1 candida albicans uses multiple mechanisms to acquire the ... · 121 and 5’ ncr from sc5314...

Candida albicans uses multiple mechanisms to acquire the essential 1

metabolite inositol during infection 2

3

Ying-Lien Chen1, Sarah Kauffman

2 and Todd B. Reynolds

1* 4

1,2 Department of Microbiology, University of Tennessee, Knoxville, TN 37996, USA 5

6

*Corresponding author: Todd B. Reynolds 7

Mailing address: Department of Microbiology, University of Tennessee, F321 Walters Life 8

Sciences Building, Knoxville, TN 37996 9

Phone: 865-974-4025, FAX: 865-974-4007, Email: [email protected] 10

11

12 ACCEPTED

Copyright © 2008, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.01514-07 IAI Accepts, published online ahead of print on 11 February 2008

on January 13, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

http://iai.asm.org/

ABSTRACT 12

Candida albicans is an important cause of life-threatening systemic bloodstream infections in 13

immunocompromised patients. In order to cause infections C. albicans must be able to 14

synthesize the essential metabolite inositol or acquire it from the host. Based on its similarity to 15

Saccharomyces cerevisiae it was predicted that C. albicans may generate inositol de novo, import 16

it from the environment, or both. The C. albicans inositol synthesis gene INO1 and inositol 17

transporter gene ITR1 were each disrupted. The ino1!/ino1! mutant was an inositol auxotroph, 18

and the itr1!/itr1! mutant was unable to import inositol from the medium. Each of these 19

mutants were fully virulent in a mouse model of systemic infection. It was not possible to 20

generate an ino1/ino1! itr1!/itr1! double mutant suggesting that in the absence of these two 21

genes C. albicans could not acquire inositol and was inviable. A conditional double mutant was 22

created by replacing the remaining wild-type allele of ITR1 in an ino1!/ino1! itr1!/ITR1 strain 23

with a conditionally expressed allele of ITR1 driven from the repressible MET3 promoter. The 24

resulting ino1!/ino1! itr1!/PMET3::ITR1 strain was found to be inviable in medium containing 25

methionine and cysteine (which represses the PMET3 promoter), and it was avirulent in the mouse 26

model of systemic candidiasis. These results suggest a model in which Candida albicans has two 27

equally effective mechanisms for obtaining inositol while in the host. It can either generate 28

inositol de novo through Ino1p, or it can import it from the host through Itr1p. 29

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

INTRODUCTION 30

Candida albicans is a dimorphic yeast that can exist in a human host as either a harmless 31

commensal, or as an opportunistic pathogen when the host’s immune system is impaired (5). In 32

patients that are neutropenic, Candida species are associated with severe and deadly systemic 33

bloodstream infections with a high mortality rate (31.8%) (27). In fact, Candida species are the 34

fourth most common cause of catheter-related blood stream infections in hospitalized patients in 35

the intensive care unit, and C. albicans is the most commonly isolated species from these 36

infections (4). 37

The ability of any pathogenic microbe to cause an infection depends on the organism’s 38

ability to acquire or generate essential nutrients during residence within the host. There are 39

several examples of auxotrophies that compromise virulence in C. albicans (16). The most 40

notable example is the defect in uracil biosynthesis caused by a mutation in URA3. Homozygous 41

URA3 mutants (ura3!/!) block the ability of C. albicans to grow without uridine 42

supplementation and lead to avirulence. In fact, the level of URA3-encoded orotidine 43

5'-monophosphate decarboxylase activity can be correlated with growth and virulence (20). 44

Homozygous mutations in the ADE2 gene, which blocks the ability of C. albicans to grow in 45

minimal medium or serum in the absence of exogenous adenine also diminish virulence (10). In 46

addition, homozygous mutations in the HEM3 gene leading to heme auxotrophy compromise 47

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

virulence (16). 48

In contrast to these results, auxotrophies for a number of amino acids including serine, 49

lysine, leucine, histidine, and arginine do not appear to compromise virulence (23, 32, 40). For 50

example, Noble and Johnson (32) demonstrated that C. albicans his1!/!, his1!/! leu2!/!, and 51

his1!/! arg4!/! auxotrophic mutants exhibited wild-type virulence in a mouse model of 52

systemic candidiasis, whereas his1!/! leu2!/! arg4!/! triply auxotrophic strains were only 53

mildly attenuated in virulence compared to the wild-type. These results suggest that there are 54

some metabolites such as amino acids that C. albicans can scavenge from the host during an 55

infection, while there are other metabolites that it must make de novo such as uracil, adenine, and 56

heme. 57

Myo-inositol (referred to here as inositol) is essential for the growth of all eukaryotes, and is 58

needed by some bacteria (12). Inositol is involved in many intracellular processes including 59

growth regulation, membrane structure, osmotolerance, signal transduction, and the formation of 60

glycosylphosphatidylinositol (GPI)-anchored proteins, which are themselves essential (3, 7, 33, 61

41). Inositol has been implicated in the pathogenicity of C. albicans because it is an essential 62

precursor for phospholipomannan, a GPI-anchored glycolipid on the cell surface of Candida 63

which is involved in pathogenicity (26). 64

There are three potential sources of inositol available to C. albicans based on work that has 65

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

been done in the related yeast S. cerevisiae: 1) de novo biosynthesis, where glucose 6-phosphate 66

is converted to inositol 1-phosphate by the inositol-1-phosphate synthase enzyme; 2) inositol 67

import from the extracellular environment by an inositol transporter; and 3) recycling of inositol 68

from the dephosphorylation of inositol polyphosphate products (7, 30, 41). 69

In S. cerevisiae, de novo inositol biosynthesis and import have both been well studied. The 70

S. cerevisiae inositol 1-phosphate synthase is encoded by the INO1 gene (9). The Ino1p enzyme 71

converts glucose-6-phosphate to inositol-1-phosphate, and then a second enzyme, inositol 72

monophosphatase, encoded by the INM1 gene, dephosphorylates inositol-1-phosphate to create 73

inositol (22). S. cerevisiae carries two distinct inositol transporter genes, ScITR1 and ScITR2, 74

which are both capable of importing inositol, but at different efficiencies (31). 75

C. albicans carries a putative homolog of INO1 based on sequence similarity which was 76

identified and sequenced by Klig et al (Genbank accession #L22737) (17, 18). C. albicans INO1 77

shows 64% identity to S. cerevisiae INO1 at the amino acid level (18). In addition, it has been 78

shown that C. albicans has a potent inositol transporter activity (15). It was demonstrated that the 79

inositol transporter in C. albicans has an apparent Km value of 240±15 µM, which appears to be 80

active and energy-dependent (15). C. albicans inositol transport activity differs in substrate and 81

cotransporter specificity from the human inositol-Na2+

transporter. However, the inositol 82

transporter gene in C. albicans was not identified in this previous study. 83

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

Recently, the importance of inositol biosynthesis in some human infectious agents was 84

demonstrated by reports in two unrelated pathogens, Mycobacterium tuberculosis and 85

