1 characterization of microevolution events in...

1

Characterization of microevolution events in Mycobacterium tuberculosis strains 1

involved in recent transmission clusters 2

3

4

5

6

7

Laura Pérez-Lago1,2

, Marta Herranz1,2,3

, Miguel Martínez Lirola3, †

, Emilio 8

Bouza1,2,3

, Darío García de Viedma1,2,3

9

10

11

12

13

1Servicio de Microbiología y Enfermedades Infecciosas, Hospital Gregorio Marañón, Madrid, 14

Spain 15

2Instituto de Investigación Biomédica Gregorio Marañón, Madrid, Spain 16

17 3CIBER Enfermedades Respiratorias-CIBERES, Spain 18

4Complejo Hospitalario Torrecárdenas, Almería, Spain.

†On behalf of the INDAL-TB 19

group 20

21

22

23

24

*Corresponding author: 25

Servicio de Microbiología y Enfermedades Infecciosas 26

Hospital General Universitario Gregorio Marañón 27

C/ Dr Esquerdo, 46 28

28007 Madrid, Spain 29

Fax: 91 5044906 30

Email: [email protected] 31

32

33

Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.01285-11 JCM Accepts, published online ahead of print on 21 September 2011

on July 28, 2018 by guesthttp://jcm

.asm.org/

Dow

nloaded from

http://jcm.asm.org/

2

Summary 34

35

In certain circumstances, it is possible to identify clonal variants of 36

Mycobacterium tuberculosis (MTB) infecting a single patient, probably as a result of 37

subtle genetic rearrangements in part of the bacillary population. We systematically 38

searched for these microevolution events in a different context, namely, recent 39

transmission chains. We studied the clustered cases identified using a population-based 40

universal molecular epidemiology strategy over a 5-year period. Clonal variants of the 41

reference strain defining the cluster were found in 9 (12%) out of the 74 clusters 42

identified after genotyping 612 MTB isolates by IS6110 RFLP and MIRU-VNTR. 43

Clusters with microevolution events were epidemiologically supported and involved 4-9 44

cases diagnosed over a 1 to 5–year period. The IS6110 insertion sites from 16 45

representative isolates of reference and microevolved variants were mapped by ligation-46

mediated PCR in order to characterize the genetic background involved in the 47

microevolution. Both intragenic and intergenic IS6110 locations resulted from these 48

microevolution events. Among those cases of IS6110 locations in intergenic regions, 49

which could have an effect on the regulation of adjacent genes, we identified 50

overexpression of cytochrome P450 in 1 microevolved variant using quantitative real-51

time RT-PCR. Our results help to define the frequency with which microevolution can 52

be expected in MTB transmission chains. They provide a snapshot of the genetic 53

background of these subtle rearrangements and identify an event in which IS6110-54

mediated microevolution on an isogenic background has functional consequences. 55

56

57

58


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

3

Introduction 59

60

Mycobacterium tuberculosis (MTB) is characterized by high genetic 61

homogeneity (99.9% similarity at the nucleotide level) (40). Different mechanisms are 62

involved in the acquisition of variability in MTB and include single-nucleotide 63

polymorphisms, insertions, deletions, genomic rearrangements, and transpositions (23). 64

One of the mobile genetic elements involved in transposition events, the insertion 65

sequence IS6110 (22, 42) , is considered a key mechanism in the evolution of MTB. 66

IS6110 transposition events are not only responsible for the specific genomic 67

changes directly caused by insertion sequence mobility. Extensive chromosomal 68

rearrangements involving large deletions by IS6110-mediated homologous 69

recombination have also been described (10), and their entry can modify the expression 70

profiles of adjacent genes (32). 71

IS6110 has been used extensively as a genotypic marker in epidemiological 72

studies. Application of MTB fingerprinting based on IS6110 restriction fragment length 73

polymorphism (RFLP) has allowed us to refine identification of recent transmission 74

events. The MTB isolates of cases involved in a recent transmission chain generally 75

have identical fingerprints and thus constitute a cluster. However, it is also possible to 76

find one or several cases sharing genotyping patterns that are highly similar, but not 77

identical, to the pattern defining the cluster (7, 17, 45). 78

The existence of clonal variants in tuberculosis has been described in recurrent 79

episodes (19), in MTB isolates from a single episode, (4, 8, 11, 37, 38) , and in the 80

respiratory and extrarespiratory isolates of a single case (12). The presence of these 81

variants indicates a certain degree of genetic plasticity in MTB. Similarly, subtle 82

variations among the isolates involved in recent transmission chains could be the result 83


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

4

of microevolution events selected by the sequential infection of independent hosts in a 84

transmission chain. 85

We describe the frequency of microevolution events in the recent transmission 86

chains of a population-based universal molecular epidemiology survey. We characterize 87

these events in detail in order to understand the genetic background involved in 88

microevolution and its potential functional significance. 89


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

5

Material and Methods 90

91

Sample 92

93

Microevolution events were analyzed in a population sample (N: 612) that was 94

analyzed in the context of a universal-genotyping (applying IS6110-RFLP and MIRU-95

VNTR) molecular epidemiology survey between 2003 and 2008 in Almeria 96

(southeastern Spain, population 699,560)(20). The incidence of tuberculosis in this area 97

was 22.9 cases per 100,000 inhabitants, the highest in its Autonomous Community 98

(Andalusia) and one of the highest in Spain. 99

100

Genotyping Methods 101

102

IS6110-based RFLP typing 103

All the isolates were analyzed using IS6110 RFLP following international 104

standardization guidelines (43). RFLPtypes were used to establish identities/differences 105

only when they had more than 6 IS6110 copies. Phylogenetic analysis of the patterns 106

was performed with Bionumerics 4.6 (Applied Maths, Sint-Martens Laten, Belgium) 107

