transgenic mice - massachusetts general · pdf fileearly transgenic mice . ... rabbit, or pig:...

Current Techniques in Molecular Genetics

Transgenic Mice July 14, 2011

Adam Lacy-Hulbert, Ph.D Developmental Immunology Program

Department of Pediatrics, MGH

I.  Background

II.  Methods for making transgenic mice

III.  Applications of transgenic mice

IV.  Resources and Protocols

V.  Practical considerations

VI. Beyond mice

Outline

The stable integration of

foreign DNA into a host genome

Transgenesis

History of Transgenesis Mid-1970’s - several labs, including those of Dr.

R. Jaenisch and Dr. R. Mulligan at MIT, infected mouse embryos with retroviruses.

•  Proviral DNA integrated into the genome •  Passed to subsequent generations

(germline transmission) •  Experiments laid the groundwork for Tg

mouse approaches commonly used today

Introduction

Advantage

•  Single copy transfer

Disadvantanges

•  Delayed integration of proviral DNA

•  High degree of mosaicism

•  Low rate of germline transmission

•  Limited size of the transgene

Retroviral transgenesis

1980-81: Several groups (Gordon et al., Brinster, Constantini et al, Lacy et al.) reported the development of transgenic mice by

microinjecting genes into the pronucleus of a fertilized egg.

1982: The first visible phenotype was shown by Dr. R. Palmiter and colleagues in mice.

Mice overexpressed rat growth hormone from MT1-GH transgene.

Early transgenic mice

Growth-Hormone Tg Mice

(From Palmiter et al. 1982) MT-1 promoter: rat GH gene

© Nature Publishing Group1982


Growth-Hormone Tg Mice

(From Palmiter et al. 1982)

Rat growth hormone Tg

normal littermate

A photograph of a giant transgenic mouse was on the cover of Nature.

Advantages of mice 1. Over other genetically tractable model systems such as worms (C. elegans) and flies (Drosophila):

a) Mammalian model b) Organ systems, tissues, physiology are

highly comparable to humans. c) Most genes are well-conserved between

humans and mice.

Advantages of mice

2. Over other mammalian model systems, such as the rat, rabbit, or pig:

a) The availability of genetically homogeneous inbred strains b) Easy to breed, short generation time c) Small size (can easily be housed) d) Availability of embryonic stem cells e) Ease of gene modification in the germline

I.  Background

II.  Applications of transgenic mice

III.  Methods for making transgenic mice



VI. Beyond mice

Outline

II. Basic Transgene Design 54 Voncken

regions (MARs) (see Subheading 2.2.) which direct transgene expression in a position-independent or cell type-specifi c fashion (9–17).

1.3. Endogenous Regulatory Elements; Transgene Size

The choice of regulatory elements that drive transgene expression is broad (Fig. 2) and is primarily determined by the aim of the model. However, in all instances, a number of indispensable elements that control gene expression need to be included in a transgene. The promoter, the region of DNA at which gene expression is initiated by binding of the RNA polymerase transcriptional machinery, is the most basic and essential element controlling gene expres-sion. The promoter region should comprise a Kozak/ATG sequence at which transgene translation commences (see Subheading 1.2.) (18). If the expression

Fig. 1. Schematic overview of basic construct design. The basis of the above scheme is the use of eukaryotic coding sequences. The origin of the coding sequences is indicated in the fi gure. Since regulatory regions are usually not cloned along with cDNA, these have to be provided “separately” and are most often not endogenous (1). Endogenous regulatory elements may be included when the DNA originated from a genomic clone (2). The experimenter has a certain degree of freedom to tailor transgene design to specifi c requirements (3; see also Fig. 3). The example depicts a transgene constructed in part of genomic and cDNA sequences. Choice of cDNA and or genomic DNA-based transgenes is discussed in Subheading 1.2. Prom, promoter sequences; ex, exon; p(A), poly(A+) signal; 5! and 3! UT, 5! and 3! untranslated regions; thin black lines, introns (2, 3); RT-PCR, reverse transcriptase polymerase chain reaction.

II. Basic Transgene Design

Promoter Selection 1.  Are the required components present?

-  Promoter, -  Transcription start? -  ATG? -  Stop codon and Poly A?