Trypanosoma brucei. In T. brucei its INO1 homolog was shown to be necessary for inositol 86

biosynthesis, efficient GPI synthesis, and growth in vitro (24, 25). In M. tuberculosis, it was 87

found that its INO1 homolog was required for de novo inositol biosynthesis and full virulence in 88

a mouse model of infection (29). 89

It is unknown what roles inositol import or biosynthesis play in the virulence of C. albicans. 90

This fungus may be able to both synthesize and import inositol. It became of interest to 91

determine if C. albicans would behave like M. tuberculosis and T. brucei and require INO1 92

function for virulence/viability, or if in contrast to these pathogens, C. albicans would be able to 93

utilize either de novo synthesis or inositol import to support virulence. 94

95

MATERIALS AND METHODS 96

Strains and growth media 97

C. albicans strains used in this study are shown in Table 1. Media used in this study include 98

YPD (yeast extract-peptone-dextrose, 1% yeast extract, 2% peptone, 2% glucose) (42), defined 99

medium 199 (M199, Invitrogen), yeast carbon base-bovine serum albumin (YCB-BSA) (39), and 100

minimal medium (MM, 0.67% Difco yeast nitrogen base without amino acids, 2% glucose) (42). 101

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

MM medium was supplemented with 75 µM inositol for supporting the growth of the C. albicans 102

ino1!/! mutant and 2.5mM methionine and cysteine for MET3 promoter shutoff assays (6). 103

Inositol-free media (42) was made for testing the phenotype of the ino1!/! mutant. Agar plates 104

were solidified with 2% agar (granulated, Fisher) for YPD and with 2% BactoAgar (contains no 105

residual inositol) for MM and inositol-free media. 106

107

Strain construction 108

The C. albicans INO1 gene (INO1) was disrupted by using the CaNAT1-FLP cassette (39), 109

whereas, the C. albicans ITR1 gene (ITR1) was disrupted by using the SAT1 flipper (35). 110

For the INO1 disruption construct, the 564 basepair (bp) 5’ non-coding region (NCR) of 111

INO1 was amplified with primers JCO39 and JCO40 (Table 3), which introduced KpnI and ApaI 112

restriction sites, and was cloned into pJK863 5’ of the CaNAT1-FLP cassette (Fig 1A). The 113

583bp 3’ NCR of INO1 was amplified with primers JCO41 and JCO42 which introduced SacII 114

and SacI sites, and was cloned into pJK863 3’ of the CaNAT1-FLP cassette (Fig 1A). This 115

created the INO1 knock out construct plasmid pYLC94 (Table 2, Fig 1A), which was cut with 116

KpnI and SacI to release the disruption construct which was transformed into the wild type 117

SC5314 strain by electroporation as described previously (8, 35). The disruption construct was 118

used to sequentially disrupt both alleles of INO1 as previously described (39). The INO1 119

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

reconstitution construct was made by amplifying a 2.1 Kb fragment containing the INO1 ORF 120

and 5’ NCR from SC5314 genomic DNA using primers (JCO39 and JCO47) that introduced 121

KpnI and SalI sites. This fragment was ligated into the pRS316 vector along with a 1.7 Kb 122

fragment containing the NAT1-3’INO1NCR

amplified from plasmid pYLC94 using primers 123

JCO50 and JCO42 which introduced SalI and SacI sites. This resulted in the INO1 reconstitution 124

plasmid pYLC119 (Table 2, Fig 1B). The 3.8Kb KpnI-SacI fragment from pYLC119 was 125

transformed into the ino1!/! mutant (YLC113) in order to create the reconstituted 126

ino1!/!::INO1 strain (YLC120). 127

A similar approach was used to knock out ITR1 with the SAT1 flipper plasmid pSFS2A (35). 128

Approximately 500 bp 5’ and 3’ NCRs from ITR1 were amplified using the primer pairs 129

JCO89-JCO90 and JCO93-JCO94, respectively, each of which introduced restriction sites into 130

the corresponding fragments. The ApaI-XhoI 5’ITR1NCR

and NotI 3’ITR1NCR

fragments were 131

ligated into pSFS2A resulting in the ITR1 knock out construct plasmid pYLC164 (Table 2, Fig 132

2A). The 5Kb ApaI-SacII fragment from pYLC164 was electroporated into SC5314 and used to 133

disrupt both copies of ITR1 by sequential disruptions (28, 35). For the reconstituted construct, 134

JCO89 and JCO111 primers, which added ApaI and EcoRI sites, were used to amplify a 2Kb 135

fragment containing the 5’ITR1NCR

and ITR1 ORF region, which was used to replace the 136

ApaI-EcoRI fragment (containing 5’ ITR1NCR

-PMAL2-FLP) in the pYLC164 plasmid resulting in 137

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

pYLC208 (Table 2, Fig 2B). The 5Kb ApaI-SacII fragment from pYLC208 was used to 138

reconstitute ITR1 in the itr1!/! mutant (YLC196) strain creating the itr1!/!::ITR1 strain 139

(YLC211). 140

The ITR1 conditional mutant was made as follows. Using SC5314 genomic DNA as 141

template, primers JCO118 and JCO119 (introduced PstI and NotI sites) were used to amplify a 142

1362bp fragment containing the CaMET3 promoter (6), and primers JCO120 and JCO121 143

(introduced NotI and SacII sites) were used to amplify the ITR1 ORF. These fragments were 144

used to replace the PstI-SacII fragment in pYLC164, which deleted the 3’ flanking FRT site, 145

resulting in the conditional ITR1 expression construct plasmid pYLC229 (Table 2, Fig 2C). The 146

7.6 Kb ApaI-SacII fragment from pYLC229 was transformed into the ino1!/! itr1!/ITR1 strain 147

(YLC184) to create the ino1!/! itr1!/PMET3::ITR1 conditional strains (YLC261 and YLC266). 148

149

Northern blot analysis 150

Northern blotting for ITR1 expression was performed as described (36) with the following 151

exceptions. Strains grown in liquid medium 199 at 37°C for 2 hrs were collected for total RNA 152

extraction by the hot phenol method (36). A PCR product containing bps 24-750 of the ITR1 153

ORF (primers JCO102 and JCO103) was used as a probe. Expression was normalized against C. 154

albicans ACT1 gene expression probed on the same membrane. The ACT1 probe was generated 155

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

with the primers JCO48 and JCO49. 156

157

Southern blot analysis 158

Hybridization conditions for the Southern blot analysis were similar to those for Northern 159

blot analysis, except that the Techne Hybrigene oven was set to 60°C for the incubation step, and 160

42°C and 60°C for washing steps. The cells were grown in liquid YPD at 30°C overnight. The 161

genomic DNA was extracted using the Winston-Hoffman method (13) and 20µg of genomic 162

DNA were subjected to Southern blotting. The genomic DNA of ino1 mutants was cut by AflII 163

and SphI restriction enzymes while the genomic DNA of itr1 mutants was cut by PstI. PCR 164

products containing the ~500bp 3’ NCR of INO1 (primers JCO41 and JCO42) and 3’NCR of 165

