculture, University of Stirling, Stirling, FK9 4LA, UKb Research Institute for Fisheries, Aquaculture and Irrigation, Anna liget 8, H-5540 Szarvas, Hungaryc Laboratory of Genome Science, Graduate School of Marine Science and Technology, Tokyo University of Marine Science and Technology,

Konan 4-5-7, Minato, Tokyo 108-8477, Japan

a r t i c l e i n f o

Article history:

Received 25 November 2009

Received in revised form 6 March 2010

Accepted 8 March 2010

Available online 20 March 2010

Keywords:

Aeromonas hydrophila

Recombinant S-layer protein vaccine

Efficacy testing

Common carp

a b s t r a c t

A recombinant protein for the S-layer protein of Aeromonas hydrophila was produced and its ability to

protect common carp Cyprinus carpio L. against six virulent isolates of A. hydrophila was assessed. A

group of 120 carp(3040 g) were vaccinated intra-peritoneally with 0.1ml of adjuvanted vaccine (30gprotein per fish). Another group of 120 carp were injected with 0.1 ml of PBS-adjuvant mixture to serve

as controls. Twenty fish from each group were challenged with each one of six virulent isolates of A.

hydrophila 35 days post-vaccination. The fish were maintained in 12 separate tanks before terminating

the experiment at 16 days post-challenge. The relative percentage survival (RPS) for the six isolates of

A. hydrophila ranged from 56 to 87%. The difference in survival rate of fish challenged with four of the

isolates was statistically significant in vaccinated fish compared to control fish, when analysed using a

Chi-square test. The results of the study suggest that the recombinant S-layer protein of A. hydrophila

could be usefulas a vaccine antigento protect fish againstdifferent isolates of this pathogenic bacterium.

2010 Elsevier Ltd. All rights reserved.

1. Introduction

Aeromonas hydrophila is an important fish pathogen in aqua-

culture systems, and millions of dollars are estimated to be lost

per annum due to the diseases caused by this bacterium [1]. The

pathogen is responsible for causing a number of different diseases

including motile Aeromonas septicaemia [2]. The symptoms of A.

hydrophila infections include swelling of tissues, dropsy, red sores,

necrosis, ulceration and haemorrhagic septicaemia [3,4], and the

pathogen canaffect a variety of fishspeciesincluding commoncarp

[3], cat fish [5], tilapia [6], eel [7] and goldfish [8].

The use of vaccines in the aquaculture industry hasbeen impor-tant in reducing economic losses which occur as a result of disease

[9,10]and in thereduction in use of antibiotics[11]. Anumberofdif-

ferent types of vaccines have been developed against A. hydrophila

for use in fish, such as whole cell (WC) [12,13], outer membrane

protein (OMP) [14], extracellular products (ECPs), lipopolysaccha-

ride (LPS) preparations [15] and also biofilms [16]. Although these

different preparations have provided varying degrees of protec-

Corresponding author. Tel.: +44 1786467994; fax: +44 1786472133.

E-mail address: [email protected] (S. Poobalane).

tion in fish, there is still no commercial vaccine available for A.

hydrophila [1]. This could be due to an inability of these vaccines

to cross-protect against different isolates ofA. hydrophila. This bac-

terium is very heterogeneous in nature (both biochemically and

serologically), and this has been one of the greatest obstacles in

developing an effective vaccine against A. hydrophila [17]. It might

be possible to overcome this problem if a common antigen(s) could

be identified among different isolates of A. hydrophila that could

serve as a vaccine candidate(s) [13].

Proteomics combined with Western blotting (i.e. immunopro-

teomics) is a useful tool for identifying proteins of interest for

vaccine development [18]. Separationand characterisation of com-plex mixtures of proteins by two-dimensional sodium dodecyl

sulphate-polyacrylamide gel electrophoresis (2D SDS-PAGE) pro-

vides information about the expression of proteins by bacterial

pathogens [19]. Further analysis by Western blotting using serum

from infected fish, or from fish which have recovered from the dis-

ease, allows identification of antigens recognised by the immune

system of the infectedhost [19]. Together,these twotechniques can

help identify potential candidates for vaccine development [20].

Although it is possible to identify a variety of immunogenic anti-

gens on the bacterium using this method, the antigen must also be

protective against a wide range of A. hydrophila isolates in order

0264-410X/$ see front matter 2010 Elsevier Ltd. All rights reserved.

doi:10.1016/j.vaccine.2010.03.011
http://www.sciencedirect.com/science/journal/0264410Xhttp://www.elsevier.com/locate/vaccinemailto:[email protected]://localhost/var/www/apps/conversion/tmp/scratch_10/dx.doi.org/10.1016/j.vaccine.2010.03.011http://localhost/var/www/apps/conversion/tmp/scratch_10/dx.doi.org/10.1016/j.vaccine.2010.03.011mailto:[email protected]://www.elsevier.com/locate/vaccinehttp://www.sciencedirect.com/science/journal/0264410X

7/30/2019 1-s2.0-S0264410X10003476-main

2/8

S. Poobalane et al. / Vaccine28 (2010) 35403547 3541

to be considered as a suitable vaccine candidate [21]. It is possible

to evaluate the level of protection elicited by a target antigen by

vaccinating thefish with the antigen andthen subsequentlyexper-

imentally infecting the fish with live pathogen and establishing the

level of survival in vaccinated fish [22].