2.  What promoter to use? - Endogenous/ exogenous? - Ubiquitous or Tissue specific?

II. Design optimises expression

Use of introns in expression vectorsA Lacy-Hulbert et al

650

Gene Therapy

Figure 1 Creation of artificial exons through intron insertion. GFP (a) or Cre (b) coding sequence before (top) and after intron insertion (bottom).

Numbers indicate nucleotide position in the coding sequence or length in bp of exons (boxes) and introns generated through intron insertion. Nucleotide

sequence at the newly generated exon–intron boundaries are indicated below; upper case letters represent exons, lower case intron sequences. In (b) the

cryptic splice site activated upon intron insertion in the Cre coding sequence is indicated at position 447 with the two mutations introduced to inactivate

it indicated above. Restriction sites for intron insertion into eGFP coding sequence from pEGFP-N1 (Clontech Laboratories, Basingstoke, UK) were

introduced by PCR mediated, silent mutagenesis using the following primer pairs (5!–3!/5!–3!). eGFP1/eGFP1R: GCGCTCGAGCCACCATGAAACG

CCCCAGGACCGTGAGCAAGGGCGA/CTCGGCC CGGGTCTTGTAG; eGFP2/eGFP2R: GACCCGGGCCGAGGTGAAG/TGCGAATTCTGGTC

GGCCAGCTGCACGC; eGFP3/eGFP3R: GCAGCTGGCCGACCACTACC/GCGAGATCTTTACTTGTACAGCTC. The mutated PCR products were

then assembled to give the GFP coding sequence used for intron insertion. The first primer also introduces the adenovirus E1a nuclear localisation

signal. The first intron (109 bp) of the mouse Ig C" gene (Genbank acession number musigcd10, bases 417–526) and the third intron (81 bp) of mouse

Ig C# (Genbank acession number musigce01, bases 1678–1759) were amplified by PCR from plasmid clones containing the respective genomic loci using

the following primer pairs (5!–3!/5!–3!), which begin with the GT donor consensus (forward primers) and end with the AG acceptor consensus (reverse

primers): GTAAGAACCAAACCCTCCCAG/CTGGAATGAAAGGTCAAGGTG; GTGAGTACAGGAGGTGGAGAGT/ CTGTGGGACGACAT-

GACTTAA. The products were cloned into the Smal and Pvull sites in the modified eGFP coding sequence to give iGFP, or the EcoRV and Pvull sites

of Cre(x) to give iCre. A 190 bp fragment containing a transcriptional pause/pA sequence shown to terminate transcription efficiently17 and a 92 bp

fragment from the 3! UTR of the mouse $ globin gene (Genbank: MUSHBBMAJ bp 3933–4025) conferring high mRNA stability18 were assembled

and introduced at the 3! end of the iCre coding region. The $ globin 3! UTR fragment was amplified from mouse genomic DNA using primers bgloba1

(CCAGTCGACCCCCTTTCCTGCTCTTGC) and bgloba2 (GTCAGATCTCAGATTTTCAAATGTCTATC). These cloning strategies produced pairs of

Cre and GFP coding sequences differing only by the presence or absence of introns. The coding sequences were cloned into an expression vector (pEGFP-

N1, Clonetech) replacing either the eGFP gene alone (for iGFP/eGFP vectors) or eGFP and the resident SV40 polyadenylation signal (iCre2/Cre(x)

vectors). The resulting plasmids were used in transfection studies.

the case of Cre, the introns were introduced into EcoRVand PvuII sites of a modified Cre coding sequence. GCpairs present in this bacterial gene had previously beenremoved by silent mutagenesis ((Cre(x); our unpublisheddata) to prevent inhibitory DNA methylation inmammalian cells.