ITR1 (primers JCO93 and JCO94) were used as probes. 166

167

Inositol uptake assays 168

This protocol was adapted in part from Jin and Seyfang (15). The wild type, itr1!/ITR1, 169

itr1!/!, and itr1!/!::ITR1 strains were grown in YPD liquid cultures overnight at 30°C. Cells 170

were diluted to 1 OD600

in YPD, grown at 30˚C, and collected at 5 OD600

by centrifugation at 171

2,600g for 5 min. Cells were then washed twice with water at 4°C and resuspended in 2% 172

glucose to a final concentration of 2x108 cells/ml as determined by a hemacytometer. From this 173

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

time point on, cells were kept on ice until used for the actual assay. For the uptake assay, the 174

reaction mixture (250µl) contained 2% glucose, 40mM citric acid/KH2PO4 (pH5.5), 0.15"M 175

[2-3H] inositol (1 µCi/µl, MP Biomedicals), and 200"M unlabeled inositol (Alexis Biomedicals). 176

Equal volumes of the reaction and cell mixtures (60"l each) were warmed to 30°C and mixed for 177

the uptake assay which was performed for 10 minutes at 30°C. As negative controls, mixtures 178

were kept at 0°C (ice) during the 10 minute incubation. One hundred µl aliquots were removed 179

and transferred to pre-wetted metricel filters on a vacuum manifold. The filters were washed 4 180

times each with 1ml ice cold water. The washed filters were removed and added to liquid 181

scintillation vials for measurements on a Perkin Elmer TRI-CARB 2900TR scintillation counter. 182

The uptake of radiolabelled inositol over 10 minutes was calculated and plotted as a function of 183

incubation temperature. 184

185

Mouse infection studies 186

Five- to six-week-old male CD1 mice (18 to 20g) from Charles River Laboratories were 187

used in this study. Mice were housed at five per cage. For infection, colonies from each C. 188

albicans strain were inoculated into 20ml of YPD or MM media. Cultures were grown overnight, 189

washed twice with 25ml of sterile water, counted by hemacytometer, and resuspended at 107 190

cells per ml in sterile water. The cells were then plated on YPD to determine the viability. Mice 191

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

were injected via the tail vein with 0.1ml of the cell suspension (106 cells) (43), and the course of 192

infection was monitored for up to 30 days. Survival was monitored twice daily, and moribund 193

mice were euthanized. All experimental procedures were carried out according to the NIH 194

guidelines for the ethical treatment of animals. 195

196

Statistics 197

The statistical analysis was done using Prism 4.0 software (GraphPad Software). For the 198

mouse model of systemic infection, Kaplan-Meier survival curves

were compared for 199

significance using the Mantel-Haenszel log rank test. Tests for significance of differences 200

between inositol uptake strains were determined using the two-tailed unpaired t test. Statistical 201

significance was set at P < 0.05. 202

203

RESULTS 204

The INO1 gene in C. albicans is required for growth in the absence of exogenous inositol 205

The C. albicans homolog of the S. cerevisiae INO1 gene (ScINO1) identified by Klig et al 206

(18) was disrupted in order to determine if it was required for inositol biosynthesis in C. albicans. 207

The C. albicans INO1 homolog (orf19.7585, which we refer to as INO1 in this communication) 208

was disrupted by sequentially replacing both alleles of the gene with the NAT1-FLP cassette 209

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

which contains the nourseothricin resistance gene (39). The INO1 disruption construct is 210

diagrammed in Fig 1A. The INO1 gene was reintegrated into the INO1 locus of the homozygous 211

mutant (ino1!/!) using the construct shown in Fig 1B to verify linkage of any resulting 212

phenotypes with the genotype. Wild-type (INO1/INO1), heterozygous (ino1!/INO1), 213

homozygous (ino1!/!), and reconstituted (ino1!/!::INO1) strains were analyzed by PCR (data 214

not shown) and Southern blotting (Fig 1C) to confirm the deletion and reintegration of the 215

correct genes. The wild-type, ino1!/INO1, ino1!/!, and ino1!/!::INO1 strains were then 216

compared for growth on medium lacking inositol (42) to determine if an ino1!/! mutation would 217

compromise the ability of the strain to grow in the absence of inositol. The ino1!/! strain was 218

unable to grow on inositol free medium, while the wild-type, heterozygous, and reconstituted 219

strains grew equally well. As expected, the ino1!/! strain was able to grow as well as the 220

wild-type on identical solid or liquid media with inositol added (Fig 1D and data not shown, 221

respectively). 222

223

The INO1 gene is not required for virulence in C. albicans 224

The INO1 gene does not appear to be required for virulence in a mouse model of 225

disseminated candidiasis. The wild-type, ino1!/INO1, ino1!/!::INO1, and two separately 226

derived ino1!/! strains were tested for virulence in the mouse disseminated infection model (43). 227

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

These tests revealed no difference in virulence between the wild type and ino1 mutant strains 228

(Fig 5A). The ino1!/INO1 heterozygote behaved like the wild-type and is not shown. 229

230

The ITR1 gene is required for inositol transport in C. albicans 231

The fact that the ino1!/! mutant can grow on medium containing inositol supports previous 232

studies that have shown that C. albicans harbors an inositol transporter (15). A C. albicans 233

homolog of the S. cerevisiae ITR1 and ITR2 inositol transporters was identified by BLASTing 234

the ScItr1p and ScItr2p protein sequences against the Candida Genome Database (CGD, 235

http://www.candidagenome.org). This homolog was orf19.3526 and is referred to as HGT15 236

in the CGD, but its alias in CGD is ITR2 . This gene has never been characterized functionally. 237

Based on our BLAST search using CGD, C. albicans orf19.3526 is the closest homolog to 238

ScITR1 and ScITR2 and is 51% identical based on amino acid sequence to both S. cerevisiae 239

transporter genes over its full length (data not shown). C. albicans orf19.3526 also contained the 240

critical inositol transporter motif (D/E)(R/K)"GR(R/K) (38). Based on the results described 241

below we will refer to orf19.3526 as ITR1 for the rest of this paper. 242

Both alleles of the ITR1 gene were sequentially disrupted by replacing each ORF with the 243

nourseothricin resistance cassette from the SAT1 flipper (35). The itr1! disruption construct is 244

diagrammed in Fig 2A. The ITR1 gene was reconstituted in the itr1!/! strain using the 245

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

reconstitution construct shown in Fig 2B. Gene deletions and replacements were checked for 246

accuracy using PCR (data not shown) and Southern blotting (Fig 2D). As a further test, Northern 247

blotting revealed that the ITR1 transcript could only be detected in wild-type (ITR1/ITR1), 248

heterozygous itr1!/ITR1, and reconstituted itr1!/!::ITR1 strains, but not in the itr1!/! strain 249

