1 population genomics gil mcvean, department of statistics, oxford
Post on 20-Jan-2016
216 views
TRANSCRIPT
![Page 1: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/1.jpg)
1
Population Genomics
Gil McVean, Department of Statistics, Oxford
![Page 2: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/2.jpg)
2
Questions about genetic variation
• How different are our genomes?
• How is the variation distributed within and between genomes?
• What does variation tell us about human evolution?
![Page 3: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/3.jpg)
3
How different are our genomes?
![Page 4: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/4.jpg)
4
Serological techniques for detecting variation
Human
Rabbit
A
A B AB O
![Page 5: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/5.jpg)
5
Blood group systems in humans
• 28 known systems– 39 genes, 643 alleles
System Genes Alleles
ABO ABO 102
Colton C4A, C4B 7+
Chido-rodgers AQP1 7
Colton DAF 10
Diego SLC4A1 78
Dombrock DO 9
Duffy FY 9
Gerbich GYPC 9
GIL AQP3 2
H/h FUT1, FUT2 27/22
I GCNT2 7
Indian CD44 2
Kell KEL, XK 33/30
Kidd SLC14A1 8
Knops CR1 24+
Landsteiner-Wiener
ICAM4 3
Lewis FUT3, FUT6 14/20
Lutheran LU 16
MNS GYPA,GYPB,GYPE
43
OK BSG 2
P-related A4GALT, B3GALT3
14/5
RAPH-MER2 CD151 3
Rh RHCE, RHD, RHAG
129
Scianna ERMAP 4
Xg XG, CD99 -
YT ACHE 4
http://www.bioc.aecom.yu.edu/bgmut/summary.htm
![Page 6: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/6.jpg)
6
Protein electroporesis
• Changes in mass/charge ratio resulting from amino acid substitutions in proteins can be detected
• In humans, about 30% of all loci show polymorphism with a 6% chance of a pair of randomly drawn alleles at a locus being different
+++
--- - --
++--- - --- - +
Starch or agar gel
Direction of travel
Lewontin and Hubby (1966)
Harris(1966)
![Page 7: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/7.jpg)
7
The rise of DNA sequence analysis
• RFLPs– Cann et al 1987
• Sequencing of small regions– Vigilant et al 1991
• Whole genome sequencing– Ingman et al 2000
![Page 8: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/8.jpg)
8
The human genomes…
• The draft human genome sequence was published in 2001– This is a mosaic from several individuals
• Since then, several more genomes have been sequenced, at least partially– Shotgun sequencing variation discovery
• Other methods have been developed to look for gross chromosomal differences
Nimblegen array CGH
![Page 9: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/9.jpg)
9
The International HapMap Project
• Launched in 2002 with the goal of characterising single nucleotide variation between 540 human genomes from individuals of European, Nigerian, Chinese and Japanese ancestry
• Not a sequencing project, rather it types known polymorphisms
• Has currently assembled information on over 6 million SNPs (single nucleotide polymorphisms)
![Page 10: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/10.jpg)
10
The 1000 Genomes Project
![Page 11: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/11.jpg)
11
How do we differ? – Let me count the ways
• Single nucleotide polymorphisms– 1 every few hundred bp
• Short indels (=insertion/deletion)– 1 every few kb
• Microsatellite (STR) repeat number– 1 every few kb
• Minisatellites– 1 every few kb
• Repeated genes– rRNA, histones
• Large inversions, deletions– Y chromosome, Copy Number Variants (CNVs)
TGCATTGCGTAGGCTGCATTCCGTAGGC
TGCATT---TAGGCTGCATTCCGTAGGC
TGCTCATCATCATCAGCTGCTCATCA------GC
≤100bp
1-5kb
![Page 12: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/12.jpg)
12
Y chromosome variation
• Non-pathological rearrangements of the AZFc region on the Y chromosome
Tyler-Smith and McVean (2003)
![Page 13: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/13.jpg)
13
Mutation is the ultimate source of variation
• New mutations occur in the germ-line
• Point mutations at about 2x10-8 per nucleotide per generation– You pass on about 60 new mutations to your children, of which perhaps 1
changes the protein sequence encoded by a gene
• Microsatellite mutations can occur much faster– Up to 10-4 per generation– Some, e.g. in Huntington’s disease, have important consequences