We determined the effect of the introns on geneexpression by stable transfection of CHO cells withexpression constructs under control of the CMV pro-moter. Pools of approximately 100 G418 resistant cloneswere analysed to minimise the possible influence of inte-gration site-specific effects. While the introns werespliced correctly to produce functional GFP mRNA(Figure 2a), cryptic splice donor site in position 447(GAG/GT) was activated in the Cre coding sequence thatled to deletion of 120 nucleotides of the first exon (seeFigure 1b, data not shown). ‘Weakening’ of this spliceconsensus sequence by mutagenesis of two bases(Figure 1b) led to the correct splice product (Figure 2b).DNA sequencing of the rtPCR products (data not shown)confirmed functional splicing and reconstitution of theopen reading frames for iGFP and iCRE2. Quantificationof GFP and Cre mRNA levels by RNA slot blot analysisrevealed a substantial effect of the introns on geneexpression: the iDNA constructs produced 30-fold higherlevels of steady-state mRNA compared to the intronlesscounterparts (Figure 2). Expression of functional proteinwas confirmed by the ability of the Cre recombinase todelete a loxP flanked premature transcriptional stopsequence leading to activation of a GFP reporter con-struct (data not shown), and the emission of green fluor-escence by cells transfected with iGFP as detailed below.

The effect of the introns on GFP expression was ana-

lysed further in vitro and in vivo at the protein level. Flow-cytometric analysis of randomly selected CHO clonestransfected with the GFP expression plasmids (Figure 3)showed a higher proportion of fluorescent cells(60 ± 7.4%, iGFP versus 41 ± 5.9% eGFP), and more homo-geneous fluorescence as indicated by the respective coef-ficient of variation (CV) values (148 ± 8.8 iGFP, 182 ± 11.9eGFP). Remarkably, the clones transfected with the iGFPconstruct showed a five-fold higher level of mean fluor-escence compared with eGFP (Figure 3). The presence ofintrons in the coding sequence of GFP thus improvesboth levels and homogeneity of gene expression.

To determine whether the artificial exon–intron struc-ture would also lead to enhanced gene expression in vivo,rat brain was transduced with a herpes simplex virus(HSV) based vector10 encoding the eGFP or the iGFP con-struct. Levels of GFP expression 3 days after transductionwere notably higher in the case of iGFP with increasedfluorescence (data not shown). The intron-mediatedenhancement, however, became most apparent 4 weeksafter transduction (Figure 3). Sections of brain tissuetransduced with iGFP expression vectors showed largerareas with more intense fluorescence and staining deepinto the axons. Taken together, the data show that arti-ficial exon–intron structures created by direct insertion ofshort heterologous introns into coding sequences canboost the expression of recombinant genes in vitro andin vivo.

The insertion of introns directly into coding sequenceshas some distinct advantages over the positioning of anintron in the UTR, the use of genomic/cDNA hybridgenes, or incorporation of UTRs.11 First, introns can actco-operatively in enhancing the levels of mRNA pro-

Constructed artificial intron-containing versions of GFP, CRE

Lacy-Hulbert (2001) Gene Therapy

‘Basic’ genetic structure (introns, UTR) can enhance transgene expression

II. Introns modify expression

Intron GFP is spliced to make GFP Expressed at higher levels than non-iGFP



651

Figure 2 Enhanced expression and correct splicing of iGFP and iCre2 coding regions. (a, b) rtPCR of mRNA from cells transfected with GFP (a) orCre (b) expression vectors. GFP or Cre specific PCR products of genomic DNA (gDNA) or cDNA were amplified with primers flanking both introns.GFP coding sequence without introns is indicated by a product of 759 bp (including 26 nucleotides from the UTRs), while the presence of the twointrons leads to a product of 949 bp. Digestion with SmaI (S) or PvuII (P) leads to generation of 563/196 and 401/357 bp product pairs, respectively,indicating the reconstitution of the ORF. Cre coding sequence without introns is indicated by a product of 904 bp, while the presence of the two intronsleads to a product of 1094 bp. Digestion with EcoRV (E) or Pvu II (P) leads to generation of 471/433 and 649/255 bp product pairs, respectively,indicating precise removal of the introns and the reconstitution of the ORF. No PCR products were generated in negative control samples treated inthe absence of reverse transcriptase to exclude amplification from contaminating chromosomal DNA. (c, d) Levels of GFP and Cre mRNA in CHO cellsstably transfected with the corresponding expression vectors. Signal intensity of serial mRNA dilutions on slot blots was determined by phosphorimageanalysis. Levels shown are normalised for GAPDH and neor mRNA to account for possible differences in sample loading and integrated vector copynumbers. CHO cells were electroporated in the presence of 0.3 !g of linearised plasmid. After 11 days of G418 selection cells were passaged once beforeharvesting cells for RNA preparation. Cytoplasmic RNA was prepared from trypsinised cell suspensions and analysed by slot-blotting. First strandcDNA synthesis was performed using 1 !g total RNA and Superscript II supplied by GibcoBRL following the manufacturer’s protocol and the equivalentof 1/20 of the reaction was used for PCR amplification. GFP sequences were amplified with eGFP1/eGFP3R and Cre sequences with Cre141f (5"–3")ATACCTGGAAAATGCTTCTGTCCG, and Cre1045R, ATCTTCCAGCAGGCGCACCATTGC.