108

Mycobacterial interspersed repetitive units–variable-number tandem 109

repeat (MIRU-VNTR) typing 110

MIRU-VNTR with the 15-loci set (MIRU-15) (41) was applied for the isolates 111

clustered by IS6110-RFLP. 112

113

114


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

6

115

116

Selection of clusters for analysis of microevolution 117

118

We selected clusters in which identical RFLPtypes and genotypic variants with 119

similar genotypes were observed. We studied those clusters including 4 or more cases in 120

which at least 2 isolates were identical by RFLP and MIRU (reference strain). The 121

genotypic variants (variant strain) within the cluster had to display differences in less 122

than 2 IS6110 bands and share MIRUtypes (or display single locus variants) with the 123

reference strain. Variants differing in 3 IS6110 bands were also considered, although 124

only when they shared identical MIRUtypes with the reference strain. 125

126

Ligation-mediated polymerase chain reaction (LM-PCR) 127

128

The protocol used is that described in Prod’hom et al. (29), with some 129

modifications. Briefly, DNA was digested with restriction enzyme SalI (Roche 130

Diagnostics GmbH, Penzberg, Germany) and ligated with adapter Saldg/Salpt by 131

incubation with T4 DNA ligase (New England Biolabs, Ipswich, Massachusetts, USA) 132

at 16°C overnight. PCR was performed using the primers ISA1 and ISA3 (25) and the 133

linker primer Saldg. Amplification was achieved using 35 PCR cycles (95ºC for 45 s, 134

65ºC for 45 s, and 72ºC for 8 min). The DNA polymerase used was AmpliTaq Gold 135

(Applied Biosystems, Foster City, California, USA). We performed LM-PCR using the 136

restriction enzyme XmaI (New England Biolabs), and XRxma24 137

(5´AGCACTCTCCAGCCTCTCAACGAC3´)/rxma12(5´CCGGGTCGTTGA3´) was 138

used as an adapter (del Portillo, unpublished). Amplified products were separated by 139


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

7

electrophoresis in a 1.8% agarose gel and purified using GFX PCR DNA and the Gel 140

Band Purification Kit (GE Healthcare, Buckinghamshire, UK). The purified fragments 141

were sequenced using the ISA1 and ISA3 primers in a 3130xl Genetic Analyzer 142

(Applied Biosystems, Carlsbad, California, USA). The IS6110 insertion sites were 143

mapped taking as a reference the homology of the LM-PCR product sequences with the 144

H37Rv sequence genome in the TB Database (http://www.tbdb.org) (31). Once the 145

insertion sites were identified in clusters C and D, we confirmed the IS6110 location by 146

amplification with specific primers (designed to anneal within IS6110 and its adjacent 147

region) and subsequent sequencing. 148

In addition to mapping the IS6110 bands responsible for the differences between 149

the reference and variant strains within each cluster, additional bands (5-8) among those 150

shared by the reference strain and variant strain within each microevolved cluster were 151

mapped to confirm the certainty of clustering by identifying identical insertion sites. 152

153

Real-time RT-PCR 154

Isolation of RNA 155

MTB cultures were grown to the stationary phase (determined by CFUs plated 156

on Middlebrook 7H11 plates) in mycobacterial-growth-indicator-tube liquid media at 157

37ºC (Becton Dickinson, Sparks, Maryland, USA). The cultures were pelleted by 158

centrifugation (5 min, 14,000 rpm, 4ºC) and resuspended in guanidinium

thiocyanate 159

5M. Cells were disrupted using TRIzol reagent (Invitrogen, Carlsbad, California, USA) 160

and Fastprep (5 sec/6.5 w FP120 Bio 101 Savant, Vista, California, USA). Cell lysates 161

were recovered by centrifugation (10 min, 7500 g, 4ºC) and deproteinized using 162

chloroform. RNA was purified using an RNeasy total RNA kit (Qiagen GmbH, Hilden, 163

Germany) according to the manufacturer's instructions. DNase treatment was performed 164


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

8

on-column. RNA underwent a second round of DNase treatment (Qiagen) for 15 min at 165

20°C and the samples were eluted in 40 µl of RNase-free water. 166

167

168

qRT-PCR 169

Quantitative reverse transcription-PCR was performed following a 1-step 170

method using the LightCycler RNA Master SYBR Green I kit (Roche). qRT-PCR 171

conditions were as follows: reverse transcription of template RNA (61ºC for 20 min), 172

denaturation of cDNA/RNA hybrid (95°C for 30 seconds), followed by 45 cycles of 173

95°C for 10 sec, 54°C for 10 sec, and 72ºC for 15 seconds. The specific primers for the 174

target genes used for RT-PCR were as follows: CYT F (Rv3121), 5´GGT TTA ATC 175

CGG CAA CTG AA 3´; CYT R (Rv3121), 5´TCG GAT TAC GTT CGA CAT CA 3´; 176

HP F (Rv3188), 5´CTG CTC TCG GAT TCG CTT AC 3´; and HP R (Rv3188), 5´GTA 177

GGC GCC GTC GAT AAA T 3´. The specificity of the PCR product was ensured by 178

post-PCR melting curve analysis and running the amplification product on a gel. 179

qRT-PCR assays from each strain were performed on 2 independent cultures and 180

the expression of the target genes was measured in 5 independent measurements. The 181

calculated threshold cycle (Ct) value for the target genes was normalized with respect to 182

the Ct value for 16S rRNA (14). 183

184


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

9

Results 185

186

Identification and description of microevolution events 187

188

Our first objective was to measure the frequency of microevolution in a 189

universal genotyping scheme from a population sample and describe the general 190

features of the clusters that underwent these genotypic changes. 191

Of the 612 MTB isolates genotyped during the study period, 231 (37.7%) were 192

grouped in 74 clusters (2-9 members), as defined by IS6110-RFLP. Microevolution 193

events were identified in 9 clusters (12%), which involved 4-9 cases occurring over a 1 194

to 5–year period (Table 1 and Figure 1). The number of IS6110 copies for the clusters 195

with or without microevolution was not markedly different (9-17, median: 12; 7-15, 196

median 10, respectively). Proved or probable epidemiological links were found in all 197

the clusters with microevolution for which detailed epidemiological information was 198

available (Figure 1). In 3 clusters (B, E, and G), 2 variants were considered in addition 199

to the reference strain; for the remaining 6 clusters, only 1 clonal variant was found. 200

