Variation Inheritance and Natural Selection Revision All species show variation: this can be divided into two groups Genetic Variation Environmental VariationHair Colour Blood group Diseases e.g. Common cold Variation can either be continuous: E.g. Height Or discontinuous: e.g. Tongue rolling DNA is found in the form of chromosomes which are located in the centre of all cells the nucleus DNA replication In order to grow and reproduce, living cells need to duplicate their chromosomes, as happens during cell divisions such as mitosis. This is possible because DNA can replicate itself.chromosomes mitosis Adenine always pairs with Thymine Guanine always pairs with Cytosine DNA is made up of 4 base pairs: - These chemicals are said to be complimentary The order of the chemicals ACTG in a section of DNA makes a gene E.g. ACCCTGGACCGGTAGTTCGTCCAGTTGCTA A gene is therefore something that codes for a particular characteristic e.g. hair colour ACCCTGGACCGGTAGTTCGTCCAGTTGCTA If we change this order of chemicals we change the characteristic that is being coded for. ACCATGGACCGGTACTTCGTCCAGGTGCTA We call a change like this a mutation Mutations can be bad e.g. Cystic Fibrosis Mutations can be good e.g. Disease Resistance 1.Ultraviolet Light in sunshine or Sun beds. 2.Chemicals in cigarette Smoke. 3.Chemicals in the environment. 4.Background radiation in the environment. 5.Or they can just happen spontaneously. Mutations can happen for many reasons This Mutation can lead to variation : - Variation leads to Evolution Yeah thats right DARWIN BABY!!! And his wonderful theory NATURAL SELECTION Natural Selection 1) Each species shows variation: 2)There is competition within each species for food, living space, water, mates etc 4)These survivors will pass on their better genes to their offspring who will also show this beneficial variation. Get off my land Gutted! Yum 3)The better adapted members of these species are more likely to survive Survival of the Fittest A knowledge of genes allows us to do selective breeding. This is where we decide what characteristics we want in the next generation. The Probability of characteristics being passed on can be decided by a genetic cross diagram Eye colour Example 1: A homozygous brown-eyed parent and a blue-eyed parent: Example 2: 2 heterozygous brown-eyed parents BBbb X Bb X Parents: Gametes: Offspring: Bb BBBbbbbB BBbbBbBb (FOIL)(FOIL) All offspring have brown eyes25% chance of blue eyes Bb b b Another method Example 3: A heterozygous brown-eyed father and a blue-eyed mother: b bBbbb bBbbb Father Mother Genotype Phenotype