(Fig 2E). Expression was lower in the itr1!/ITR1 and itr1!/!::ITR1 strains presumably because 250

they contain only one allele of the gene. 251

Analysis of inositol uptake in the wild-type, itr1!/ITR1, itr1!/!, and itr1!/!::ITR1 strains 252

revealed that ITR1 is required for inositol uptake (Fig 3). Inositol uptake was not very low at 0˚C 253

((15) and Fig 3), hence this was used as a control. Inositol uptake was 58-fold higher at 30˚C 254

than at 0˚C in the wild type. In contrast, inositol uptake in the itr1!/! mutant was only 4-fold 255

higher at 30˚C than at 0˚C, but a two-tailed paired t test analysis revealed that there was no 256

significant difference in uptake between these two temperatures (P=0.34). The itr1!/ITR1 mutant 257

showed decreased inositol import compared to the wild type, and the ITR1 reconstituted strain 258

restored inositol import to a level similar to that seen in the wild-type. 259

Inositol uptake in the wild type strain in 200"M inositol was found to be 288 pmol per 5x107 260

cells during a 10 minute uptake period. Jin and Seyfang showed approximately 60 pmol per 5 x 261

107 cells during a single minute uptake (15). The difference between their data and ours is 262

probably due to saturation of uptake over a 10 minute time course (15). 263

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

264

The ITR1 gene is not required for virulence in C. albicans 265

The itr1!/! strain does not appear to be any less virulent than the wild type in a mouse 266

model of systemic candidiasis. The wild-type, itr1!/ITR1, itr1!/!, and itr1!/!::ITR1 strains 267

were compared in the mouse model for disseminated infection. There was not a significant 268

difference between the virulence of the wild-type and the itr1!/! strains (Fig 5B, P=0.95). The 269

similarity in virulence between wild-type and itr1!/! strains was born out in two separate 270

infection experiments. The itr1!/ITR1 mutant behaved like the wild-type (Fig 5B) as well. In 271

the reintegrated strain (itr1!/!::ITR1) only half of the mice succumbed to the infection. This 272

may be due to technical error during the injection or an uncharacterized mutation within the 273

strain. The fact that the wild-type, itr1!/ITR1, and itr1!/! strains were all similarly virulent 274

strongly indicates that a lack of ITR1 does not impair virulence. 275

276

The INO1 and ITR1 genes show synthetic defects in growth and virulence 277

Although neither ITR1 nor INO1 were required for virulence in a mouse model of systemic 278

candidiasis, it was possible that each could compensate for loss of the other during infection 279

since it has been shown that rat serum contains 20-100µM inositol (14, 34) and mouse liver 280

contains approximately 100µM inositol (2). In order to test this hypothesis an attempt was made 281

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

to disrupt both genes simultaneously. One allele of ITR1 was disrupted in the ino1!/! strain. 282

However, it was not possible to disrupt the other allele of ITR1 suggesting that a double mutant 283

consisting of ino1!/! and itr1!/! was synthetically lethal. Therefore, in the ino1!/! itr1!/ITR1 284

strain the promoter of the remaining wild-type ITR1 allele was replaced with the CaMET3 285

conditional promoter (6) using the construct described in Fig 2C. When the CaMET3 promoter 286

(PMET3) is used to replace the promoter of a target gene, it represses transcription of that gene in 287

the presence of methionine and cysteine in the medium. The correct insertion of the PMET3::ITR1 288

allele into the chromosome was confirmed by PCR analysis (data not shown) and Southern 289

blotting (lane 7, Fig 2D). The resulting ino1!/! itr1!/PMET3::ITR1 strain was tested for growth in 290

minimal medium containing 75"M inositol and either 0 or 2.5mM methionine and cysteine. It 291

was found that unlike the wild-type or the ino1!/! itr1!/ITR1 strains, two separately derived 292

ino1!/! itr1!/ PMET3::ITR1 strains failed to grow in the presence of 2.5 mM methionine and 293

cysteine (Fig 4). 294

The ino1!/! itr1!/PMET3::ITR1 strain was tested to determine whether its virulence was 295

affected in a mouse model of systemic candidiasis. Previous work had indicated that the presence 296

of the PMET3 promoter on the essential gene CaFBA1 could compromise virulence (37). The 297

methionine in the mouse bloodstream is presumably able to prevent expression of the CaFBA1 298

gene sufficiently to compromise growth and virulence in the mouse. The wild-type, ino1!/! 299

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

itr1!/ITR1 and two ino1!/! itr1!/PMET3::ITR1 strains were compared in the mouse model of 300

systemic candidiasis. This experiment revealed that the ino1!/! itr1!/ITR1 strain was attenuated 301

for virulence, and the ino1!/! itr1!/PMET3::ITR1 strains were avirulent (Fig 5C). 302

303

DISCUSSION 304

The mechanism by which C. albicans acquires the essential metabolite inositol during an 305

infection has not been explored previously. We have found that C. albicans is able to generate 306

inositol de novo via the INO1 gene product or import inositol from the environment via the ITR1 307

gene product with efficiencies that allow it to establish an infection regardless of which 308

mechanism is employed. This conclusion only applies to bloodstream infections as this was the 309

only model tested. This result implies that the availability of inositol in mice is sufficient to 310

support an infection even if C. albicans must acquire inositol solely by importing it. Although 311

our search of the literature did not reveal the estimated inositol content of mouse serum, the 312

inositol levels found in rats is 20-100"M (14, 34) and may be comparable to mice and is similar 313

to that found in humans (61.0±12.4 µM) (19). 314

The results found with C. albicans are in contrast to what has been observed in two 315

important human pathogens, M. tuberculosis and T. brucei, which require de novo inositol 316

biosynthesis via INO1 homologs in order to be fully virulent (Mt) in mouse models or viable (Tb) 317

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

(25, 29). Both of these pathogenic microbes are capable of importing inositol, but in neither case 318

is import sufficient to allow viability in T. brucei or virulence in M. tuberculosis. In the case of T. 319

brucei, de novo synthesized inositol is used to make GPI-anchored proteins, while imported 320

inositol is used very inefficiently for this purpose (24). GPI-anchored proteins are required for 321

viability in T. brucei (21), so disruption of INO1 compromises viability. In the case of M. 322

tuberculosis the inositol transporter is too inefficient to import inositol from the host in order to 323

support infection (29). 324

Unlike either of these pathogens Candida albicans possesses an inositol transporter, 325

encoded by ITR1, that is capable of transporting inositol efficiently enough to allow full 326

virulence in a mouse model of systemic candidiasis even in the absence of de novo inositol 327

biosynthesis. In the case of both M. tuberculosis and T. brucei it has been suggested that the 328

development of selective inhibitors of Ino1p homologs might be an effective way to generate 329

antimicrobials (24, 29). The data reported in this communication indicates that this would not be 330

effective in C. albicans as it is fully virulent even in the absence of its Ino1 enzyme. As an 331

alternative approach, it has been suggested that toxic inositol analogs that are selectively taken 332

up by the C. albicans inositol transporter but not by the human inositol-Na2+ transporter, could be 333

effective drugs (15). This may be a possibility, although it needs to be determined which of these 334

two mechanisms, de novo biosynthesis or import, is used by wild-type C. albicans during an 335