Among the 12 clonal variants identified by RFLP, differences in the MIRUtypes 201

involving a single locus were also found in 2 cases (Figure 1). Additionally, MIRU 202

analysis split the reference pattern of 4 clusters in 2 MIRUtypes differing in a single 203

locus. Three clusters involved only Spanish cases, 1 cluster Moroccan cases, and the 204

remaining clusters were multinational (Figure 1). In 4 of the microevolved clusters, a 205

delay in administering therapy was recorded for some of the cases. All the isolates were 206

susceptible to INH and RIF, except one representative of the reference strain in cluster 207

H which was INH-resistant. 208

209


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

10

210

211

Genotypic characterization of the microevolution phenomena 212

213

Our second objective was to map the IS6110 insertion sites responsible for the 214

differences between RFLP patterns in the clonal variants selected in order to identify the 215

genetic background involved in the microevolution events. The analysis could not be 216

performed in 2 of the 9 clusters (clusters A and E; Figure 1) due to lack of viability in 217

some of the isolates. IS6110 insertion sites were mapped in the 16 representative 218

isolates of the reference strain and variants observed in the analyzed clusters (Figure 1). 219

The results for IS6110 mapping of the differential IS6110 bands are compiled in 220

Figure 2. Of the IS6110 bands differing with respect to the RFLP pattern defining the 221

cluster, 3 were intragenic and interrupted coding regions and the remaining 9, which led 222

to differential RFLP hybridization bands, mapped in intergenic regions that were 223

potentially involved in the regulation of the downstream genes (Figure 2). In the 224

intergenic regions, the promoter from IS6110 was oriented with the adjacent gene (ie, 225

potential up-regulation) in 5 cases (68-422 nucleotides before), whereas in the 226

remaining 4 it was oriented in the opposite direction (at 39-404 nucleotides) (ie, 227

potential down-regulation) (Figure 2). All 45 analyzed controls shared IS6110 bands 228

that mapped in identical coordinates for the reference and variant strains. 229

230

Analysis of the effect of the insertion sequence IS6110 on the regulation of transcription 231

of downstream genes 232

Five IS6110 locations (Figure 2) involved in microevolution events mapped in 233

potential regulatory regions which were located at a distance and orientation that were 234


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

11

compatible with up-regulation of the downstream genes by the promoter included in 235

IS6110 (32). Our final objective was to document whether this potential regulation 236

could occur. Therefore, we selected 2 clusters (C and D) as representatives of those in 237

which the entry of IS6110 into the microevolved variant was duly oriented and at a 238

suitable distance from the downstream genes. 239

Relative quantification assays were performed based on real-time RT-PCR with 240

the isolate that was representative of each of the 2 clusters selected and its 241

corresponding variants targeting the expression of the corresponding genes located 242

downstream and coding for CYP141 (Rv3121) in cluster C and for a hypothetical 243

protein (Rv3188) in cluster D. A Wilcoxon–Mann-Whitney test was used to assess 244

differences in the expression of the studied genes. No differences were found in Rv3188 245

expression between the reference and variant strains. However, for Rv3121 (CYP141), 246

higher expression levels (a 5.6-fold difference) were recorded when the median 247

expression values measured for the variant were compared with the reference strain 248

(p<0.05; Figure 3). 249

250

251

252

253

254


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

12

Discussion 255

256

Several studies have found exceptions to the assumption that infection by MTB 257

involves a genetically homogeneous population of bacilli. The extensive application of 258

IS6110-RFLP as a genotyping tool has revealed the existence of clonal variants from a 259

common ancestor resulting from microevolution phenomena within individuals (1, 6, 260

12, 13, 34, 37) . RFLP-defined clonal variants have also appeared in transmission 261

chains or in outbreaks involving susceptible or resistant strains (2, 13, 26, 28, 36, 45). 262

The existence of microevolution from an initial strain due to sequential host-to-host 263

infection led to the proposal that, if only identical genotypes are considered to define 264

clusters, the percentage of recent transmission in a population is underestimated, 265

because epidemiological links are also found between cases infected by strains with 266

RFLP patterns showing a certain degree of variation (7, 17, 45). 267

Most publications on microevolution in tuberculosis are case reports, except for 268

the few systematic studies based on population samples (7, 8, 21, 37). Consequently, it 269

is difficult to appreciate the true dimension of microevolution. The primary objective of 270

our study was to screen microevolution phenomena at the population level. We found 271

that 12% of the clusters grouping identical patterns in a 5-year universal genotyping-272

based molecular epidemiology survey in southeastern Spain (20) also grouped some 273

clonal variants, indicating that this is not an anecdotal phenomenon. We decided to 274

define clonal variants according to differences in the RFLP patterns, although variants 275

can also involve diverse genetic targets applied for epidemiological purposes other than 276

IS6110, such as MIRU sites or the spacers at the DR region, thus increasing the rate at 277

which clonal variants could be found in transmission chains. In our clusters showing 278

RFLP variants, differences were also observed at individual MIRU loci. Clonal variants 279