duced12 – an effect that would require the presence of atleast two introns. Second, genomic/cDNA hybrid genesusually contain authentic introns that are considerablylarger than the minimal sequences required for efficientsplicing and they can therefore represent an unnecessaryload for gene delivery systems with limited capacity forforeign DNA. Recently, a UTR from the wood-chuckhepatitis virus has been shown to enhance recombinantgene expression.11 While such an approach may well rep-resent an important step forward in achieving thera-peutic levels of protein expression in vivo, it is associatedwith the expression of viral genetic information in themRNA. Introns, however, which can be of autologous,heterologous or synthetic origin, are removed completelyfrom the mature mRNA.

The positive effect of introns on gene expression maybe related to their reported influence on the local chroma-tin structure,13 through the possible effect of splice junc-tion sequences on nucleosome arrangement.14 Also, theformation of the splicesosome may help stabilise RNAand support the efficient production of the mature tran-script. Through mechanisms, which are only beginningto be understood, eukaryotic cells can recognise foreignDNA and inhibit its expression, a phenomenon describedas gene silencing. It has become apparent for example in

Gene Therapy

the de novo methylation and silencing of retroviral genes,transgene silencing in mice or RNA interference –phenomena that are likely to also affect the expression oftherapeutic genes in humans (reviewed in Ref. 15).

Currently used therapeutic recombinant genes are usu-ally uninterrupted coding sequences presented in thefrom of cDNA or cDNA/gDNA hybrids with few, if anyintrons. Recognition of these sequences as ‘alien’ and sub-sequent epigenetic silencing of the locus may well con-tribute to the difficulties in achieving sustainedexpression of recombinant genes in vivo. These consider-ations and the data presented here would support thegeneration of near-natural, alternating exon–intron struc-tures to obtain satisfactory expression of recombinantDNA in vivo. This can be achieved by direct insertion ofsmall introns into coding regions. Studies with Ig genesshowed that the positive effect of introns on geneexpression can depend on the promoter used.16 Remark-ably, CMV promoter-driven expression was notincreased by introns in this B cell system. Given that Igintrons do have a pronounced effect on CMV promoterdriven expression of Cre and GFP in CHO cells as shownhere, cell type-specific factors may play a role in the poss-ible interaction between promoter region and codingsequences. Therefore, it would seem important to test

II. Introns modify expression



651

Figure 2 Enhanced expression and correct splicing of iGFP and iCre2 coding regions. (a, b) rtPCR of mRNA from cells transfected with GFP (a) orCre (b) expression vectors. GFP or Cre specific PCR products of genomic DNA (gDNA) or cDNA were amplified with primers flanking both introns.GFP coding sequence without introns is indicated by a product of 759 bp (including 26 nucleotides from the UTRs), while the presence of the twointrons leads to a product of 949 bp. Digestion with SmaI (S) or PvuII (P) leads to generation of 563/196 and 401/357 bp product pairs, respectively,indicating the reconstitution of the ORF. Cre coding sequence without introns is indicated by a product of 904 bp, while the presence of the two intronsleads to a product of 1094 bp. Digestion with EcoRV (E) or Pvu II (P) leads to generation of 471/433 and 649/255 bp product pairs, respectively,indicating precise removal of the introns and the reconstitution of the ORF. No PCR products were generated in negative control samples treated inthe absence of reverse transcriptase to exclude amplification from contaminating chromosomal DNA. (c, d) Levels of GFP and Cre mRNA in CHO cellsstably transfected with the corresponding expression vectors. Signal intensity of serial mRNA dilutions on slot blots was determined by phosphorimageanalysis. Levels shown are normalised for GAPDH and neor mRNA to account for possible differences in sample loading and integrated vector copynumbers. CHO cells were electroporated in the presence of 0.3 !g of linearised plasmid. After 11 days of G418 selection cells were passaged once beforeharvesting cells for RNA preparation. Cytoplasmic RNA was prepared from trypsinised cell suspensions and analysed by slot-blotting. First strandcDNA synthesis was performed using 1 !g total RNA and Superscript II supplied by GibcoBRL following the manufacturer’s protocol and the equivalentof 1/20 of the reaction was used for PCR amplification. GFP sequences were amplified with eGFP1/eGFP3R and Cre sequences with Cre141f (5"–3")ATACCTGGAAAATGCTTCTGTCCG, and Cre1045R, ATCTTCCAGCAGGCGCACCATTGC.

