what is dna dna is also know as deoxyribonucleic acid dna is the basic “building block” of life....
TRANSCRIPT
.
What is DNA
DNA is also know as
DeoxyriboNucleic AcidDNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that is you?
Perhaps when you think of DNA, you think of something out of a sci fi film. Like poor Bryant here…
Who helped figure out DNA?• Griffith and Transformation
– Using strains of pneumonia figures out that DNA can “transform” harmless bacteria into harmful bacteria
Avery• discovered that DNA is the nucleic acid
that stores and transmits the genetic information from one generation of an organism to the next
Hershey and Chase – 1952
• Used Viruses to infect living organisms ***IMPORTANT NEW STUDIES/ RESEARCH HAVE COME FROM THIS EXPERIMENT
• Used radioactive markers on the protein coat vs the DNA
• Conclusion – genetic material of the bacteriophage (virus) they infected with bacteria was DNA – not protein.
Watson and Crick/ Rosalind Franklin - 1953
• Franklin studies DNA using x-Ray diffraction – and gives her pictures to Watson and Crick
• Watson and Crick Use her pattern and instantly realize that DNA was a Double Helix. Every Scientist around the world was feverishly working out this structure and without her work might not have figured it out –
• SHE was NEVER recognized!!!
So let’s Look at the Basic’s DNA is held in your nucleus. It never leaves (copies get
sent out to do the dirty work but NEVER the DNA itself.)
The subunit of DNA is made of a
Sugar – a Phosphate – and a NITROGENOUS BASE.
5’
3’
Basic’s
There are 4 Nitrogenous Bases:
Adenine (A)
Guanine (G)
Thymine (T)
Cytosine (C)
A always bonds with T
G always bonds with C
Think – “A Tall Girl Called”
G C
T A
C G
A T
Purine
Pyrimidine3’
3’ 5’
5’
• Sugar Phosphates are always facing outward.
• The two complementary strands of DNA are always oriented in opposite directions in the double helix, with one strand oriented 5’ to 3’ and the complementary strand pointing in the other direction
• The two strands for this reason are said to be anti parallel!
• Chargaff’s rules - # of A’s = T’s and G=C’s
How is DNA kept in your Cells?
You have roughly 3’ of DNA in each of your billions of cells.
They need to be tightly coiled like a phone cord (remember those things) then coiled around protein.
These are the structures you see as chromosomes.
Genes, the basic unit of inheritance are contained in chromosomes and consist of DNA
Chromosomes
Karyotype
When a women has a child they can do what is called a karyotype This is a picture of the baby’s DNA before they are born. They pair up all the Chromosomes to see if there are any abnormalities.
DNA fingerprints?
Everyone’s DNA is unique to them. Unless, they are an identical twin.
I’m sure you’ve seen on CSI, they take DNA evidence.
They do this by doing a DNA Gel Electrophoresis. (we will be doing one too)
On the following slide you will see a picture of several twin’s DNA fingerprints.
Twin DNA Fingerprints
How do you make more?
Well we know you are more then the one cell you started at.
And every cell you have has the same DNA, so how do you make more DNA?
It’s called DNA Replication.
You’re DNA is in the shape of a Double Helix – like a twisted ladder. This shape is not really the best in aiding the replication process.
What to do, what to do …
Replication
First you UNTWIST a section
Then you must UNZIP
This is done by breaking the Hydrogen bonds between
the nitrogenous bases.
Now you find a new “complimentary base” partner
(A with T, G with C)
Once a section has been partnered up it
RETWISTS
Replication
Closer look at
Replication
This is a Semi-CONSERVATIVE replication because each new strand has half of the old strand.
The old strand is used as a TEMPLATE or guide of where to put the new bases
Bidirectional Replication
• Starts at the replication origin and creates 2 replication forks that move away in both directions.
• DNA Helicase opens the DNA
• DNA polymerases add to end of existing nucleotide elongating it (5’ – 3’ adding onto the 3’ end)
• Since DNA polymerase can not start a new strand from scratch must add onto a short primer of RNA (made by RNA polymerase called primase.
• The continuous strand is called the leading stand
• The one in smaller pieces (called Okazaki fragments) is called the lagging strand.– A DNA polymerase fills in the gaps after the
RNA primer is removed from between the pieces.