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

13

with simultaneous variation in RFLP and MIRU have been identified elsewhere (1, 15, 280

37). Among the clusters considered representative of microevolution, we found 281

differences in 1-3 RFLP bands. Variations in up to 4 IS6110 bands between 282

epidemiologically linked cases have been found in other studies (13). We found 283

epidemiological links between patients in all but one of the selected microevolved 284

clusters. The number of IS6110 bands in the shared patterns was >8 and mapping of a 285

high number of shared IS6110 bands between the reference strain and the variants 286

reinforced the observation that co-migrating IS6110 bands corresponded to identical 287

insertion sites, thus supporting the genotypic relationship between them and the 288

existence of a transmitted common ancestor undergoing genotypic changes through 289

microevolution phenomena. 290

The appearance of clonal variants in MTB can be facilitated by a series of 291

factors. The existence of a long delay between infection and diagnosis of TB enables the 292

infecting bacterial population to increase in size and provides sufficient time for 293

microevolution (1). Furthermore, the longer the transmission chain or the higher the 294

number of clustered cases, the higher the possibility of finding clonal variants as a result 295

of the length of time to microevolution, the sequential adaptation to multiple 296

independent hosts, or both. In our study, microevolution leading to clonal variants was 297

not restricted to these scenarios, but was detected in different types of clusters, 298

including the lowest number of cases (4 cases), in clusters from 1 to 5 years long, and in 299

clusters involving Spanish-born patients, clusters involving single-nationality immigrant 300

cases, and in multinational clusters. Moreover, in most of the patients involved in 301

microevolved clusters, diagnostic delay was rare, and in the few cases where it occurred 302

it was too short (less than 3 months), thus making it an unlikely explanation for the 303


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

14

variations observed. Taken together, our data suggest that microevolution may not be 304

restricted to specific clinical/epidemiological circumstances. 305

Apart from the usefulness of targeting IS6110 bands to identify microevolution, 306

we must remember that modifications in IS6110 insertion sites can have genetic 307

consequences. IS6110 can directly disrupt genes when it is located intragenically and its 308

entry can modulate expression of adjacent genes when it enters intergenic regions (23, 309

33).. 310

The systematic application of LM-PCR allowed us not only to confirm the 311

clonal relatedness of the isolates involved in the microevolved clusters, but also to know 312

the genetic background involved in the IS6110-mediated microevolution events 313

observed in transmission chains. Unlike other studies analyzing the role of IS6110 314

sequences in specific strains by comparing with fully unrelated control strains, ours was 315

a unique opportunity to evaluate the relevance of specific IS6110 insertions in an 316

isogenic background (ie, one shared by the reference strain and variant strain). In this 317

context, the identification of a new microevolved variant strain by a new IS6110-318

transposition event in the reference strain suggests that the entry of IS6110 is 319

advantageous. The IS6110 mobilization event is expected to occur initially in a single 320

bacterium and, if we can detect it in the transmission chain, it may indicate that the 321

variant strain has been positively selected in the host case to enrich its 322

representativeness and to enable its transmission. 323

We observed both intragenic and intergenic locations for the IS6110 sequences 324

involved in microevolution events. The genes disrupted by the intragenic entry of 325

IS6110 in our study were previously found to be interrupted in other analyzed strains 326

(35) and, as generally occurs with intragenic entry of IS6110, corresponded to 327

redundant genes; therefore, the loss of gene expression does not become deleterious for 328


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

15

the strain, although we cannot rule out some effect due to this IS6110-mediated 329

inactivation. In other cases, mobilization of IS6110 into intragenic regions could have 330

an effect other than inactivation, and it is also possible to find a functional phenotype 331

associated with a single IS6110-disrupted copy of a redundant gene. This could be the 332

case, for example, of the microevolution event involving an IS6110 insertion in a PPE 333

gene, which could disrupt antigenic determinants in an attempt to evade the immune 334

response (23), as suggested by the frequent finding of IS6110 insertions in the PE/PPE 335

gene family described for clinical isolates (46). 336

The majority of IS6110 locations involved in microevolution mapped in 337

intergenic regions as has been found previously in clinical isolates (46). Unlike 338

intragenic locations of IS6110, which systematically disrupt the genes involved, entry 339

into intergenic regions could lead to a variety of effects, by either direct impairment of 340

existing promoters or by driving expression using a promoter included in IS6110 itself 341

(3, 5, 32, 39),. The distances between IS6110 and the adjacent genes in our study were 342

variable, but within the range for modulation of expression. The regions involved in the 343

regulation of transcription of a specific gene are rather extensive and include not only 344

the promoter itself, but also distanced regions with a role in secondary structure 345

regulatory interactions or binding of transcription factors. 346

In our analysis, 3 cases in which transposition of IS6110 could modulate 347

adjacent gene expression involved hypothetical proteins (Rv3188, Rv1762, and 348

Rv1504) with an unknown role. However, in some of the remaining cases, IS6110 was 349

adjacent to genes encoding proteins with well known functions, as follows: i) esxK 350

(early secreted antigenic target), which belongs to the ESAT-6 family of proteins, a 351

group of immunodominant MTB antigens that are relevant in virulence (16, 30); ii) 352

dnaA-dnaN intergenic region, which includes the oriC locus, a preferential site for 353


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

16

IS6110 insertion (18) that is downregulated in hypoxia (9); iii) PPE29, a member of the 354

PPE/PE protein family, whose expression is controlled by diverse factors and which 355

induces dynamic antigenic pattern modification depending on host microenvironments 356

(44), thus helping to evade the immune response; and iv) Rv3121, coding for the protein 357