Another important factor in vaccine development is the abil-

ity to produce sufficient quantities of the protective proteins

for commercialisation of the vaccine. Researchers are now using

recombinant DNA technology to develop protein vaccines because

it provides a means of economically producing sufficient quanti-

ties of the immunoprotective antigen [23,24]. Such vaccines have

enormous potential in the aquaculture industry as they provide

an alternative approach to traditional formalin-killed WC vaccines,

which are not always efficacious, and they are safe compared to

live attenuated bacteria used in vaccines which can possibly revert

to becoming pathogenic [25]. Recombinant protein vaccines have

been reported to confer protection against a variety of human and

animal pathogens (Yersinia pestis [26], rabies virus [27], Plasmod-

ium falciparum [28]) including fish (Ichthyophthirius multifiliis [29],Piscirickettsia salmonis [23]).

We previously examined the differential expression of cellular

proteins (WC and OMP) and ECPs of six isolates (four virulent and

two avirulent) ofA. hydrophila, cultured either in vitro in tryptone

soy broth or in vivo in dialysis tubing implanted within the peri-toneal cavity of common carp [30]. Using 1D SDS-PAGE of WC,

OMP and ECP preparations and 2D SDS-PAGE of the WC prepara-

tion, unique and up-regulated proteins were observed in bacteria

grown in vivo. In a subsequent study, common carp were infected

withthesamesixisolatesofA. hydrophila inordertoobtainantibod-

ies elicited by the fish against proteins of various bacterial isolates

expressed in vivo during infection [31]. The immune-recognition

pattern of these antibodies against WC, OMP and ECP preparations

of the six isolates grown either in vitro or in vivo was compared

by the Western blot analysis. A common antigen found on all the

isolates at around 50 kDa, was identified as an S-layer protein by

MALDI TOFmass spectrometry. Theaim of thepresent study was to

produce the S-layer protein of A. hydrophila by recombinant tech-

nology to ensure sufficient quantity of the protein for a vaccinationtrial to assess the level of protection elicited by the recombinant

protein, and to verify if this recombinant protein was capable of

cross-protecting against different isolates ofA. hydrophila.

2. Materials and methods

2.1. Recombinant S-layer protein production

Recombinant S-layer protein of A. hydrophila was produced in

order to have sufficient protein for a vaccination trial.

2.1.1. Extraction of DNA from A. hydrophila

A. hydrophila isolate T4 was grown overnight according toPoobalane et al. [30] and centrifuged at 5000gfor 5min at 4 C.

The pellets were resuspended in 567l Tris ethylenediaminete-traacetic acid (EDTA) (TE) buffer (10 mM TrisCl and 1 mM EDTA,

pH 8), 30l of 10% (w/v) SDS and 3l of 20mgml1 proteinase K.The bacteria were thoroughly mixed and incubated for 1 h at 37 C

before adding 100l of 5 M NaCl. The pellets were mixed againand incubated for 10minat 65C after adding 80l cetyltrimethy-lammonium bromide (CTAB) in NaCl solution (10%, v/v, CTAB in

0.7 M NaCl). The DNA was extracted from the sample withan equal

volume of chloroform: isoamyl alcohol (24:1 ratio) (780 l). Thetube was inverted a couple of times and centrifuged at 5000gfor

5minat4 C. The aqueous phase was transferred to a new tube and

extractedwith phenol: chloroform: isoamyl alcohol (25:24:1ratio).

The contents of the tube was thoroughly mixed and centrifuged

at 5000gfor 10 min at 2022 C before transferring the aqueous

phase to a new tube. The DNA was precipitated with an equal vol-

umeof isopropanol.The contents of the tube were then thoroughly

mixed by inverting the tube a couple of times and centrifuged at

5000g for 10min at 4 C. The precipitate was washed with 70%

ethanol by centrifuging at 5000g for 10min at 4 C. The super-

natant was removed and the pellets were briefly dried at 2022 C

for 10 min. The pellets were resuspended in 100l TE buffer andstored at 20 C until used.

2.1.2. Polymerase chain reaction (PCR) of A. hydrophila S-layer

protein gene

Specific primers were designed to amplify the S-layer pro-

tein gene based on the DNA sequence data for the S-layer

protein of A. hydrophila published by Thomas and Trust [32].

Restriction sites NcoI and BglII were added to the forward (5

ccatgggagttaatctggacactggtgc 3) and reverse (3 gacttgtggtacttgcg-

taagtctaga 5) primers, respectively, to assist its cloning into the

expression vector pQE 60 (Qiagen, Tokyo, Japan). The PCR mixture,

composed of genomic DNA (3l containing 50 ng), the forwardand reverse primers (2l containing 200 pmol), dNTP (5l con-taining 200M), MgCl2 buffer (4l containing 1 mM), Taq DNApolymerase (0.5l) and TE buffer, was prepared for a 40l reac-

tion. The DNA was amplified with 32 cycles using the followingconditions: preheating to 95 C for 5 min, denaturation at 95 C for

30 s, annealing at 55 C for 30 s, elongation at 72 C for 1 min and a

final elongation step at 72 C for 5min.