duced12 – an effect that would require the presence of atleast two introns. Second, genomic/cDNA hybrid genesusually contain authentic introns that are considerablylarger than the minimal sequences required for efficientsplicing and they can therefore represent an unnecessaryload for gene delivery systems with limited capacity forforeign DNA. Recently, a UTR from the wood-chuckhepatitis virus has been shown to enhance recombinantgene expression.11 While such an approach may well rep-resent an important step forward in achieving thera-peutic levels of protein expression in vivo, it is associatedwith the expression of viral genetic information in themRNA. Introns, however, which can be of autologous,heterologous or synthetic origin, are removed completelyfrom the mature mRNA.

The positive effect of introns on gene expression maybe related to their reported influence on the local chroma-tin structure,13 through the possible effect of splice junc-tion sequences on nucleosome arrangement.14 Also, theformation of the splicesosome may help stabilise RNAand support the efficient production of the mature tran-script. Through mechanisms, which are only beginningto be understood, eukaryotic cells can recognise foreignDNA and inhibit its expression, a phenomenon describedas gene silencing. It has become apparent for example in

Gene Therapy

the de novo methylation and silencing of retroviral genes,transgene silencing in mice or RNA interference –phenomena that are likely to also affect the expression oftherapeutic genes in humans (reviewed in Ref. 15).

Currently used therapeutic recombinant genes are usu-ally uninterrupted coding sequences presented in thefrom of cDNA or cDNA/gDNA hybrids with few, if anyintrons. Recognition of these sequences as ‘alien’ and sub-sequent epigenetic silencing of the locus may well con-tribute to the difficulties in achieving sustainedexpression of recombinant genes in vivo. These consider-ations and the data presented here would support thegeneration of near-natural, alternating exon–intron struc-tures to obtain satisfactory expression of recombinantDNA in vivo. This can be achieved by direct insertion ofsmall introns into coding regions. Studies with Ig genesshowed that the positive effect of introns on geneexpression can depend on the promoter used.16 Remark-ably, CMV promoter-driven expression was notincreased by introns in this B cell system. Given that Igintrons do have a pronounced effect on CMV promoterdriven expression of Cre and GFP in CHO cells as shownhere, cell type-specific factors may play a role in the poss-ible interaction between promoter region and codingsequences. Therefore, it would seem important to test


652

Gene Therapy

Figure 3 Enhanced GFP protein expression upon intron insertion. (a) GFP expression indicated by fluorescence of CHO clones transfected with eGFP(dotted line) or iGFP (bold line) and untransfected control cells (thin line). (b) Fluorescence of clones transfected with iGFP (closed symbols) or eGFP(open symbols). Untransfected CHO cells showed a background fluorescence of 3.2 relative fluorescent units (see panel a). The mean values are indicatedby horizontal bars. (c, d) GFP expression in rat brain 4 weeks after transduction with herpes simplex based vector expressing either eGFP (c) or iGFP(d). The relative increase in background fluorescence in the eGFP sample (c) is due to the longer exposure time (1 s) compared with iGFP (0.5 s) (d),to document the area of weak GFP fluorescence in (c). Primary magnification was ! 400. Green fluorescence was determined using a FACScan flowcyto-meter (Becton Dickinson, San Jose, CA, USA). The eGFP or iGFP coding sequences were inserted into a ‘multiple immediate–early gene defective HSV-1 vector’ (1764/27–/4–/pR19)10 such that iGFP or eGFP is under CMV promoter control and terminated with the bovine growth hormone pA sequence.Recombinant virus was prepared as described10 and 5 ! 106 p.f.u. in 5 !l were injected by stereotaxic inoculation into the rat striatum.

promoter/intron combinations in the appropriate cellularsystems to maximise recombinant gene expression in thetarget tissue.