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

infection. If import is used extensively, then this approach might work, however since C. 336

albicans is fully virulent in the absence of ITR1, the development of resistant mutants lacking 337

Itr1p transporter function could pose a problem. Nonetheless, a toxic analog might be useful in 338

combination with drugs affecting other targets such as an azole or polyene (1). 339

Based on our results it appears that Itr1p is the primary and perhaps sole inositol importer in 340

C. albicans both in vitro and during infection. Disruption of ITR1 greatly inhibits inositol uptake 341

in vitro (Fig 3), and in the absence of INO1 a strain carrying only the PMET3::ITR1 allele of ITR1 342

cannot grow in medium containing cysteine and methionine, even in the presence of 75 µM 343

extracellular inositol (Fig 4). The amount of methionine and cysteine in mouse serum is 344

apparently sufficient to decrease expression from the MET3 promoter as well, which is consistent 345

with results using a MET3 driven form of the C. albicans FBA1 gene (37). Our conclusion that 346

ITR1 is the primary or sole inositol transporter is consistent with a previous study of C. albicans 347

inositol transport which concluded that there was one inositol transporter in C. albicans that was 348

responsible for all, or at least the vast majority of, inositol transport activity (15). 349

The situation in C. albicans contrasts with S. cerevisiae, which has two inositol transporters 350

that are expressed at widely different levels (31). In S. cerevisiae, the ScItr1p transporter is the 351

most highly expressed of the two transporters and accounts for most of the transport activity. The 352

residual transport activity in S. cerevisiae is carried out by ScItr2p, which is expressed at much 353

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

lower levels. Based on BLAST searches of the Candida Genome Database using ScITR1 or 354

ScITR2 as queries, the C. albicans ITR1 gene was the closest homolog to the S. cerevisiae 355

inositol transporters showing 51% identity over the whole sequence (amino acids) to either 356

ScITR1 or ScITR2. C. albicans carries at least one other homolog of the S. cerevisiae inositol 357

transporters that is predicted to have 12 transmembrane domains and the (D/E)(R/K)øGR(R/K) 358

motif typical of inositol transporters. The predicted protein sequence of this gene (orf19.5447, 359

HGT19) bears 26% and 27% identity to ScItr1p and ScItr2p, respectively. It is possible that 360

orf19.5447 encodes an inositol transporter, but our results suggest that if so, this other transporter 361

is expressed at too low of a level to transport inositol efficiently or it is expressed in different 362

conditions than those tested in our experiments. Alternatively, it is a very low affinity transporter 363

like that seen in M. tuberculosis (29). 364

Taken together our results indicate that either Ino1p or Itr1p can supply the inositol 365

requirement during an infection, but a number of questions remain to be answered. For wild-type 366

C. albicans it is not known whether de novo inositol biosynthesis or import is utilized during an 367

infection or a combination of both are in operation. It may be variable depending on the 368

distribution of C. albicans cells within the host. In addition, it is not known whether de novo 369

synthesis or import is favored during growth in other host niches such as the gut, the oral mucosa, 370

and the vaginal tract. This again may be variable depending on the nutrient conditions of the 371

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

particular host niche and location of cells within those host sites. Further studies will be required 372

to answer these questions. 373

374

Acknowledgements 375

We gratefully acknowledge Dr. Jeffrey Becker, Dr. Michael Lorenz, and Dr. Pamela Small for 376

their critical review of this work. We thank Dr. Julia Köhler and Dr. Joachim Morschhäuser for 377

providing the CaNAT1-FLP cassette and SAT1 flipper, respectively. We are grateful to Dr. 378

Melinda Hauser and Li-Yin Huang for their assistance with the inositol uptake assay and animal 379

studies, respectively. We also thank all members of the Reynolds, Kitazono, and Becker 380

laboratories for many helpful discussions. This work was funded in part by grants 381

1R03AI071863 and AHA 0765366B. 382

383 ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

REFERENCES 383

1. Anderson, J. B. 2005. Evolution of antifungal-drug resistance: mechanisms and 384

pathogen fitness. Nature reviews 3:547-556. 385

2. Berry, G. T., S. Wu, R. Buccafusca, J. Ren, L. W. Gonzales, P. L. Ballard, J. A. 386

Golden, M. J. Stevens, and J. J. Greer. 2003. Loss of murine Na+/myo-inositol 387

cotransporter leads to brain myo-inositol depletion and central apnea. The Journal of 388

biological chemistry 278:18297-18302. 389

3. Betz, C., D. Zajonc, M. Moll, and E. Schweizer. 2002. ISC1-encoded inositol 390

phosphosphingolipid phospholipase C is involved in Na+/Li+ halotolerance of 391

Saccharomyces cerevisiae. European journal of biochemistry / FEBS 269:4033-4039. 392

4. Bustamante, C. I. 2005. Treatment of Candida infection: a view from the trenches! 393

Current opinion in infectious diseases 18:490-495. 394

5. Calderone, R. A. 2002. Candida and candidiasis. ASM Press, Washington, D.C. 395

6. Care, R. S., J. Trevethick, K. M. Binley, and P. E. Sudbery. 1999. The MET3 396

promoter: a new tool for Candida albicans molecular genetics. Molecular microbiology 397

34:792-798. 398

7. Chen, M., L. C. Hancock, and J. M. Lopes. 2007. Transcriptional regulation of yeast 399

phospholipid biosynthetic genes. Biochimica et biophysica acta 1771:310-321. 400

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

8. De Backer, M. D., D. Maes, S. Vandoninck, M. Logghe, R. Contreras, and W. H. 401

Luyten. 1999. Transformation of Candida albicans by electroporation. Yeast (Chichester, 402

England) 15:1609-1618. 403

9. Donahue, T. F., and S. A. Henry. 1981. myo-Inositol-1-phosphate synthase. 404

Characteristics of the enzyme and identification of its structural gene in yeast. The 405

Journal of biological chemistry 256:7077-7085. 406

10. Donovan, M., J. J. Schumuke, W. A. Fonzi, S. L. Bonar, K. Gheesling-Mullis, G. S. 407

Jacob, V. J. Davisson, and S. B. Dotson. 2001. Virulence of a 408

phosphoribosylaminoimidazole carboxylase-deficient Candida albicans strain in an 409

immunosuppressed murine model of systemic candidiasis. Infection and immunity 410

69:2542-2548. 411

11. Gillum, A. M., E. Y. Tsay, and D. R. Kirsch. 1984. Isolation of the Candida albicans 412

gene for orotidine-5'-phosphate decarboxylase by complementation of S. cerevisiae ura3 413

and E. coli pyrF mutations. Mol Gen Genet 198:179-182. 414

12. Haites, R. E., Y. S. Morita, M. J. McConville, and H. Billman-Jacobe. 2005. Function 415

of phosphatidylinositol in mycobacteria. The Journal of biological chemistry 416

280:10981-10987. 417

13. Hoffman, C. S., and F. Winston. 1987. A ten-minute DNA preparation from yeast 418

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

efficiently releases autonomous plasmids for transformation of Escherichia coli. Gene 419