2.1.3. Cloning of the S-layer protein gene

The PCR products were run on a 1% agarose gel for 30min

at 100V. The target bands were identified under ultraviolet

(UV) light, excised from the gel and cut into small pieces. The

DNA was extracted from the gel using a DNA purification kit

(GE Life Science, Buckinghamshire, UK). Digestion of the PCR

products and vector (pQE 60) were performed using restriction

enzymes NcoI and BglII. The digested PCR products and the vec-

tor were run on an agarose gel and purified as described above,

before ligating them together using ligation high, T4 DNA ligaseenzyme (Cosmo Bio, Tokyo, Japan). The pQE 60 vector, carrying

the amplified S-layer protein gene of A. hydrophila, was trans-

formed into Escherichia coli, M15 (Quiagen, Tokyo, Japan). The

bacteria were incubated in SOC medium (SigmaAldrich, Dorset,

UK) at 37 C for 1 h with vigorous shaking. The pellets were

centrifuged at 2000g for 3min and resuspended in 2 yeast

tryptone broth (2YTB). The cells were grown on Luria Bertani

(LB)agar plates containing ampicillin (100g ml1) andkanamycin(25g ml1).

2.1.4. Expression and purification of the recombinant S-layer

protein in E. coli

The positive clones containing the S-layer protein gene, were

inoculated into LB broth containing antibiotics (ampicillin andkanamycin), and incubated overnight at 37 C. The culture was

transferred into fresh LB broth (1:9 ratio, v/v) containing antibi-

otics and cultured at 37 C with vigorous shaking. The absorbance

of the culture was measured every hour at 600 nm until it reached

0.6, after which, the culture was induced to express the recombi-

nant protein by adding 1mM isopropyl--thiogalactoside (IPTG).After growing the bacteria for 4 h, the bacterial pellets were har-

vested at 4000gfor 30minat 4 C. The pellets were resuspended

in phosphate buffered saline (PBS: 0.02M phosphate and 0.15M

NaCl) and stored at 80 C.

The bacterial pellet was subjected to three rounds of freeze-

thawing before resuspendingin sterile PBS and sonicating 60 times

at 150 W for 20 s with 10 s intervals. After sonication, the soluble

(native protein) and insoluble materials (inclusion bodies) were

7/30/2019 1-s2.0-S0264410X10003476-main

3/8

3542 S. Poobalane et al. / Vaccine28 (2010) 35403547

separated by centrifugation at 4000g for 30min at 4 C. Inclu-

sion bodies were solubilised in denaturing solution (8 M urea, 0.1%

(w/v) SDS and 100 mM TrisHCl) with 10 mM imidazole. The pQE

60 vector used for cloning the S-layer protein gene has 6 repeated

sets of DNA coding for amino acid, histidine, which will also be

expressed by attaching with the protein encodes for the insert. The

histidine-tag was used to assist in separating the S-layer protein

from the other proteins of the E. coli. Nickel beads (Ni Sepharose 6

fast flow, Amersham Bioscience) were added to the inclusion bod-

ies to bind the histidine-tag present in theproteins. Thebeadswere

poured into a column (XK 16/20 empty lab scale column, Amer-

sham BioScience) and washed three times with 20mM wash buffer

(Imidazole 20 mM, NaH2PO4 50 mM and NaCl 300 mM) pH 8. The

proteins were elutedfrom thebeads with elution buffer (imidazole

250mM, NaH2 P04 50 mM and NaCl 300mM) pH 8.5. The beads

in the column were washed again before loading the soluble pro-

tein mixed with imidazole (10 mM), and the protein was eluted

after washing as described above. The eluted protein was concen-

trated using a Millipore membrane (10,000 MW cut-off, Amicon).

The concentration of the protein was measured using a Pierce pro-

tein determination kit (Pierce ScientificCo., Rockford, USA) after

dialysing the protein overnight in sterile PBS using seamless cellu-

lose tubing (12,000MW cut-off, Union Carbide Corporation, Tokyo,

Japan).The WC preparation of recombinant E. coli with and without

IPTG induction, and the recombinant S-layer protein preparation

were separated on a 12% SDS-PAGE and Western blot was then

performed according to Poobalane [31] with modifications using

an anti-histidine-tag antibody, which can bind to the histidine-

tag attached to the S-layer protein. Briefly, after electroblotting

the gels onto a nitrocellulose membrane (ATTO Co., Tokyo, Japan),

the membranes were blocked with casein, and incubated with an

anti-histidine-tag antibody (GE life science, Buckinghamshire, UK)

diluted 1:6000 in TBS for 1 h. Mouse anti-rabbit conjugated to IgG-

alkaline phosphatase (Promega, Madison WI, USA) was used at a

concentration of 1:7500 and incubated for 1 h. The reaction was

developed using 5-bromo-4-chloro-3-indolylphosphate/nitro blue

tetrazolium (BCIP-NBT) alkaline phosphatase substrate (1 tabletdissolved in 10 ml of double distilled water, SigmaAldrich Co, St.

Louis, MO, USA).