The method described here should be generally appli-cable to improve recombinant gene expression indepen-dently, or in combination with promoter choice and othermethods such as the use of mRNA stabilisingsequences.11 A near-natural gene organisation of alternat-ing exons and introns should help achieve the sustainedlevels of gene expression required for effective proteinfunction and therapeutic efficiency in vivo.

AcknowledgementsExperiments on animals were carried out in accordanceto the regulations under the Home Office (UnitedKingdom) Animals (Scientific Procedures) Act 1986. ALHand RT contributed equally to this work. This work wassupported by the Wellcome Trust grants 47608, 55287,47273 the latter to J Savill, University of Edinburgh,whom we gratefully acknowledge for the support ofALH during the project.

References1 Palmiter RD et al. Heterologous introns can enhance expression

of transgenes in mice. Proc Natl Acad Sci USA 1991; 88: 478–482.2 Evans MJ, Scarpulla RC. Introns in the 3"-untranslated region

can inhibit chimeric CAT and beta-galactosidase geneexpression. Gene 1989; 84: 135–142.

3 Boyd AC et al. Insertion of natural intron 6a-6b into a humancDNA-derived gene therapy vector for cystic fibrosis improvesplasmid stability and permits facile RNA/DNA discrimination.J Gene Med 1999; 1: 312–321.

4 Kay MA et al. Evidence for gene transfer and expression of fac-tor IX in haemophilia B patients treated with an AAV vector.Nat Genet 2000; 24: 257–261.

5 Chalfie M et al. Green fluorescent protein as a marker for geneexpression. Science 1994; 263: 802–805.

6 Cubitt AB et al. Understanding, improving and using green flu-orescent proteins. Trends Biochem Sci 1995; 20: 448–455.

7 Sauer B, Henderson N. Site-specific DNA recombination inmammalian cells by the Cre recombinase of bacteriophage P1.Proc Natl Acad Sci USA 1988; 85: 5166–5170.

8 Wang Y, Krushel LA, Edelman GM. Targeted DNA recombi-nation in vivo using an adenovirus carrying the cre recombinasegene. Proc Natl Acad Sci USA 1996; 93: 3932–3936.

9 Rajewsky K et al. Conditional gene targeting. J Clin Invest 1996;98: 600–603.

Causes increased expression of GFP in cells and in vivo

II. Basic Transgene Preparation


•  Prepare DNA in plasmid

•  Grow and excise transgene construct

•  Purify DNA: Contaminants (salt, Ethidum Bromide) are toxic to the ovum Purification critical for success

What method and mouse to use?

1. Pronuclear injection •  Most commonly used technique •  Works best in some strains (FVB)

2. Transformation of embryonic stem cells •  More laborious and time consuming •  Better characterization of the transgene •  Requires Appropriate ES cells

3. Alternative Methods (virus, knockouts..)

II. Methods for making Tg mice

Two common methods for making Tg mice

1. Pronuclear injection •  Most commonly used technique

2. Transformation of embryonic stem cells •  More laborious and time consuming •  Better characterization of the transgene

II. Methods for making Tg mice

1. Pronuclear injection •  Desired gene is injected into a mouse egg just

after fertilization (single cell stage) •  Using a fine needle, the DNA is injected into the

male pronucleus, which is derived from the sperm •  The DNA tends to integrate as tandemly-arranged

copies at a random position in the genome •  The resulting mouse is only partially transgenic.