57:267-272. 420

14. Isaacks, R. E., A. S. Bender, C. Y. Kim, and M. D. Norenberg. 1997. Effect of 421

osmolality and myo-inositol deprivation on the transport properties of myo-inositol in 422

primary astrocyte cultures. Neurochemical research 22:1461-1469. 423

15. Jin, J. H., and A. Seyfang. 2003. High-affinity myo-inositol transport in Candida 424

albicans: substrate specificity and pharmacology. Microbiology (Reading, England) 425

149:3371-3381. 426

16. Kirsch, D. R., and R. R. Whitney. 1991. Pathogenicity of Candida albicans auxotrophic 427

mutants in experimental infections. Infection and immunity 59:3297-3300. 428

17. Klig, L. S., B. Antonsson, E. Schmid, and L. Friedli. 1991. Inositol biosynthesis: 429

Candida albicans and Saccharomyces cerevisiae genes share common regulation. Yeast 430

(Chichester, England) 7:325-336. 431

18. Klig, L. S., P. A. Zobel, C. G. Devry, and C. Losberger. 1994. Comparison of INO1 432

gene sequences and products in Candida albicans and Saccharomyces cerevisiae. Yeast 433

(Chichester, England) 10:789-800. 434

19. Kouzuma, T., M. Takahashi, T. Endoh, R. Kaneko, N. Ura, K. Shimamoto, and N. 435

Watanabe. 2001. An enzymatic cycling method for the measurement of myo-inositol in 436

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

biological samples. Clinica chimica acta; international journal of clinical chemistry 437

312:143-151. 438

20. Lay, J., L. K. Henry, J. Clifford, Y. Koltin, C. E. Bulawa, and J. M. Becker. 1998. 439

Altered expression of selectable marker URA3 in gene-disrupted Candida albicans strains 440

complicates interpretation of virulence studies. Infection and immunity 66:5301-5306. 441

21. Lillico, S., M. C. Field, P. Blundell, G. H. Coombs, and J. C. Mottram. 2003. 442

Essential roles for GPI-anchored proteins in African trypanosomes revealed using 443

mutants deficient in GPI8. Molecular biology of the cell 14:1182-1194. 444

22. Lopez, F., M. Leube, R. Gil-Mascarell, J. P. Navarro-Avino, and R. Serrano. 1999. 445

The yeast inositol monophosphatase is a lithium- and sodium-sensitive enzyme encoded 446

by a non-essential gene pair. Molecular microbiology 31:1255-1264. 447

23. Manning, M., C. B. Snoddy, and R. A. Fromtling. 1984. Comparative pathogenicity of 448

auxotrophic mutants of Candida albicans. Canadian journal of microbiology 30:31-35. 449

24. Martin, K. L., and T. K. Smith. 2006. The glycosylphosphatidylinositol (GPI) 450

biosynthetic pathway of bloodstream-form Trypanosoma brucei is dependent on the de 451

novo synthesis of inositol. Molecular microbiology 61:89-105. 452

25. Martin, K. L., and T. K. Smith. 2005. The myo-inositol-1-phosphate synthase gene is 453

essential in Trypanosoma brucei. Biochemical Society transactions 33:983-985. 454

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

26. Mille, C., G. Janbon, F. Delplace, S. Ibata-Ombetta, C. Gaillardin, G. Strecker, T. 455

Jouault, P. A. Trinel, and D. Poulain. 2004. Inactivation of CaMIT1 inhibits Candida 456

albicans phospholipomannan beta-mannosylation, reduces virulence, and alters cell wall 457

protein beta-mannosylation. The Journal of biological chemistry 279:47952-47960. 458

27. Morrell, M., V. J. Fraser, and M. H. Kollef. 2005. Delaying the empiric treatment of 459

candida bloodstream infection until positive blood culture results are obtained: a potential 460

risk factor for hospital mortality. Antimicrobial agents and chemotherapy 49:3640-3645. 461

28. Morschhauser, J., S. Michel, and P. Staib. 1999. Sequential gene disruption in Candida 462

albicans by FLP-mediated site-specific recombination. Molecular microbiology 463

32:547-556. 464

29. Movahedzadeh, F., D. A. Smith, R. A. Norman, P. Dinadayala, J. Murray-Rust, D. 465

G. Russell, S. L. Kendall, S. C. Rison, M. S. McAlister, G. J. Bancroft, N. Q. 466

McDonald, M. Daffe, Y. Av-Gay, and N. G. Stoker. 2004. The Mycobacterium 467

tuberculosis ino1 gene is essential for growth and virulence. Molecular microbiology 468

51:1003-1014. 469

30. Nikawa, J., T. Nagumo, and S. Yamashita. 1982. Myo-inositol transport in 470

Saccharomyces cerevisiae. Journal of bacteriology 150:441-446. 471

31. Nikawa, J., Y. Tsukagoshi, and S. Yamashita. 1991. Isolation and characterization of 472

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

two distinct myo-inositol transporter genes of Saccharomyces cerevisiae. The Journal of 473

biological chemistry 266:11184-11191. 474

32. Noble, S. M., and A. D. Johnson. 2005. Strains and strategies for large-scale gene 475

deletion studies of the diploid human fungal pathogen Candida albicans. Eukaryotic cell 476

4:298-309. 477

33. Orlean, P., and A. K. Menon. 2007. Thematic review series: lipid posttranslational 478

modifications. GPI anchoring of protein in yeast and mammalian cells, or: how we 479

learned to stop worrying and love glycophospholipids. Journal of lipid research 480

48:993-1011. 481

34. Palmano, K. P., P. H. Whiting, and J. N. Hawthorne. 1977. Free and lipid 482

myo-inositol in tissues from rats with acute and less severe streptozotocin-induced 483

diabetes. The Biochemical journal 167:229-235. 484

35. Reuss, O., A. Vik, R. Kolter, and J. Morschhauser. 2004. The SAT1 flipper, an 485

optimized tool for gene disruption in Candida albicans. Gene 341:119-127. 486

36. Reynolds, T. B. 2006. The Opi1p transcription factor affects expression of FLO11, mat 487

formation, and invasive growth in Saccharomyces cerevisiae. Eukaryotic cell 488

5:1266-1275. 489

37. Rodaki, A., T. Young, and A. J. Brown. 2006. Effects of depleting the essential central 490

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

metabolic enzyme fructose-1,6-bisphosphate aldolase on the growth and viability of 491

Candida albicans: implications for antifungal drug target discovery. Eukaryotic cell 492

5:1371-1377. 493

38. Seyfang, A., and S. M. Landfear. 2000. Four conserved cytoplasmic sequence motifs 494

are important for transport function of the Leishmania inositol/H(+) symporter. The 495