2.2. Vaccination of common carp with recombinant S-layer

protein

2.2.1. Vaccination

The recombinant S-layer protein of A. hydrophila, prepared

above, was diluted in PBS and mixed with montanide adjuvant

(Intervet Schering-Plough Aquaculture, Saffron Walden, UK) at

a ratio of 30:70 (v/v) to give a final antigen concentration of

300g ml1. PBS was mixed with the adjuvant at the same ratioas the antigen to serve as a negative control. Mixing was car-

ried out by vortexing until the antigen was emulsified, and itwas then stored overnight at 4 C to ensure that the emulsion

was stable. Common carp, weighing 3040g, were obtained from

the indoor fish culture system of Research Institute for Fisheries,

Aquaculture and Irrigation, Hungary. The fish were maintained

in a fibreglass tank in an indoor aquarium at a water tempera-

ture of 2022 C. The tanks were supplied with water, which was

passed through a biological recirculatory system and ultraviolet

(UV) irradiation. The fish were anaesthetised according to Poobal-

ane et al. [30] before start vaccinating them. One hundred and

twenty common carp (3040 g) were vaccinated intra-peritoneally

(IP) with 0.1 ml of the vaccine preparation, and another 120 fish

were injected with the PBS-adjuvant mixture. The right-hand side

pectoral fins of control fish were clipped for identification. All the

fish were maintained for 35 days in 1 m

1 m (diameter

depth)

tanks before challenging them with six different isolates of A.

hydrophila.

2.2.2. Challenge studies

Six virulentisolatesofA. hydrophila (T4,98140,98141,Hh, B2/12

and Vds) were passaged twice through common carp (3040g)

to determine their lethal dose 50% (LD50) value in carp. Initially,

the concentration of the bacteria was adjusted to an OD of 1.0 at

610nm,equivalent to 1108 bacteria ml

1, before preparingthreedifferent doses of bacteria, at 2107, 5107 and 2.5107 ml1.

The fish were injected IP with 0.1ml of these suspensions and

placed in a separate glass tank for each strain. The concentration of

bacteria was adjusted accordingly and injected into a newgroup of

fish to obtain the LD50 value for all isolates.

Twenty vaccinated and 20 control fish were challenged IP with

each isolate after anaesthetising the fish according to Poobal-

ane et al. [30]. The concentrations of the bacteria used in the

challenge were 1 108, 2107, 2107, 5107, 7.5106 and

2107 bacteriaml1 for T4, 98140, 98141, Hh, B2/12 and Vds,

respectively. All 40 fish within each group were placed in sepa-

rate glass tanks (90cm length47 cm height40 cm depth) and

the water temperature was maintained at 2022 C. The dead

fish from the tanks were removed three times a day and a kid-ney swab taken was streaked onto TSA plates. At the end of

the trial, Day 16 post-challenge, 6 fish surviving the challenge

(3 vaccinated and 3 control fish for each bacterial strain) were

killed by overdosing with benzocaine (0.01% w/v). The appear-

ance of the internal organs of the killed fish was examined before

sampling their kidney. Gram staining and serum agglutination

using rabbit anti-A. hydrophila polyclonal antibodies diluted in PBS

1/100 (v/v) were used to confirm the presence of A. hydrophila

to ensure the mortalities were specific to the infection caused

by the bacteria. The relative percentage survival (RPS) was calcu-

lated to determine the efficacy of the vaccine using the following

formula [33].

RPS = 1 (% vaccinated mortality)

(% control mortality) 100

2.2.3. Statistical analysis

The results obtained were analysed statistically using Chi-

square test for survival, comparing the mortality of vaccinated fish

with the control group fish after challenging with bacteria.

3. Results

3.1. Production of the recombinant S-layer protein of A.

hydrophila isolate

The amplification of the gene encoding the S-layer protein fromA. hydrophila isolate T4 was successfully achieved, indicated by the

production of the1353bp PCRproducton a 1%agarose gelas shown

in Fig. 1 (lanes 2 and 3), while successful ligation of the digested S-

layerproteingeneintothe pQE60vectorwasconfirmed bythe band

obtained at around 4.8kb (Fig. 1 (lane 4)). Expression of an abun-

dant S-layer protein (45.5 kDa) was confirmed in the IPTG induced

E. coli, transformed with the pQE60 vector containing the S-layer

gene insert, by SDS-PAGE analysis (Fig. 2a). The protein also gave

a strong positive reaction in Western blot with the anti-histidine

antibody (Fig. 2b). A final yield of 15 mg of purified protein was

recovered from a 1 litre E. coli culture, and it was confirmed as S-

layer protein by SDS-PAGE analysis (Fig. 3a) and Western blotting

using serum produced against a WC preparation ofA. hydrophila T4

isolate (raised in common carp) (Fig. 3b).

7/30/2019 1-s2.0-S0264410X10003476-main

4/8


Fig. 1. Amplification of the S-layer gene of A. hydrophila isolate T4 shown on a 1%

agarose gel. Lanes: (1) standard markers; (2) S-layer protein gene; (3) purified S-

layer protein gene; (4) pQE60 vector carrying S-layer protein gene.

3.2. Efficacy of recombinant S-layer protein as a vaccine against

A. hydrophila in common carp

3.2.1. Standardisation of the challenge dose of A. hydrophila

All six strains ofA. hydrophila, T4, 98140, 98141, Hh, B2/12 and

Vds, were passaged two times through common carp and the bac-

teria were successfully recovered on each passage. During the first

passage, no mortalities occurred in any of the fish, while most fishdied when passaging bacteria were used with the exception of fish

passed with isolate T4. The LD50 values obtained for each strain are

presentedinTable1. ThehighestLD50 value obtainedwas for isolate

T4 with a dose of 1108 bacteriaml1, while the lowest dose was

Fig. 2. Expressionof S-layer protein ofA. hydrophila with E. coli WC protein. (a)12%SDS-PAGEstained withCoomassieblue and(b) Westernblot ofproteinusing ananti-

histidine-tag antibody. Lanes: (1) standard protein marker; (2) WC preparation of

recombinant E. coli without IPTG induction; (3) WC preparation of recombinant E.

coli with IPTG induction showing S-layer protein.

obtained with isolate B2/12 with a value of 7.5106 bacteriaml1.