If transgenic cells contribute to the germ line, then the transgene is passed on to the next generation

III. Methods for making Tg mice

Method 1: Pronuclear injection

nucleolus

male pronucleus

holding pipet injection needle

depression slide

DNA

Superovulation and mating

Isolation of one cell stage zygote

Microinjection of transgene

Oviduct transfer to pseudopregnant females

Identification of founders by Southern blotting/PCR

Method 1: Pronuclear injection

Transformation of embryonic stem cells ES cells are widely used for making gene knock-outs and this technique has been adapted for transgenics: •  ES cells are grown in vitro and transfected with

DNA, selected for antibiotic resistance, and injected into a recipient blastocyst.

•  Can characterize number of copies and sites of

gene integration before injection •  Can insert transgene into native locus by

homologous recombination

Method 2:

blastocyst

ES cells

holding pipet

injection needle

depression slide

Method 2: Embryonic stem cell injection

Natural mating

Isolation of blastocyst

Microinjection of ES cells into blastocyst

Uterine transfer to pseudopregnant females

Identification of founders by chimerism

Method 2: Embryonic stem cell injection

Timeline for Tg Mouse Analysis

•  Injection of DNA •  Transfer to foster mother

Potential founders

born

Wean Tg

founders Mate Tg founders

F1 progeny

born Wean

progeny

0 1 2 3 4 5 mos

Begin analysis

Gestation Gestation

Birth rate 10-60%

Identify transgenic founders 10-30%

Sexual maturation of founders

Identify transgenic progeny

Sexual maturation of progeny

5. Characterizing the transgenic mouse •  Is the transgene present?

# copies? # integration sites •  Is the transgene complete? functional?

II. Practical considerations

Detection Methods: 1.  Southern blotting (Tail tip DNA)

Provides information on: •  number of copies present in each founder line •  number of integration sites of the transgene

2. PCR •  Can detect low-copy number •  More rapid than Southern blotting •  Cannot determine copy number or integration sites •  Best used for screening established transgenic lines

Detection of the transgene

Potential Pitfalls in Transgenesis

•  No expression of transgene?

Is the construct present? PCR, southern blot Is the construct functional? Test in vitro Insertion site prevents expression? Check more founders Transgene may be silenced Check more founders

Reduce DNA Redesign construct: introns, UTR, etc


•  Mosaic or inappropriate expression?

Insertion site is mosaic Check more founders Promoter may have problems? Longer/ shorter

promoter BAC transgene?

I.  Background





VI. Beyond mice

Outline

III. Applications of Tg mice

•  To test or confirm the role of a gene in vivo

•  To develop an animal model to study disease

•  To dissect the regulatory mechanisms of gene expression in health and disease

•  To test therapeutic strategies

III. Applications of Tg mice 1. Gene overexpression / ectopic expression

•  Increased expression •  Expression in a unique site

Although genetic manipulation in vitro is possible, Tg mice provide the opportunity to study the interaction of the transgene with other genes or proteins in the intact organism.

2. Models of Human Disease


Example 1: Polio Virus

•  Normal mice lack the polio virus receptor found in humans.

•  Tg mice expressing the human polio virus receptor gene can be infected by polio virus and even develop paralysis and other pathological changes characteristic of the disease in humans.

Example 2: Amyloid Precursor Protein Tg

•  Initial attempt to develop a mouse model of Alzheimer’s disease involved overexpressing APP, the protein that is cleaved to generate β-amyloid.

•  Despite increased APP-production, these mice failed to develop Alzheimer-like plaques.

•  Subsequent overexpression of a human APP mutation led to the successful development of a mouse model of Alzheimer’s disease.


a) Identification of promoter regulatory sequences •  tissue specific and temporal gene expression.

3. Gene Regulation Studies


b)  Gene reporters in vivo (β-gal, GFP, Luciferase) •  can be used to assay promoter specificity

GFP Transgenic Mouse, CLONTECHniques 1996 M. Okabe & M. Ikawa, Osaka University, Japan

c) In vivo phenotyping:

•  transgenes fused to luciferase are used to study gene expression in a living mouse. Xenogen uses biophotonic imaging technology that allows the study of gene expression in a whole mouse during physiological challenge.

3. Gene Regulation Studies


Using this model, it is possible to assay:

•  Site of expression

•  Intensity

•  Modulation - during development -  in response to stimuli bacterial challenge drug challenge, etc.


4. Conditional Gene Expression Useful in situations where it may not be desirable to have constitutive gene overexpression.