Journal of biological chemistry 275:5687-5693. 496

39. Shen, J., W. Guo, and J. R. Kohler. 2005. CaNAT1, a heterologous dominant 497

selectable marker for transformation of Candida albicans and other pathogenic Candida 498

species. Infection and immunity 73:1239-1242. 499

40. Shepherd, M. G. 1985. Pathogenicity of morphological and auxotrophic mutants of 500

Candida albicans in experimental infections. Infection and immunity 50:541-544. 501

41. Strahl, T., and J. Thorner. 2007. Synthesis and function of membrane 502

phosphoinositides in budding yeast, Saccharomyces cerevisiae. Biochimica et biophysica 503

acta 1771:353-404. 504

42. Styles, C. 2002. How to set up a yeast laboratory. Methods in enzymology 350:42-71. 505

43. Warenda, A. J., S. Kauffman, T. P. Sherrill, J. M. Becker, and J. B. Konopka. 2003. 506

Candida albicans septin mutants are defective for invasive growth and virulence. 507

Infection and immunity 71:4045-4051. 508

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

509

510

511

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

511

Table 1. C. albicans strains 512

Strain Parent Genotype Source of

reference

SC5314 (wild-type) Clinical isolate Prototrophic wild type (11)

YLC100 SC5314 ino1#::NAT1-FLP/INO1 This study

YLC105 YLC100 ino1#/INO1 This study

YLC111 YLC105 ino1#/ino1#::NAT1-FLP This study

YLC113 YLC111 ino1#/ino1# This study

YLC120 YLC113 ino1#/ino1#::INO1-NAT1 This study

YLC101 SC5314 ino1#::NAT1-FLP/INO1 This study

YLC108 YLC101 ino1#/INO1 This study

YLC126a YLC108 ino1#/ino1#::NAT1-FLP This study

YLC176 SC5314 itr1#::SAT1-FLP/ITR1 This study

YLC185 YLC176 itr1#/ITR1 This study

YLC192 YLC185 itr1#/itr1#::SAT1-FLP This study

YLC196 YLC192 itr1#/itr1# This study

YLC211 YLC196 itr1#/itr1#::ITR1-SAT1 This study

YLC180 YLC113 ino1#/ino1# itr1#::SAT1-FLP/ITR1 This study

YLC184 YLC180 ino1#/ino1# itr1#/ITR1 This study

YLC261 YLC184 ino1#/ino1# itr1#/SAT1-PMET3-ITR1 This study

YLC181 YLC113 ino1#/ino1# itr1#::SAT1-FLP/ITR1 This study

YLC187 YLC181 ino1#/ino1# itr1#/ITR1 This study

YLC266b YLC187 ino1#/ino1# itr1#/SAT1-PMET3-ITR1 This study

a another separately derived ino1#/ino1# homozygous mutant. 513

b another separately derived ino1#/ino1# itr1#/PMET3::ITR1 conditional strain. 514

515

516

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

516

Table 2. Plasmids 517

Plasmids Characteristics Source of

reference

pJK863 CaNAT1-FLP cassette carrying nourseothricin resistance gene (39)

pSFS2A SAT1 flipper carrying nourseothricin resistance gene (35)

pYLC94 pJK863 flanked by 5’ and 3’ INO1NCR

for INO1 gene knock out This study

pYLC119 INO1 reconstitution construct This study

pYLC164 pSFS2A flanked by 5’ and 3’ ITR1NCR

for ITR1 gene knock out This study

pYLC208 ITR1 reconstitution construct This study

pYLC229 ITR1 conditional construct controlled by CaMET3 promoter This study

518

519

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

519

Table 3. PCR primers 520

Primer Use Sequence (5’ ! 3’)

JCO39 Disrupt INO1 AAAAAAGGTACCGGGATCAAACAATCTAGACTCAC

JCO40 Disrupt INO1 AAAAAAGGGCCCAGTTATTTGTTTGTGAAGGAGAT

JCO41 Disrupt INO1 AAAAAACCGCGGTGTTGCTTTATAGTAATATCGCT

JCO42 Disrupt INO1 AAAAAAGAGCTCCGACAGCCCATATATTTTAATCG

JCO47 Restore INO1 AAAAGTCGACTGATTATTTGAGAATTCTTTC

JCO50 Restore INO1 AAACGTCGACACTGGATGG

TRO369 Confirm ino1# GCACGTCAAGACTGTCAAGG

JCO105 Confirm ino1# TTATCTATTGTCAATTTCGCC

JCO106 Confirm ino1# TGGGAGTTTAGTGTTTGAGC

JCO89 Disrupt ITR1 AAAAAAGGGCCCCTCAACAAATTGTCGATTAT

JCO90 Disrupt ITR1 AAAAAACTCGAGTTCCCTCAAATCAATACACT

JCO93 Disrupt ITR1 AAAAAAGCGGCCGCCTCAGTCTAGTATACTAAAT

JCO94 Disrupt ITR1 AAAAAAGCGGCCGCTGAAATACTTGAACTGTGTGA

JCO95 Confirm itr1# GATTATTAGTTAAACCACTGC

JCO96 Confirm itr1# TGAAGGGGGAGATTTTCACT

JCO100 Confirm itr1# AAACCCCCACTTGAGTCTAA

JCO101 Confirm itr1# TTGATCATTTGACCTCGGCA

JCO111 Restore ITR1 AAAAAAGAATTCGAGCTATACGGTTGGTTTCGA

JCO118 ITR1 conditional construct AAAAAACTGCAGAAAACTACGAACAATTGTC

JCO119 ITR1 conditional construct AAAAAAGCGGCCGCGTTTTCTGGGGAGGGTATTT

JCO120 ITR1 conditional construct AAAAAAGCGGCCGCATGGGAAGTTCAACCAATAA

JCO121 ITR1 conditional construct AAAAAACCGCGGCTATACGGTTGGTTTCGATT

JCO102 ITR1 Northern blot probe ACAATCAAAAGCTACCCCCA

JCO103 ITR1 Northern blot probe TGGTGTATCTGGTAAAAACCA

TRO562 INO1 Northern blot probe GAAAACTCTGTTGTTGAAAAAGATG

TRO563 INO1 Northern blot probe TTGTTGGCACGTTCACTTTG

JCO48 CaACT1 Northern blot probe CCAGCTTTCTACGTTTCC

JCO49 CaACT1 Northern blot probe CTGTAACCACGTTCAGAC

521

522

523

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

Figure legends 524

Figure 1. The INO1 gene was disrupted in C. albicans. (A) Structure of the INO1 disruption 525

construct. Approximately 500 base pairs of non-coding DNA flanking the 5’ and 3’ ends of the 526

INO1 gene (5’-and 3’-INO1NCR

, respectively) were cloned onto either flank of the CaNAT1-FLP 527

construct (39). The thick dark arrows represent the FRT target sites of the FLP recombinase. 528