An LD50 value of 2107 bacteriaml1 was obtained for isolates

98140, 98141and Vds, whilean LD50 valueof 5107 bacteriaml1

was obtained for Hh.

3.2.2. Vaccination of common carp with the recombinant S-layer

protein of A. hydrophila

The cumulative mortality that occurred in the control fish after

challenging with the different isolates ofA. hydrophila ranged from

40 to 75%, while the mortalities of vaccinated fish ranged between10 and 20% (Table 1). The mortalities ceased in the control groups

by Day 8 post-challenge, whereas no mortality was found after

Day 5 post-challenge in the vaccinated groups (Fig. 4). A higher

percentage of mortalities were recorded in control fish challenged

Fig. 3. Recombinant S-layer protein of A. hydrophila purified from E. coli. (a) 12% SDS-PAGE stained with Coomassie blue and (b) Western blot against anti-A. hydrophila T4

isolate antibody from carp. Lanes: (1) standard protein marker; (2) WC protein of A. hydrophila; (3 and 4) protein separated from insoluble fractions of recombinant E. coli;

(5 and 6) protein separated from soluble fractions of recombinant E. coli.

7/30/2019 1-s2.0-S0264410X10003476-main

5/8


Fig. 4. Cumulative percentagemortalityof carp vaccinated with recombinant S-layer protein and challengedwithA. hydrophila isolates.Different letters indicate a statistical

difference between vaccinated and unvaccinated fish.

with isolate T4 than in fish challenged with the other isolates of A.

hydrophila (Fig. 4a). The relative percentage survival (RPS) value of

fish challenged with isolate T4 was found to be the highest com-pared with the fish challenged with other A. hydrophila isolates,

while the lowest RPS value was obtained in fish challenged with

isolate B2/12 (Table 1). Statistically, survival after challenging with

isolates T4, 98140, 98141 and Hh was significantly higher in vac-

cinated fish compared to control fish, while levels of survival were

not statistically different between vaccinated and control fish chal-

lenged with isolates B2/12 and Vds (Table 1).

A. hydrophila was recovered from all kidney swabs taken from

dead fish over the course of the trial. In contrast, no A. hydrophila

was cultured from kidney swabs taken from fish surviving at the

endof experimentalchallenge exceptswabs of one fishin the vacci-

nated group challenged with isolate 98140, and another fish in the

control group challenged with isolate 98141, with a few colonies

obtained from both fish.

4. Discussion

A. hydrophila infections have been difficult to treat in aquacul-ture systems due to the resistance of this pathogen to a number

of different antibiotics [34]. Researchers have, therefore, examined

the effects of different types of A. hydrophila vaccine preparations,

to protect fish against diseases caused by this bacterium. How-

ever, the efficacy of these vaccines was not tested against a variety

of different A. hydrophila isolates, and it is therefore unknown if

they would cross-protect against other isolates of the bacterium

[1315]. Most of these vaccines do not appear to have been field-

tested for commercialisation, possibly due to the fact that the

quantity of vaccine required for a field trial is much greater, and

the licensing of vaccines is a long and complicated process.

In previous work, we used immunoproteomics to try to identify

a common antigen between several isolates of A. hydrophila that

could be used to cross-protect fish from infection caused by vari-

7/30/2019 1-s2.0-S0264410X10003476-main

6/8


Table

1

ThedetailsoftheA.hydrophilaisolatesusedandrelativepercentagesurvivalofcarpvaccinatedwithrecombinantS-layerproteinofA.hydrophilathenchallengedwiththebacterium.

A.hydrophila

isolates

Isolatedfrom

LD50value

(bacteriaml1)

Totalmortality(%)

Relativeperce

ntage

survival(%)

P-value

(Chi-squaretest)

Hostspecies

Country/date

Lesion/infection

Vaccinatedfish

Controlfish

T4

Rohu(Labeorohita)

Bangladesh(1994)

EUSlesion

1

108

10

75

87

0.000

Hh

Hedgehog(Erinaceuseuropaeu

s)

IOA

5

107

10

65

85

0.000

98140

Blackshark(Moruliuschrysoph

ekadion)

AyuthayaProvince,Thailand(1998)

Haemorrhagiclesion

2

107

10

50

80

0.006

98141

2

107

10

40

75

0.028

Vds

Catfish(Ictuluruspuctatus)

India

EUSlesion

2

107

15

40

62.5

0.077

B2/12

Bangladesh

7.5

106

20

45

56

0.091

Abbreviations:IOA,InstituteofAquaculture;EUS,

epizooticulcerativesyndrome.

ous strains of this pathogen [30,31]. Using bacteria cultured both

in vitro and in vivo, an immunogenic S-layer protein was identi-

fiedwhich was common to all virulent isolates ofA. hydrophila. I n a

small scale preliminary vaccination study, the protein was electro-

eluted from an SDS-PAGE gel and the level of protection elicited by

this protein examined using a low number of goldfish. The protein

was found to confer protection against the bacterium in the vac-

cinated goldfish as the RPS value was 66.7%. However, the process

for eluting the protein from the gel was time consuming, and very

small yields of the protein were obtained which were insufficient

forlarger scale vaccination studies. It was, therefore, decided to use

recombinant protein technology to produce sufficient quantities of

the S-layer protein to enable large-scale vaccine trials to be carried

outto examine theability of this protein to elicitprotectionagainst

a variety of different A. hydrophila isolates.

