1 drew endy stanford bioengineering the biobricks foundation the presidential commission for the...
TRANSCRIPT
1
Drew EndyStanford BioengineeringThe BioBricks Foundation
The Presidential Commission for the Study of Bioethical IssuesWashington DC8 July 2010
Overview and Context of the Technology of Synthethic Biology
2
Mice from dirty rags & wheat bran
Life has not now been created from inanimate matter.
33
Synthetic genomes are a BTD (Big Technical Deal)
Natural living systems,Direct generational descent, Replication with error,Natural selection.
Synthetic living systems,“Decoupled” promulgation over time, Replication with representation,Fashioned selections.
44
Big stresses can arise when material and information become interconvertible.- Changes in business and distribution models
(ongoing transitions from CDs & DVDs, to MP3s & Internet TV)- Challenges to safety & security frameworks (from control of material, to control of information)- Avoidance of nation state and cultural relations (border controls for DNA sequences on the internet, really?)- Increases in scale and pace (overloading of current practices)
5
TAATACGACTCACTATAGGGAGA
DNA Construction = #1 Tech. of 21st Ctry.From
absract information to physical, living DNA designs.
2004: 10,000 bp2010: 1,000,000 bp2016: 100 million?
6
~99% Genetic Engineering:<20 kb DNA, ~1 dozen DNA components
Genome Synthesis:>8 mb DNA, ~1000+ DNA components?!
~4 meter gap
400-fold “biointegration gap,” today.
(We are relatively bad at putting the molecules of biology back together in useful ways)
7
if {growing} call wintergreen()else call bananas()
Beyond synthetic genomes: We’ll need languages & grammars for writing DNA
poetry
8
To Have the Chance of Being Ethical,We Must Lead Future Biotech. Tool
RevolutionsDNA Sequencing
Read Out the Genetic Code
Recombinant DNA
Basic “Cut” & “Paste”
Polymerase Chain Reaction
Amplify & Make Simple Changes
First Gen.
Biotech=
...
Next Gen.
BiotechAddsNew Tools
=
9
- We often learn best by tinkering. Today, most of biology remains unknown; we stand to learn more than ever before via a synthetic approach.
The Technical Ethics of Synthetic Biology
- Freedom of the (DNA) press. There are now no sustained public investments in getting better at building DNA; leverage over the presses can lead to control of content (i.e., what is written).
- Preparedness and reconciliation. More accidents will happen; more misuses will occur; nature is not a liberal representative democracy; how do we make such truths not intolerable?
- Institutions & individuals; hackers are community. The tools of synthetic biology make biotechnology, today’s *most* compelling technology, available to many. Do we enable or ostracize a future world of “Do-It-Together” biotechnology? Let’s not overlook many basics (e.g., property rights).