CYP141, one of 20 cytochrome P450 enzymes that exist in the genome of MTB and are 358

physiologically relevant mono-oxygenases involved in catabolic pathways (24) related 359

to viability and virulence, thus making them good candidates as drug targets (27). 360

Expression of the adjacent gene must be measured to clarify the specific effect 361

expected for intergenic entry. In our study, we selected 2 clusters as representative of 362

microevolutions involving entry of IS6110 in intergenic regions according to the 363

orientation of the promoter included in IS6110 (OPIS6110) and the distance between 364

the promoter and the adjacent gene (a hypothetical protein and CYP141). Differences in 365

cytochrome P450 expression were found between the variant and the reference strain, 366

thus indicating that microevolution events can have a functional consequence and are 367

not always meaningless subtle variations. Given the proper proximity and orientation of 368

the OPIS6110 promoter included in the transposable sequence, which is known to be 369

upregulated during the stationary phase in broth culture (32), the entry of IS6110 led to 370

increased expression of the downstream gene (CYP141). 371

We estimated the frequency with which microevolution can be expected in 372

tuberculosis transmission chains at population level and showed that it is not restricted 373

to specific clinical-epidemiological circumstances. The microevolution mediated by 374

IS6110 transposition detected here involves a variety of intragenic and intergenic 375

genetic backgrounds. Functional consequences of the differential location of an IS6110 376

copy on an isogenic background were observed in one of the microevolution events. 377


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

17

Further studies will help us to explore the as yet unrevealed meaning of microevolution 378

in MTB. 379


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

18

Figures 380

381

Figure 1: Clusters including isolates sharing identical RFLPtypes (RS: reference strain) 382

together with clonal variants (V). Numbers in parenthesis indicate the number of cases. 383

Different RFLP bands between the reference strains and variant strains are indicated by 384

asterisks. Allelic differences between the MIRUtypes of their reference and variant 385

strains are highlighted in bold. 386

Figure 2: Compilation of the IS6110 location sites mapped for the clusters with 387

microevolution. The arrows indicate the direction of the transcription mediated by 388

IS6110. nts: nucleotides 389

Figure 3: Box plot of the distribution of expression ratios for the reference strains and 390

variant strains from cluster C, which lacked or included IS6110, respectively, upstream 391

of Rv3121. 392

393

394


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

19

395

396

Acknowledgements 397

We are grateful to Ainhoa Simón Zárate, who holds a grant from the Fondo de 398

Investigaciones Sanitarias (Línea Instrumental Secuenciación), and Milagros González 399

for their participation in the sequencing analysis. The 3130xl Genetic Analyzer was 400

partially financed by grants from Fondo de Investigaciones Sanitarias (IF01-3624, IF08-401

36173). Laura Pérez holds a Juan de la Cierva contract from Ministerio de Ciencia e 402

Innovación (Ref JCI-2009-05713). This study was partially supported by Fondo de 403

Investigaciones Sanitarias (S09/02205). We are grateful to Beatriz Pérez from the 404

National Epidemiology Center and Jose María Bellón from HGUGM for performing the 405

statistical analysis. We thank Thomas O’Boyle for proofreading the manuscript. 406

407

408

409

410

411

412

413

414

415

416

417

418

419

420

421

422

423

424

425

426

427

428

429

430

431


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

20

References 432

433

434

435

436

437

1. Al-Hajoj, S. A., O. Akkerman, I. Parwati, S. al-Gamdi, Z. Rahim, D. van 438

Soolingen, J. van Ingen, P. Supply, and A. G. van der Zanden. 2010. 439

Microevolution of Mycobacterium tuberculosis in a tuberculosis patient. J Clin 440

Microbiol 48:3813-6. 441

2. Alito, A., N. Morcillo, S. Scipioni, A. Dolmann, M. I. Romano, A. Cataldi, 442

and D. van Soolingen. 1999. The IS6110 restriction fragment length 443

polymorphism in particular multidrug-resistant Mycobacterium tuberculosis 444

strains may evolve too fast for reliable use in outbreak investigation. J Clin 445

Microbiol 37:788-91. 446

3. Alonso, H., J. I. Aguilo, S. Samper, J. A. Caminero, M. I. Campos-Herrero, 447

B. Gicquel, R. Brosch, C. Martin, and I. Otal. 2011. Deciphering the role of 448

IS6110 in a highly transmissible Mycobacterium tuberculosis Beijing strain, 449

GC1237. Tuberculosis (Edinb) 91:117-26. 450

4. Andrade, M. K., S. M. Machado, M. L. Leite, and M. H. Saad. 2009. 451

Phenotypic and genotypic variant of MDR-Mycobacterium tuberculosis multiple 452

isolates in the same tuberculosis episode, Rio de Janeiro, Brazil. Braz J Med 453

Biol Res 42:433-7. 454

5. Beggs, M. L., K. D. Eisenach, and M. D. Cave. 2000. Mapping of IS6110 455

insertion sites in two epidemic strains of Mycobacterium tuberculosis. J Clin 456

Microbiol 38:2923-8. 457

6. Braden, C. R., G. P. Morlock, C. L. Woodley, K. R. Johnson, A. C. 458

Colombel, M. D. Cave, Z. Yang, S. E. Valway, I. M. Onorato, and J. T. 459 Crawford. 2001. Simultaneous infection with multiple strains of 460