Recombinant protein vaccines have a number of advantages

over traditional bacterin vaccines, including being inexpensive to

produce and safer to use [25]. One of the other major advantages

is that this method of vaccine preparation avoids the presence of

unwanted antigens from the pathogen in the vaccine, which could

lead to suppression of the hosts immune system. For example,

some of the surface proteins of Renibacterium salmoninarum (i.e.

p22 and p57) have been found to suppress the immune system of

fish, and therefore, a WC preparation of this bacterium is not idealto use as a bacterin vaccine [35]. Recombinant protein vaccines, on

the other hand, can induce specific immunity against a particular

antigen which can protect the host from infection [36].

The reason for differences in thevirulence between differentiso-

lates ofA. hydrophila is due to a wide variation in the expression of

genes between various isolates,which in turn leads to differentlev-

els of expression of the virulence factors, such as those found in the

ECP or as surface proteins [37]. In this study, the lowest virulence

was seen with isolate T4 and thehighestwithisolateB2/12.The rate

of mortality was high with all six isolates in both vaccinated and

control fish within the first 2 days post-challenge, compared with

the level of mortality obtained over the rest of the trial (Fig. 4). The

sudden mortality that occurred in the first 2 days post-challenge

was most likely due to toxic shock [38]. This rate of mortality isunlikely to occur during a natural infection because the concen-

tration of the pathogen gradually increases during the infection,

whereas a large numberof bacteria areintroducedat thesame time

in the experimental infection. The recombinantS-layer protein vac-

cine may therefore have a greater ability to protect fish against

natural infections by A. hydrophila, when bacterial concentrations

are low.

The S-layer protein is a predominant cell surface protein seen

in the SDS-PAGE profiles of WC lysates and outer membrane frac-

tions ofA. hydrophila [39]. The presence of S-layer protein among

highly virulentstrains ofA. hydrophila has previously beenreported

by Thomas and Trust [32] and Dooley et al. [40]. Diseases caused

byA. hydrophila possessing S-layers are often associated with inva-

sive systemic infection [41]. Being on the outermost layer of thebacterium, the S-layer protein has more chance of rapidly interact-

ing with the host than other protein components of the bacterium

[32]. The S-layer binds to many host proteins such as fibronectin,

laminin and vitronectin [42], which could be one reason why the

S-layer protein appears to be more immunogenic than other pro-

teins in the bacterium. Kokka et al. [43] suggested that the S-layers

may provide protection for bacteria in their natural environment

or provide a selectiveadvantage in the ability of bacteriumto cause

infection. The protein was also found to confer resistance to serum

killing and protease digestion [42].

The study indicated that the S-layer protein antigen of A.

hydrophila is able to confer protection in common carp against a

range of different isolates of the bacterium, although the RPS val-

ues obtained for the carp did vary between the different challenge

7/30/2019 1-s2.0-S0264410X10003476-main

7/8


isolates. No mortalities occurred in any of the groups of fish after

Day 8 post-challenge and no colonies of A. hydrophila grew from

the kidney swabs taken from surviving fish at the end of experi-

ment except for two fish. This suggests that most of the surviving

fish in the control group had managed to clear the bacterium. It

is known that a healthy fish can produce an antibody response

against different components of the bacterium and clear it from

its circulatory system within 7 days post-infection, if the level of

infection caused by the pathogen is not sufficient to kill the fish

[44].

Other proteins ofA. hydrophila have been produced as recombi-

nant antigensfor usein vaccination studies. Forexample,Fanget al.

[1] foundsignificant protection against two isolates ofA. hydrophila

in bluegourami, Trichogaster trichopterus (75and87.5% RPS) immu-

nised with a recombinant 43kDa OMP, whilea recombinant 37kDa

OMP ofA. hydrophila has been shown to be immunogenic in rohu

carp [45]. Fish vaccinated with this recombinant OMP had a RPS

value of 57% after challenging the fish with a virulent isolate of

A. hydrophila [46]. However, cross-protection of these vaccines

against a range of A. hydrophila isolates has not been reported.

Amend [33] proposed that a RPS value of more than 60 with vac-

cinated and experimentally infected fish was necessary to ensure

protection from natural infection in field. The author also recom-

mendeda minimum mortalityof 60% inthe controlgroupusing tworeplicate groups of 25 fish for both the vaccinated and the control

groups. Though not all the criteria suggested by Amend were fol-

lowedin thepresentstudy, thelevel of protection obtainedwith the

recombinant protein against six different isolates of A. hydrophila,

suggests that it is able to protect against a range of different A.

hydrophila isolates despite thefact thattwo of the challenge isolates

resulted in low RPS values due to slightly increased mortalities in

vaccinated groups (15 and 20%).

In summary, the results of this study, and the smaller prelimi-

nary study with goldfish mentionedabove, suggest that the S-layer

protein ofA. hydrophila maybe an importantantigen for conferring

protection in common carp against a variety of virulent isolates of

this pathogenic bacterium. Efficacy testing of this vaccine is cur-

rently in progress in the aquarium and in the field to establish if itcan protect a variety of fish species against different isolates of this

bacterium.