• The sections of DNA are finally joined together by an enzyme called ligase
Finally
• The ends of eukaryotic chromosomes present a special problem for DNA replication – therfore the 5’ – 3’ direction can not copy both ends of linear eukaryotic chromosomes. The ends of the chromosomes have special repeating sequences called telomeres and a specialized enzymed called telomerase that copies the telomeres from an RNA template it carries rather than the usual method. Without telomerase, the ends of chromosomes would shrink with repeated rounds of the DNA replication.
• The key to accurate replication dictates that unpaired bases will attract a free nucleotide ONLY if the nucleotide has a proper COMPLEMENTARY BASE!
• As DNA separates at weak hydrogen bonds, it also recombines at those same weak hydrogen bonds
But how does DNA control Cell functions?
Well like any building site – there are a set of
blue prints. You don’t want to hand out the
original, you have to make a copy to give the
plumber, electrician, mason, etc.
So we make a messenger molecule called RNA.
RNA is kind of like DNA in that it is made up of
nucleotides (remember – sugar, phosphate,
base)
RNA
However, RNA’s bases areAdenine (A)
Guanine (G)
Cytosine (C)
URACIL (U)
Also RNA is single Stranded, that’s how it can fit out of the nuclear pores.
The process in which we make RNA from DNA is like replication but the RNA strand leaves, and the DNA just retwists
Transcription
Transcription
So now you keep the original In the nucleus,
and the copy goes out into the cytoplasm.
The code is an exact copy of the DNA’s code
(with the exception of U’s instead of T’s)
So it looks something like -
AUGUUUAAAGGGCCCUAGCGCUUAAGGUUAAGGCCUUUGUAUUAAUAG
OK so how does that RNA tell our cells what to do?
So now the RNA code is in the cytoplasm. A
ribosome bonds to an initiation site.
The ribosome “reads” this code and figures out
what amino acids to put together to make a
protein.
The proteins made are what influences the cells
behavior.
So let’s look at TRANSLATION in detail.
The Ribosome reads the RNA three letters at a time.
This is called the codon.
If you look at the amino acid chart you will see there
are 20 amino acids but 64 different codon
possibilities. That means that several codons code
for the same amino acid. (This is called degeneracy
so if there is a mutation it may not change the amino
acid)
A T-RNA with the anti-codon brings the appropriate
amino acid to the M-RNA and links the amino acids
together.
Codon - Amino Acid Chart
Translation
In the codon chart, you saw the amino acid
sequences. The ribosome knows where to start
reading based on the initiation codon AUG, and
where to end based on three termination
sequences: UAA, UGA, UAG
You saw in that second picture that the ribosome
held two T-RNA. The first one holds the chain of
amino acids, while the second one brings in the
new amino acid.
The following is an animation of the ribosome
traveling down the Messenger RNA
Translation
Here’s an animation of translation I found online
Many ribosomes can read the RNA strand at one time.
What’s the big deal making proteins?
Proteins are what controls the activities going on in your cells.
Remember, enzymes are protein too.
IMPORTANT :
the sequence of the amino acids determines the SHAPE of the protein
The SHAPE determines the FUNCTION of the protein
If the DNA changes (a mutation), the AMINO ACID could change, which WOULD change the shape, which WOULD change the function.
Remember since some codons code for the same amino acid, substituting one letter for another MAY change the amino acid. It is not a guarantee. However, If you delete or add a letter that would change the reading frame and would change almost all the amino acids.
Overview of Transcription and Translation
Mutations
• In a mutation – nucleotides can be added, deleted, or substituted.
• For example – PKU – phenylketoneria, you do not make the proper enzyme to metabolize phenylalanine (you get a toxic accumulation of phyenylpyruvic acid.
• Sickle Cell Anemia – red blood cells can not carry oxygen – one amino acid in hemoglobin gene wsa changed. The disorder is traced to the presence of valine (GUA or GUG instead of glutamic acid (GAA or GAG)
Types of Mutations
• Point mutations – occurs when a single nucleotide is substituted by another nucleotide.
• THE CAT ATE THE RAT – original
• THE BAT ATE THE RAT - mutation
• THE CAT ATE THE BAT - mutation
• Frame Shift Mutation – addition or deletion that involves the loss or addition of a single nucleotide
• THE CAT ATE THE BAT – original
• THC ATA TET HEB AT – mutation
• THE CAA THT HEB AT – mutation