Mycobacterium tuberculosis. Clin Infect Dis 33:e42-7. 461

7. Cave, M. D., Z. H. Yang, R. Stefanova, N. Fomukong, K. Ijaz, J. Bates, and 462

K. D. Eisenach. 2005. Epidemiologic import of tuberculosis cases whose 463

isolates have similar but not identical IS6110 restriction fragment length 464

polymorphism patterns. J Clin Microbiol 43:1228-33. 465

8. Cohen, T., D. Wilson, K. Wallengren, E. Y. Samuel, and M. Murray. 2011. 466

Mixed-strain Mycobacterium tuberculosis infections among patients dying in a 467

hospital in KwaZulu-Natal, South Africa. J Clin Microbiol 49:385-8. 468

9. Chauhan, S., and J. S. Tyagi. 2011. Analysis of transcription at the oriC locus 469

in Mycobacterium tuberculosis. Microbiol Res. 470

10. Fang, Z., C. Doig, D. T. Kenna, N. Smittipat, P. Palittapongarnpim, B. 471

Watt, and K. J. Forbes. 1999. IS6110-mediated deletions of wild-type 472

chromosomes of Mycobacterium tuberculosis. J Bacteriol 181:1014-20. 473

11. Garcia de Viedma, D., N. Alonso Rodriguez, S. Andres, M. J. Ruiz Serrano, 474

and E. Bouza. 2005. Characterization of clonal complexity in tuberculosis by 475

mycobacterial interspersed repetitive unit-variable-number tandem repeat 476

typing. J Clin Microbiol 43:5660-4. 477

12. Garcia de Viedma, D., M. Marin, S. Andres, G. Lorenzo, M. J. Ruiz-478

Serrano, and E. Bouza. 2006. Complex clonal features in an mycobacterium 479

tuberculosis infection in a two-year-old child. Pediatr Infect Dis J 25:457-9. 480


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

21

13. Glynn, J. R., M. D. Yates, A. C. Crampin, B. M. Ngwira, F. D. Mwaungulu, 481

G. F. Black, S. D. Chaguluka, D. T. Mwafulirwa, S. Floyd, C. Murphy, F. A. 482 Drobniewski, and P. E. Fine. 2004. DNA fingerprint changes in tuberculosis: 483

reinfection, evolution, or laboratory error? J Infect Dis 190:1158-66. 484

14. Haile, Y., G. Bjune, and H. G. Wiker. 2002. Expression of the mceA, esat-6 485

and hspX genes in Mycobacterium tuberculosis and their responses to aerobic 486

conditions and to restricted oxygen supply. Microbiology 148:3881-6. 487

15. Hawkey, P. M., E. G. Smith, J. T. Evans, P. Monk, G. Bryan, H. H. 488

Mohamed, M. Bardhan, and R. N. Pugh. 2003. Mycobacterial interspersed 489

repetitive unit typing of Mycobacterium tuberculosis compared to IS6110-based 490

restriction fragment length polymorphism analysis for investigation of 491

apparently clustered cases of tuberculosis. J Clin Microbiol 41:3514-20. 492

16. Hsu, T., S. M. Hingley-Wilson, B. Chen, M. Chen, A. Z. Dai, P. M. Morin, 493

C. B. Marks, J. Padiyar, C. Goulding, M. Gingery, D. Eisenberg, R. G. 494

Russell, S. C. Derrick, F. M. Collins, S. L. Morris, C. H. King, and W. R. 495 Jacobs, Jr. 2003. The primary mechanism of attenuation of bacillus Calmette-496

Guerin is a loss of secreted lytic function required for invasion of lung 497

interstitial tissue. Proc Natl Acad Sci U S A 100:12420-5. 498

17. Ijaz, K., Z. Yang, H. S. Matthews, J. H. Bates, and M. D. Cave. 2002. 499

Mycobacterium tuberculosis transmission between cluster members with similar 500

fingerprint patterns. Emerg Infect Dis 8:1257-9. 501

18. Kurepina, N. E., S. Sreevatsan, B. B. Plikaytis, P. J. Bifani, N. D. Connell, 502

R. J. Donnelly, D. van Sooligen, J. M. Musser, and B. N. Kreiswirth. 1998. 503

Characterization of the phylogenetic distribution and chromosomal insertion 504

sites of five IS6110 elements in Mycobacterium tuberculosis: non-random 505

integration in the dnaA-dnaN region. Tuber Lung Dis 79:31-42. 506

19. Martin, A., M. Herranz, Y. Navarro, S. Lasarte, M. J. Serrano, E. Bouza, 507

and D. G. de Viedma. 2011. Evaluation of the inaccurate assignment of mixed 508

infections by Mycobacterium tuberculosis as exogenous reinfection and analysis 509

of the potential role of bacterial factors in reinfection. J Clin Microbiol 49:1331-510

8. 511

20. Martinez-Lirola, M., N. Alonso-Rodriguez, M. L. Sanchez, M. Herranz, S. 512

Andres, T. Penafiel, M. C. Rogado, T. Cabezas, J. Martinez, M. A. Lucerna, 513 M. Rodriguez, C. Bonillo Mdel, E. Bouza, and D. Garcia de Viedma. 2008. 514

Advanced survey of tuberculosis transmission in a complex socioepidemiologic 515

scenario with a high proportion of cases in immigrants. Clin Infect Dis 47:8-14. 516

21. Mathema, B., P. J. Bifani, J. Driscoll, L. Steinlein, N. Kurepina, S. L. 517

Moghazeh, E. Shashkina, S. A. Marras, S. Campbell, B. Mangura, K. 518 Shilkret, J. T. Crawford, R. Frothingham, and B. N. Kreiswirth. 2002. 519