• Minisatellites can mutate at rates of up to 10-1 per generation– The uniqueness of these patterns gives rise to DNA fingerprinting
• Most of the differences between genomes are the result of inheriting mutations from our ancestors
![Page 14: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/14.jpg)
14
Our genomesInherited mutations
Our genealogical tree
Mutations in our ancestors
![Page 15: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/15.jpg)
15
Different, but not that different
• Humans are one of the least diverse organisms (excepting cheetahs)
Species Diversity (percent)
Humans 0.08 - 0.1
Chimpanzees 0.12 - 0.17
Drosophila simulans 2
E. coli 5
HIV1 30
Photos from UN photo gallery www.un.org/av/photo
![Page 16: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/16.jpg)
16
An aside on the genetics of race
• It is sometimes claimed that there is a ‘genetic basis to race’
• What is true is that groups of individuals from different parts of the world tend to have similar genomes because they share recent ancestry
• But there are very few ‘fixed’ genetic differences between populations (I can think of one example – the FY gene)
• The differences between populations are in terms of the combinations of variants,
Rosenberg et al (2002)
![Page 17: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/17.jpg)
17
How is genetic variation distributed within and between genomes?
![Page 18: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/18.jpg)
18
Diversity is not evenly distributed across the genome I
Genome Average pairwise differences / kb
Relative copy number ()
Autosomes 0.5 – 0.85 1
X chromosome 0.47 3/4
Y chromosome 0.15 1/4
mtDNA 2.8 1/4
TISMWG (2001) , Jobling et al (2004)
• Autosomes, sex chromosomes and mtDNA have systematically different levels of diversity
• This reflects differences in the number of chromosomes and the mutation rate
![Page 19: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/19.jpg)
19
Diversity is not evenly distributed across the genome II
TISMWG (2001)
Chromosome 6
HLA
• There are fluctuations in the level of variation across the genome
![Page 20: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/20.jpg)
20
Diversity is not evenly distributed across genes I
• Purifying selection eliminates deleterious mutations and reduces diversity in regions of strong functional constraint
0123456789
Intergenic Intronic Exonic UTR
SN
Ps
pe
r 1
0k
b
Zhao et al (2003)
![Page 21: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/21.jpg)
21
Diversity is not evenly distributed across genes II
• Adaptive evolution ‘wipes out’ diversity nearby due to the hitch-hiking effects of a selective sweep
– e.g. Duffy-null locus in sub-Saharn africa, protects against P. vivax
Pop1
Pop2
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0C 0 0 0 T 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 00 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 T 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 G 0 0 -1 -1 C C 0 0 0 0 0 0 00 0 0 0 0 0 0 0 0 G 0 0 -1 -1 C C 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 G 0 0 -1 -1 C C 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 C 0 0 0 0 00 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 00 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 C 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 00 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
C 0 0 0 T 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0C 0 0 0 T 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 00 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 G 0 0 -1 -1 C C 0 0 0 0 0 0 00 0 0 0 0 0 0 0 0 G 0 0 -1 -1 C C 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 G 0 0 -1 -1 C C 0 0 0 0 0 0 00 0 0 0 0 0 0 0 0 G 0 0 -1 -1 C C 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 G 0 0 -1 -1 C C 0 T 0 0 0 0 0