Acknowledgements

Authors would like to thank Intervet Schering-Plough Aqua-

culture, Overseas Research Students Awards Scheme and the Paul

Foundation for funding this work.

References

[1] Fang HM, Ge R, Sin YM. Cloning, characterisation and expression ofAeromonashydrophila major adhesin. Fish Shellfish Immunol 2004;16:64558.

[2] Esteve C, Amaro C, Garay E, Santos Y, Toranzo AE. Pathogenicity of live bacte-ria and extracellular products of motile Aeromonas isolated from eels. J ApplMicrobiol 1995;78:55562.

[3] Karunasagar I, Rosalind GM, Karunasagar I, Gopal Rao K. Aeromonas hydrophilasepticaemia of Indian major carps in some commercial fish farms of WestGodavari District, Andhra Pradesh. Curr Sci 1989;58:10445.

[4] Azad IS, Rajendran KV, Rajan JJS, Vijayan KK, Santiago TC. Virulence andhistopathology of Aeromonas hydrophila (Sah 93) in experimentally infectedtilapia, Oreochromis mossambicus (L.). J Aquac Trop 2001;16:26575.

[5] Llobrera AT, Gacutan RQ. Aeromonas hydrophila associated with ulcerative dis-ease epizootic in Laguna de Bay, Philippines. Aquaculture 1987;67:2738.

[6] Yambot AV. Isolation ofAeromonas hydrophila from Oreochromis niloticus dur-ing fish disease outbreaks in the Philippines. Asian Fish Sci 1998;10:34754.

[7] EsteveC, Biosca EG,AmaroC. VirulenceofAeromonashydrophila andsome otherbacteria isolated fromEuropeaneelsAnguilla anguilla rearedin freshwater. DisAquat Org 1993;16:1520.

[8] MajiS,MaliP,JoardarSN.Immunoreactiveantigensoftheoutermembranepro-tein ofAeromonas hydrophila, isolated from goldfish, Carassius auratus (Linn.).

Fish Shellfish Immunol 2006;20:46273.

[9] Ebanks RO, Dacanay A, Goguen M, Pinto DM, Ross NW. Differential proteomicanalysis ofAeromonas salmonicidaoutermembrane proteinsin responseto lowiron and in vivo growth conditions. Proteomics 2004;4:107485.

[10] Thompson KD,AdamsA. Current trendsin immunotherapy andvaccine devel-opment for bacterial diseases of fish. In: Leung KY, editor. Molecular Aspectsof Fish and Marine Biology, vol. 3. Singapore: World Scientific Publishing Co.;2004. p. 31362.

[11] SamuelM, LamTJ, SinYM. Effectof laminaran[beta(1,3)-d-glucan]onthe pro-tective immunity of blue gourami, Trichogaster trichopterus against Aeromonashydrophila. Fish Shellfish Immunol 1996;6:44354.

[12] Lamers CHJ, De Haas MJH, Van Muiswinkel WB. The reaction of the immune

system of fish to vaccination: development of immunological memory in carp,Cyprinus carpioL.,following direct immersioninAeromonashydrophila bacterin.

J Fish Dis 1985;8:25362.[13] Leung KY,WongLS, LowKW, SinYM. Mini-Tn5 induced growth- andprotease-

deficient mutants of Aeromonas hydrophila as live vaccines for blue gourami,Trichogaster trichopterus (Pallas). Aquaculture 1997;158:1122.

[14] Rahman MH, Kawai K. Outer membrane proteins of Aeromonas hydrophilainduce protective immunity in goldfish. Fish Shellfish Immunol2000;10:37982.

[15] Baba T,ImamuraJ, IzawaK, IkedaK. Immuneprotectionin carp, Cyprinus carpioL., after immunization with Aeromonas hydrophila crude lipopolysaccharide. JFish Dis 1988;11:23744.

[16] Azad IS, Shankar KM, Mohan CV, Kalita B. Protective response of common carporallyvaccinatedwith biofilm andfreecells ofAeromonashydrophila challengedby injection and immersion routes. J Aquac Trop 2000;15:6570.

[17] Khashe S, Hill W, Janda JM. Characterization of Aeromonas hydrophila strainsof clinical, animal, and environmental originexpressing the O:34 antigen. CurrMicrobiol 1996;33:1048.

[18] Connolly JP, Comerci D, Alefantis TG, Walz A, Quan M. Proteomic analysis of

Brucella abortus cell envelope and identification of immunogenic candidateproteins for vaccine development. Proteomics 2006;6:376780.

[19] Chen Z, Peng B, Wang S, Peng X. Rapid screening of highly efficient vaccinecandidates by immunoproteomics. Proteomics 2004;4:320313.

[20] ChakravartiDN, FiskeMJ, FletcherLD, ZagurskyRJ. Applicationof genomicsandproteomics for identification of bacterial gene products as potential vaccinecandidates. Vaccine 2000;19:60112.

[21] Makela PH. Vaccines, coming of age after 200 years. FEMS Microbiol Rev2000;24:920.

[22] Irie T, Watarai S, Iwasaki T, Kodama H. Protection against experimentalAeromonas salmonicida infection in carp by oral immunisation with bacterialantigen entrapped liposomes. Fish Shellfish Immunol 2005;18:23542.

[23] Wilhelm V, Miquel A, Burzio LO, Rosemblatt M, Engel E, Valenzuela S, et al. Avaccine against thesalmonidpathogen Piscirickettsia salmonisbasedon recom-binant proteins. Vaccine 2006;24:508391.