Identification and evolution of an IS6110 low-copy-number Mycobacterium 520

tuberculosis cluster. J Infect Dis 185:641-9. 521

22. McAdam, R. A., P. W. Hermans, D. van Soolingen, Z. F. Zainuddin, D. 522

Catty, J. D. van Embden, and J. W. Dale. 1990. Characterization of a 523

Mycobacterium tuberculosis insertion sequence belonging to the IS3 family. 524

Mol Microbiol 4:1607-13. 525

23. McEvoy, C. R., A. A. Falmer, N. C. Gey van Pittius, T. C. Victor, P. D. van 526

Helden, and R. M. Warren. 2007. The role of IS6110 in the evolution of 527

Mycobacterium tuberculosis. Tuberculosis (Edinb) 87:393-404. 528


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

22

24. McLean, K. J., D. Clift, D. G. Lewis, M. Sabri, P. R. Balding, M. J. 529

Sutcliffe, D. Leys, and A. W. Munro. 2006. The preponderance of P450s in the 530

Mycobacterium tuberculosis genome. Trends Microbiol 14:220-8. 531

25. Mendiola, M. V., C. Martin, I. Otal, and B. Gicquel. 1992. Analysis of the 532

regions responsible for IS6110 RFLP in a single Mycobacterium tuberculosis 533

strain. Res Microbiol 143:767-72. 534

26. Namouchi, A., R. Haltiti, D. Hawari, and H. Mardassi. 2010. Re-emergence 535

of the progenitors of a multidrug-resistant outbreak strain of Mycobacterium 536

tuberculosis among the post-outbreak case patients. J Infect Dis 201:390-8. 537

27. Ouellet, H., J. B. Johnston, and P. R. Ortiz de Montellano. 2010. The 538

Mycobacterium tuberculosis cytochrome P450 system. Arch Biochem Biophys 539

493:82-95. 540

28. Perri, B. R., D. Proops, P. K. Moonan, S. S. Munsiff, B. N. Kreiswirth, C. 541

Goranson, and S. D. Ahuja. 2011. Mycobacterium tuberculosis cluster with 542

developing drug resistance, New York, New York, USA, 2003-2009. Emerg 543

Infect Dis 17:372-8. 544

29. Prod'hom, G., C. Guilhot, M. C. Gutierrez, A. Varnerot, B. Gicquel, and V. 545

Vincent. 1997. Rapid discrimination of Mycobacterium tuberculosis complex 546

strains by ligation-mediated PCR fingerprint analysis. J Clin Microbiol 35:3331-547

4. 548

30. Pym, A. S., P. Brodin, R. Brosch, M. Huerre, and S. T. Cole. 2002. Loss of 549

RD1 contributed to the attenuation of the live tuberculosis vaccines 550

Mycobacterium bovis BCG and Mycobacterium microti. Mol Microbiol 46:709-551

17. 552

31. Reddy, T. B., R. Riley, F. Wymore, P. Montgomery, D. DeCaprio, R. 553

Engels, M. Gellesch, J. Hubble, D. Jen, H. Jin, M. Koehrsen, L. Larson, M. 554

Mao, M. Nitzberg, P. Sisk, C. Stolte, B. Weiner, J. White, Z. K. Zachariah, 555 G. Sherlock, J. E. Galagan, C. A. Ball, and G. K. Schoolnik. 2009. TB 556

database: an integrated platform for tuberculosis research. Nucleic Acids Res 557

37:D499-508. 558

32. Safi, H., P. F. Barnes, D. L. Lakey, H. Shams, B. Samten, R. Vankayalapati, 559

and S. T. Howard. 2004. IS6110 functions as a mobile, monocyte-activated 560

promoter in Mycobacterium tuberculosis. Mol Microbiol 52:999-1012. 561

33. Sampson, S., R. Warren, M. Richardson, G. van der Spuy, and P. van 562

Helden. 2001. IS6110 insertions in Mycobacterium tuberculosis: predominantly 563

into coding regions. J Clin Microbiol 39:3423-4. 564

34. Sampson, S. L., M. Richardson, P. D. Van Helden, and R. M. Warren. 2004. 565

IS6110-mediated deletion polymorphism in isogenic strains of Mycobacterium 566

tuberculosis. J Clin Microbiol 42:895-8. 567

35. Sampson, S. L., R. M. Warren, M. Richardson, G. D. van der Spuy, and P. 568

D. van Helden. 1999. Disruption of coding regions by IS6110 insertion in 569

Mycobacterium tuberculosis. Tuber Lung Dis 79:349-59. 570

36. Schurch, A. C., K. Kremer, O. Daviena, A. Kiers, M. J. Boeree, R. J. Siezen, 571

and D. van Soolingen. 2010. High-resolution typing by integration of genome 572

sequencing data in a large tuberculosis cluster. J Clin Microbiol 48:3403-6. 573

37. Shamputa, I. C., L. Jugheli, N. Sadradze, E. Willery, F. Portaels, P. Supply, 574

and L. Rigouts. 2006. Mixed infection and clonal representativeness of a single 575

sputum sample in tuberculosis patients from a penitentiary hospital in Georgia. 576

Respir Res 7:99. 577


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

23

38. Shamputa, I. C., L. Rigouts, L. A. Eyongeta, N. A. El Aila, A. van Deun, A. 578

H. Salim, E. Willery, C. Locht, P. Supply, and F. Portaels. 2004. Genotypic 579

and phenotypic heterogeneity among Mycobacterium tuberculosis isolates from 580

pulmonary tuberculosis patients. J Clin Microbiol 42:5528-36. 581

39. Soto, C. Y., M. C. Menendez, E. Perez, S. Samper, A. B. Gomez, M. J. 582

Garcia, and C. Martin. 2004. IS6110 mediates increased transcription of the 583

phoP virulence gene in a multidrug-resistant clinical isolate responsible for 584