0 0 0 0 0 0 0 0 0 G 0 0 -1 -1 C C 0 T 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 00 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 00 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 00 0 0 0 0 0 0 0 0 G 0 0 -1 -1 C C 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 G 0 0 -1 -1 C C 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 00 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 00 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 00 0 0 0 0 0 0 0 T 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 00 0 G 0 0 0 0 0 0 0 0 0 0 0 C 0 0 0 0 0 0 0 0
0 G 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 G 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T 0 G 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T 0 G 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T 0 G 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T 0 G 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T 0 G 00 0 0 T 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T 0 G 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T 0 G 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T 0 G 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T 0 G 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T 0 G 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T 0 0 0 0 G 0
C 0 0 T 0 0 0 0 0 0 0 0 0 0 0 0 T 0 0 0 0 G 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T 0 0 0 0 G 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T 0 0 0 0 0 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T 0 0 0 0 0 0
0 0 0 T 0 0 0 0 0 0 0 0 0 0 0 0 T 0 0 0 0 0 0
0 0 0 T 0 0 0 0 0 0 0 0 0 0 0 0 T 0 0 0 0 0 00 0 0 T 0 0 0 0 0 0 0 0 0 0 0 0 T 0 0 0 0 0 A
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T 0 0 0 0 0 A0 0 0 T 0 0 0 0 0 0 0 0 0 0 0 0 T 0 0 0 0 0 A
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T 0 0 0 0 0 AC 0 0 0 T 0 -1 0 0 0 T 0 0 0 0 0 T 0 0 0 0 0 0
C 0 0 0 T 0 -1 0 0 0 T 0 0 0 0 0 T 0 0 0 0 0 0
C 0 0 0 T 0 -1 0 0 0 T 0 0 0 0 0 T 0 0 0 0 0 0C 0 0 0 T 0 -1 0 0 0 T 0 0 0 0 0 T 0 0 0 0 0 0
C 0 0 0 T 0 -1 0 0 0 T 0 0 0 0 0 T 0 0 0 0 0 0C 0 0 0 T 0 -1 0 0 0 T 0 0 0 0 0 T 0 0 0 0 0 0
C 0 0 0 T 0 -1 0 0 0 T 0 0 0 0 0 T 0 0 0 0 0 0
C 0 0 0 T T -1 G 0 0 T T 0 0 0 C 0 0 0 0 0 0 0C 0 0 0 T T -1 G 0 0 T T 0 0 0 C 0 0 0 0 0 0 0
C 0 0 0 T T -1 G 0 0 T T 0 0 0 C 0 0 0 0 0 0 00 0 0 0 0 0 -1 0 0 0 0 0 0 0 0 C 0 0 0 0 G 0 0
0 0 0 0 0 0 -1 0 0 0 0 0 0 0 0 C 0 0 0 0 G 0 0
European
African
FY*O mutation
Ancestral alleleDerived alleleMissing dataHamblin and Di Rienzo (2000)
![Page 22: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/22.jpg)
22
Diversity is not evenly distributed across genes III
• Some genes are under balancing or diversifying selection, where diversity is actively selected for
– MHC complex: heterozygote advantage and frequency-dependent selection driven by recognition of pathogens
Horton et al (1998)
![Page 23: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/23.jpg)
23
Diversity is not evenly distributed across populations I
• African populations are more diverse than non-African populations– More polymorphisms– Polymorphisms at less skewed frequencies
• Differences reflect bottlenecks associated with the colonisation from Africa c.65 KYA
Population Segregating sites per kb (n = 30)
Diversity per kb
Tajima D statistic
Hausa (African)
4.8 0.11 -0.33
Italian 3.2 0.10 1.18
Chinese 3.0 0.07 1.19
Frisse et al (2001)
![Page 24: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/24.jpg)
24
mtDNA phylogeography
Ingman et al (2000)
African
Non-African
![Page 25: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/25.jpg)
25
The colonisation process as inferred from mtDNA variation
![Page 26: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/26.jpg)
26
What does genetic variation tell us about human evolution?
• Modern humans appear in the fossil record about 200K years ago
• The mitochondrial Eve dates back to about 150K years ago
• The Y-chromosome Adam dates back to about 70K years ago
• For most of our genome, however, the common ancestor is about 500K – 1M years ago
– This predates the origin of Homo sapiens considerably
![Page 27: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/27.jpg)
27
Human – chimp split
Autosomal MRCA
Origin of H. sapiens
![Page 28: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/28.jpg)
28
Did early humans interbreed with Neanderthals?