[24] SunK, ZhangWW, HouJH, SunL. Immunoprotective analysisof VhhP2,a Vibrioharveyi vaccine candidate. Vaccine 2009;27(21):273340.

[25] Clark TG, Cassidy-HanleyD. Recombinant subunit vaccines: potential and con-

straints. In: Midtlyng PJ, editor. Progress in fish vaccinology. Basel: Karger;2005. p. 15364.[26] Williamson ED, Eley SM, Griffin KF, Green M, Russell P, Leary SEC, et al. A new

improved sub-unit vaccine for plague: the basis of protection. FEMS ImmunolMed Microbiol 1995;12:22330.

[27] Rupprecht CE, Hanlon CA, Blanton J, Manangan J, Morrill P, Murphy S, et al.Oral vaccination of dogs with recombinant rabies virus vaccines: Rabies in theAmericas. Virus Res 2005;111:1015.

[28] Saul A,LawrenceG, AllworthA, Elliott S,AndersonK, RzepczykC, etal. A humanphase 1 vaccine clinical trial of the Plasmodium falciparum malaria vaccinecandidate apical membrane antigen 1 in Montanide ISA720 adjuvant. Vaccine2005;23:307683.

[29] HeJ,Yin Z,Xu G,GongZ,LamTJ,Sin YM.Protectionof goldfishagainst Ichthyoph-thirius multifiliis by immunization with a recombinant vaccine. Aquaculture1997;158:110.

[30] PoobalaneS, ThompsonKD,Diab A,Ard L, JeneyG, AdamsA. Proteinexpressionby Aeromonas hydrophila during growth in vitro and in vivo. Microb Pathog2008;45:609.

[31] Poobalane S. Aeromonas hydrophila vaccine development using immunopro-

teomics. University of Stirling, PhD Thesis; 2007.[32] Thomas SR, TrustTJ. Tyrosinephosphorylation of thetetragonal paracrystalline

array ofAeromonas hydrophila: molecular cloning and high-levelexpression ofthe S-layer protein gene. J Mol Biol 1995;245:56881.

[33] Amend DF. Potency testing of fish vaccines. International symposium on fishbiologics: serodiagnostic and vaccines. Dev Biol Stand 1981;49:44754.

[34] Shariff M. Impact of diseases on aquaculture in the Asia-Pacific region asexemplified spizootic ulcerative syndrome (EUS). J Appl Ichthyol 1998;14:13944.

[35] Fredriksen A, Endresen C, Wergeland HI. Immunosuppressive effect of alow molecular weight surface protein from Renibacterium salmoninarum onlymphocytes from Atlantic salmon (Salmo salar L.). Fish Shellfish Immunol1997;7:27382.

[36] Potter AA, Babiuk LA. New approaches for antigen discovery, production anddelivery: vaccines for veterinary and human use. Curr Drug Targets Infect Dis-ord 2001;1:24962.

[37] Zhang YL,Ong CT,LeungKY. Molecularanalysisof genetic differencesbetweenvirulent and avirulent strains ofAeromonas hydrophila isolated from diseasedfish. Microbiology 2000;146:9991009.

7/30/2019 1-s2.0-S0264410X10003476-main

8/8


[38] Perez MJ, Rodriguez LA, Fernandez-Briera A, Nieto TP. A 45-kDa acetyl-cholinesterase protoxin of Aeromonas hydrophila: purification and immuno-genicity in fish. FEMS Microbiol Lett 2002;211:237.

[39] Murray RGE, Dooley JSG, Whippy PW, Trust TJ. Structure of an S layer on apathogenic strain ofAeromonas hydrophila. J Bacteriol 1988;170:262530.

[40] Dooley JSG, Lallier R, Shaw DH, Trust TJ. Electrophoretic and immunochem-ical analyses of the lipopolysaccharides from various strains of Aeromonashydrophila. J Bacteriol 1985;164:2639.

[41] Janda JM, Kokka RP, Guthertz LS. The susceptibility of S-layer-positive and S-layer-negativeAeromonas strains to complement-mediatedlysis.Microbiology1994;140:2899905.

[42] Noonan B, Trust TJ. The synthesis, secretion and role in virulence ofthe paracrystalline surface protein layers of Aeromonas salmonicida and A.hydrophila. FEMS Microbiol Lett 1997;154:17.

[43] Kokka RP, Velji AM, Clark RB, Bottone EJ, Janda JM. Immune response to Slayer-positive 0:11 Aeromonas associated with intestinal and extraintestinalinfections. Immunol Infect Dis 1992;2:1114.

[44] Chandran MR,ArunaBV, Logambal SM,Dinakaran MR.Immunisation of Indianmajor carps against Aeromonas hydrophila by intraperitoneal injection. FishShellfish Immunol 2002;13:19.

[45] Khushiramani R, Girisha SK, Karunasagar I, Karunasagar I. Cloning and expres-sion of an outer membrane protein ompTS ofAeromonas hydrophila and studyof immunogenicity in fish. Protein Expr Purif 2007;51:3037.

[46] Khushiramani R, Girisha SK, Karunasagar I, Karunasagar I. Protective efficacyof recombinant OmpTS protein ofAeromonas hydrophila in Indian major carp.

Vaccine 2007;25:11578.

1-s2.0-s0264410x10003476-main

Documents