tuberculosis outbreaks. J Clin Microbiol 42:212-9. 585

40. Sreevatsan, S., X. Pan, K. E. Stockbauer, N. D. Connell, B. N. Kreiswirth, 586

T. S. Whittam, and J. M. Musser. 1997. Restricted structural gene 587

polymorphism in the Mycobacterium tuberculosis complex indicates 588

evolutionarily recent global dissemination. Proc Natl Acad Sci U S A 94:9869-589

74. 590

41. Supply, P., C. Allix, S. Lesjean, M. Cardoso-Oelemann, S. Rusch-Gerdes, E. 591

Willery, E. Savine, P. de Haas, H. van Deutekom, S. Roring, P. Bifani, N. 592

Kurepina, B. Kreiswirth, C. Sola, N. Rastogi, V. Vatin, M. C. Gutierrez, M. 593

Fauville, S. Niemann, R. Skuce, K. Kremer, C. Locht, and D. van Soolingen. 594 2006. Proposal for standardization of optimized mycobacterial interspersed 595

repetitive unit-variable-number tandem repeat typing of Mycobacterium 596

tuberculosis. J Clin Microbiol 44:4498-510. 597

42. Thierry, D., M. D. Cave, K. D. Eisenach, J. T. Crawford, J. H. Bates, B. 598

Gicquel, and J. L. Guesdon. 1990. IS6110, an IS-like element of 599

Mycobacterium tuberculosis complex. Nucleic Acids Res 18:188. 600

43. van Embden, J. D., M. D. Cave, J. T. Crawford, J. W. Dale, K. D. Eisenach, 601

B. Gicquel, P. Hermans, C. Martin, R. McAdam, T. M. Shinnick, and et al. 602 1993. Strain identification of Mycobacterium tuberculosis by DNA 603

fingerprinting: recommendations for a standardized methodology. J Clin 604

Microbiol 31:406-9. 605

44. Voskuil, M. I., D. Schnappinger, R. Rutherford, Y. Liu, and G. K. 606

Schoolnik. 2004. Regulation of the Mycobacterium tuberculosis PE/PPE genes. 607

Tuberculosis (Edinb) 84:256-62. 608

45. Warren, R. M., G. D. van der Spuy, M. Richardson, N. Beyers, C. Booysen, 609

M. A. Behr, and P. D. van Helden. 2002. Evolution of the IS6110-based 610

restriction fragment length polymorphism pattern during the transmission of 611

Mycobacterium tuberculosis. J Clin Microbiol 40:1277-82. 612

46. Yesilkaya, H., J. W. Dale, N. J. Strachan, and K. J. Forbes. 2005. Natural 613

transposon mutagenesis of clinical isolates of Mycobacterium tuberculosis: how 614

many genes does a pathogen need? J Bacteriol 187:6726-32. 615

616

617


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

Total number of clusters

Clusters without RFLP

modification

14

3

1

3

2

9

2

-

2

1

5 (C, D, G, H, I)

1 (A)

1 (F)

1 (E)

1 (B)

4 members

5 members

6 members

7 members

9 members

Clusters with RFLP microevolution

events

Table 1: Distribution of IS6110 RFLP-defined clusters according to the existence

of microevolved clonal variants. RFLP, restriction fragment length polymorphism.

Letters in brackets correspond to cluster codes in Figure 1.


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

Figure 1

A

(29)254333342123359 5 years

Morocco (3)

Romania(1)

Spain (1)

NO YES (3)RS (4)

V1 (1)

*

5 yearsB

(30)

Spain (6)

Ghana (1)

Nigeria (1)

Senegal (1)

YES (3)252243242242325 YES (9)

***

RS (7)

V1 (1)

V2 (1)

*

RS (3)

V1 (1)

C

(46)Spain YES (2)NO 5 years

158333343232523RS:

V1:

158333343242523

158333343232523

***

RS (3)

V1 (1)

D

(625)Morocco (3)

Spain (1)2 years YES (2) YES (3)

254313243252425RS:

254313343252425

254313243252425V1:

E

(280)5 years YES (3)Morocco YES (7)

RS (4)

V1 (2)

V2 (1)

* ** 264233342123235RS:

V2: 264433342123235264433342123235

*RS (5)

V1 (1)

F

(633)

Argentina (1)

Gambia (1)

Romania(1)

Spain (3)

NO 2 years YES (6)252343232242325

252343232232325

RS:

V1:

5 yearsH

(450)Spain YES (3)YES (1)

*

RS (3)

V1 (1)

253533233443337

253533233443347

253533233443337

RS:

V1:

3 yearsI

(427)Spain (2)

Morocco (2)NO NO 254423422212326

*RS (3)

V1 (1)

1 yearG

(500) Spain241423242122234 NO YES (3)

RS (2)

V1 (1)

V2 (1)

* *

MIRUtype 15 PeriodCluster

(ref number)

Epidemiological

linksRFLP patternPatientorigin

Diagnostic delay

(months)


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

D

D Rv2283

LipM

Rv2284

Rv1752

PPE 24

Rv1753c

FConserved hypothetical

protein

Rv3179 Rv3180c

Intragenic locations

G

C

B

H

D

Cytochrome p450

280 nts

Rv3120 Rv3121

Conserved

hypothetical

protein

Transposase

Rv3187 Rv3188

231 nts

PPE28 181 nts PPE29

Rv1800 Rv1801

dnaA 422 nts dnaN

Rv0001 Rv0002

Rv1197

PPE 18 68 nts esxK

Rv1196

Intergenic locations

G

B

B

I

dnaA 404 nts dnaN

Rv0001 Rv0002

Hypothetical

protein274 nts

Rv1762c Rv1765c

Membrane protein

Membrane protein

68 nts

Rv0010c Rv0011c

39 ntsConserved

hypothetical

protein

Rv1504c Rv1505c

Potential down-regulationPotential up-regulationCluster Cluster Cluster Interrupted gene

Figure 2


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

0.0

02

.004

.006

Reference Strain Variant Strain

Figure 3

Expre

ssio

nra

tio


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

1 characterization of microevolution events in...

Documents