Ovchinnikov et al (2000)
Neanderthals
mtDNA sequences say no…
![Page 29: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/29.jpg)
29
But…
• There is some evidence for this in the presence of unusual haplotypes found in Europe composed of SNPs not found in non-European populations
Plagnol and Wall (2006)
![Page 30: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/30.jpg)
30
Deeper trees in the human genome
• There is growing evidence that some regions of our genome have truly ancient common ancestors
• Dystrophin has an ancient haplotype found primarily outside Africa suggesting a colonisation of >160KYA
• There is an inversion found primarily in Europeans that is roughly 3MY old
Stefansson et al (2005)
Haplotype 1
Haplotype 2
![Page 31: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/31.jpg)
31
What are the genetic differences that make us human?
![Page 32: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/32.jpg)
32
Chromosomal changes
• Human chromosome 2 is a fusion of two chromosomes in great apes
• There are several inversion differences between the chromosomes
Feuk et al (2005)
![Page 33: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/33.jpg)
33
Gene loss
• Loss of enzymes that make sialic acid
– Sugar on cell surface that mediates a variety of recognition events involving pathogenic microbes and toxins
• Myosin heavy chain– Associated with
gracilization
Wang et al (2006)
![Page 34: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/34.jpg)
34
Gene evolution
• FOXP2 is a highly conserved gene (across the mammalia), expressed in the brain. Mutations in the gene in humans are associated with specific language impairment
• Across the entire mammalian phylogeny, there have only been a very few amino acid changing substitutions
• However, two amino acid changes have become fixed in the lineage leading to modern humans since the split with the chimpanzee lineage
Enard et al. (2002)
![Page 35: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/35.jpg)
35
What are the genetic differences that make people and peoples different?
![Page 36: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/36.jpg)
36
Detecting recent adaptive evolution
• Let’s look closely at the dynamics of the fixation process for adaptive mutations
• The fixation of a beneficial mutation is associated with a change in the patterns of linked neutral genetic variation
• This is known as the hitch-hiking effect (Maynard Smith and Haigh 1974)
• Looking for the signature of hitch-hiking can be a good way of detecting very recent fixation events
![Page 37: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/37.jpg)
37
Long haplotypes
• A selective sweep at the Lactase gene in Europeans
![Page 38: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/38.jpg)
38
Strong population differentiation
Lamason et al (Science 2005)
• SLC24A5
![Page 39: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/39.jpg)
39
![Page 40: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/40.jpg)
40
Classes of selected genes
Voight et al. (2005)
![Page 41: 1 Population Genomics Gil McVean, Department of Statistics, Oxford](https://reader035.vdocuments.mx/reader035/viewer/2022062519/56649d265503460f949fd216/html5/thumbnails/41.jpg)
41
Reading
• Human genetic variation– Rosenberg et al. Genetic structure of human populations. Science 2002, 298:2381-2385.– Conrad et al. A worldwide survey of haplotype variation and linkage disequilibrium in the
human genome. Nature Genet. 2006, 1251-1260.– McVean et al. Perspectives on human genetic variation from the International HapMap
Project. PLoS Genetics 2005, 1:e54.
• The origin of modern humans– Reed & Tishkoff. African human diversity, origins and migrations. Curr Opin Genet Dev. 2006
16:597-605.– Jobling et al. Human evolutionary genetics: origins, peoples, and disease. Garland Science,
2004.– Harding & McVean. A structured ancestral population for the evolution of modern humans.
Curr. Op. Genet. Dev. 2004, 14: 667-674.
• Natural selection– Lamason et al. SLC24A5, a putative cation exchanger, affects pigmentation in zebrafish and
humans. Science 2005, 310:1782-1786.– Sabeti et al. Positive natural selection in the human lineage. Science 2006, 312:1614-1620. – Tishkoff et al. Convergent adaptation of human lactase persistence in Africa and Europe. Nat
Genet. 2007 39:31-40