The ball and stick represents the ACT1 terminator (ACT1t) and the thinner arrow on a raised line 529

represents the SAP2 promoter (PSAP2). (B) The INO1-NAT1 construct used to reintegrate INO1 530

into the ino1!/! mutant. (C) Southern blotting was used to confirm the INO1 disruptions. Lane 1 531

(wild-type); lane 2 (ino1#::NAT1-FLP/INO1), lane 3 (ino1#/INO1); lane 4 (ino1#/#:: 532

NAT1-FLP); lane 5 (ino1#/#); lane 6 (ino1#/#::INO1). (D) The INO1 gene is required for 533

growth in the absence of exogenous inositol. The cells were streaked onto medium containing 534

either 0 or 75µM inositol and grown for 2 days at 30°C. 535

536

Figure 2. The ITR1 gene was disrupted in C. albicans. (A) Structure of the ITR1 disruption 537

construct. Approximately 500 base pairs of non-coding DNA flanking the 5’ and 3’ ends of the 538

ITR1 gene (5’-and 3’-ITR1NCR

, respectively) were cloned into the pSFS2A plasmid such that 539

they flanked the SAT1 flipper cassette. The thick dark arrows represent the FRT target sights of 540

the FLP recombinase. The ball and stick represents the ACT1 terminator (ACT1t) and the 541

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

thinner arrow on a raised line represents the MAL2 promoter (PMAL2). (B) The ITR1-SAT1 542

construct used to reintegrate ITR1 into the itr1!/! mutant. (C) The PMET3::ITR1 construct used to 543

replace the ITR1 allele in the ino1!/! itr1!/ITR1 strain to generate the ITR1 conditional allele. 544

(D) Southern blotting was used to confirm the ITR1 disruptions. Lane 1 (wild-type); lane 2 545

(itr1#::SAT1-FLP/ITR1); lane 3 (itr1#/ITR1); lane 4 (itr1#/#::SAT1-FLP); lane 5 (itr1#/#); lane 546

6 (itr1#/#::ITR1-SAT1); lane 7 (ino1!/! itr1!/PMET3::ITR1). The itr1!::SAT1-FLP band 547

(disrupted allele prior to “flipping out” the SAT1-FLP construct) and ITR1-SAT1 band 548

(reintegrated ITR1 marked with SAT1) ran together on the gel. (E) Northern blotting revealed 549

that the expression of ITR1 was lost in the itr1!/! mutant, but not the wild-type, heterozygous, 550

and reconstituted strains. Strains were grown in defined medium 199 for 2hrs at 37°C, and RNA 551

was isolated, Northern blotted, and probed for ITR1 expression. ITR1 expression was 552

normalized to ACT1 expression on the same blot. 553

554

Figure 3. The ITR1 gene is required for inositol transport in C. albicans. The inositol uptake 555

assay revealed that the ability to import 3H-myo-inositol was greatly reduced in the itr1!/! 556

mutant, whereas the wild-type, heterozygous, and reconstituted strains exhibited the ability to 557

import inositol. Each strain was assayed at 0˚C (white bars) and 30˚C (black bars). 558

559

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

Figure 4. The INO1 and ITR1 genes show synthetic growth defects on agar plates. The growth of 560

wild-type, ino1!/! itr1!/ITR1, and two separately derived ino1!/! itr1!/PMET3::ITR1 strains 561

were compared in 5-fold serial dilutions on minimal medium containing 75µM inositol ± 2.5mM 562

methionine and cysteine. 563

564

Figure 5. The INO1 and ITR1 genes show synthetic defects in virulence. The survival of mice 565

was monitored following intravenous challenge with 106 C. albicans blastospores. (A) Mice 566

were injected with INO1 mutant strains. Wild-type (n=10); ino1!/! (YLC113, n=10); ino1!/! 567

(YLC126, n=11); ino1!/!::INO1 (n=10). (B) Mice were injected with ITR1 mutant strains. 568

Wild-type (n=5); itr1!/ITR1 (n=5); itr1!/! (n=10); itr1!/!::ITR1 (n=6). (C) Mice were injected 569

with ino1!/! itr1#/PMET3::ITR1 conditional double mutant strains. Wild-type (n=10); ino1!/! 570

itr1!/ITR1 (n=10); ino1!/! itr1!/PMET3::ITR1 (YLC261, n=10); ino1!/! itr1!/PMET3::ITR1 571

(YLC266, n=10). Strains for experiments A and B were pre-grown in YPD before the injection 572

while strains for experiment C were pre-grown in minimal medium-meth-cys

plus 75µM inositol. 573

574

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

C

ino1!::NAT1-FLP

INO1-NAT1INO1

ino1!

1 2 3 4 5 6

B

3’ INO1NCRINO1

5’ INO1NCR

Kpn I Sac ISal I

NAT1

D

0 µM inositol 75 µM inositol

INO1/

INO1

ino1!/

INO1

ino1!/!ino1!/!

::INO1

Figure 1

A

3’ INO1NCRPSAP2 ACT1t5’ INO1NCR

FLP NAT1

Kpn I Sac IApaI Sac II

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

D

B

3’ ITR1NCR5’ ITR1NCR

Apa I Sac IIEco RI

ITR1 SAT1

1 2 3 4 5 6 7

PMET3::ITR1

itr1!

itr1!::SAT1-FLP &

ITR1-SAT1

ITR1

ITR1

ACT1

E

WT

itr1!

/ITR

1

itr1!

/ !itr

1!/!

::ITR

1

100% 48% 3% 29%

Figure 2

ACT1t 3’ ITR1NCRPMAL2

A

5’ ITR1NCR

FLP SAT1

Apa I Sac IIPst I

C

ITR15’ ITR1NCR PMET3

Apa ISac IIPst I Not I

PMAL2 ACT1t

FLP SAT1

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

Figure 3

Inosi

tol

upta

ke

(pm

ol/

10m

in/4

x10

6 c

ells

)

WT itr1!/ITR1 itr1!/! itr1!/!::ITR1

°C Temp0 30 0 30 0 30 0 30

0

5

10

15

20

25

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

Figure 4

ino1!/! itr1!/PMET3::ITR1 (YLC261)


0 mM methionine and cysteine 2.5 mM methionine and cysteine

2x10

5

4x10

4

8x10

3

1.6x

103

3.2x

102

WT

ino1!/! itr1!/ITR1

2x10

5

4x10

4

8x10

3

1.6x

103

3.2x

102

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

A

B

C

Figure 5

0 2 4 6 8 10 12 14

0

20

40

60

80

100

WT

ino1!/! (YLC113)

ino1!/!::INO1

ino1!/! (YLC126)

Days post-infection

0 2 4 6 8 10 12 14

0

20

40

60

80

100

WT

itr1!/ITR1

itr1!/!

itr1!/!::ITR1

Days post-infection

0 3 6 9 12 15 18 21 24 27 30

0

20

40

60

80

100

WT

ino1!/! itr1!/ITR1



Days post-infection

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

1 candida albicans uses multiple mechanisms to acquire the ... · 121 and 5’ ncr from sc5314...

Documents