(eg. Gene toxicity, developmental studies)


a)  Inducible transgene expression •  Tetracycline-regulated gene expression

b)  Cre-Lox tissue specific expression •  Conditional gene deletion

Cre-Lox system of gene regulation

•  Genetic tool to control site specific recombination events in genomic DNA derived from bacteriophage

•  Gene of interest is bracketed by LoxP sites that are the target of Cre enzyme

Cre-Lox system of gene regulation "

•  Used to generate tissue-specific KOs"

•  Tg mice expressing Cre under control of tissue specific promoters regulate site of “floxing”


Tissue Specific Gene Deletion

cre

LacZ reporter floxed-stop

X

Tie2-LacZ

tie2-CRE x LacZ reporter Small intestine

tie2 CRE

Flox mouse breeding

Endothelium Immune system

B cells

Macrophages, Dendritic cells & Neutrophils

Tie2 cre

LysM cre

T cells

CD19 cre

Lck cre

Dendritic cells, NK cells

The CRE ZOO

CD11c cre

αv-null αv-flox

Birth

Nervous system

Bleeding Neural degeneration

Endothelium No defects?

Immune system Colitis

B cells T cells

Macrophages, Neutrophils DCs

‘Innate’ Lymphocyte Activation Migration

Phagocytosis recruitment

Using a conditional genetic approach

Lethal Placental Defects Cleft Palate/ Bleeding

Adam Lacy-Hulbert, 2007

αv floxed

cre

CRE mice

X

Dissecting immune requirements

Immune system Colitis Tie2 cre

LysM cre

CD19 cre Lck cre T & B cells No Colitis

Colitis Myeloid cells

5. RNAi Tg for gene knock-down •  Transgenic RNAi knock-down provides an opportunity to study reduced gene expression in a shorter time frame than traditional knock-out mice

•  RNAi introduced using lentiviral vectors into single cell embryos which are reimplanted into pseudopregnant recipients


Example of lentiviral Tg

III. Transposon Transgenesis

III. Transposon Transgenesis

source for the transposase enzymatic activity,which has been shown to be effective (Wilberet al. 2006). The transient nature of cRNA, limitsthe duration of transposase activity and wouldlikely attenuate the risks of the integration of thetransposase into the host genome. However, it istheoretically possible, although unlikely, that the

RNA could undergo reverse transcriptionresulting in the possibility of non-homologousrecombination into the host genome.

To determine which DNA transposase encod-ing plasmids may have the greatest affect on tginsertion, four commonly used transposon trans-fection systems were studied in four differentmammalian cell lines (Wu et al. 2006), three ofwhich were human. These initial experimentsperformed with the two plasmid system (Donorand Helper plasmids) demonstrated that piggy-Bac (PB), a transposase isolated from the cab-bage looper moth Trichoplusia ni, and found toexhibit activity in a variety of species rangingfrom planarian to mammalian cells (Lobo et al.2006), is the most effective mediator for stableinsertion of tg’s in all cell lines tested. Onepotential limitation of transposases is that insteadof reaching a plateau in transposition withincreasing transposase, transposon integrationdeclines due to overproduction inhibition. Wehave observed overproduction inhibition with PBand it might also occur with Tol2 if the ratio ofhelper to donor plasmid was increased (Wu et al.2006). In contrast, Wilson and colleagues did notdemonstrate overproduction inhibition with PB(Wilson et al. 2007). PB and Tol2 have beenfound to be able to carry a larger cargo ascompared to Sleeping Beauty (SB). For example,the PB helper can be large (9.3–14.3 Kb) withoutsignificant reduction in transposition efficiency(Ding et al. 2005). Transposon systems have manyattractive features as vectors for gene delivery,such as: (a) accommodating large tg; (b) beingnon-viral, they do not induce an immune responsein rodent models; (c) inexpensive to mass produce(Kaminski and Summers 2003) and (d) mediatingefficient tg integration which is stable and showspersistent expression (Ivics et al. 1997).

Mechanisms to improve specificity and efficiencyof transfection

As PB is the most efficient transposon in mam-malian systems (Wu et al. 2006), studies to modifyPB to increase its specificity and transpositionefficiency are in progress. Until recently the PBliterature described the transposition machineryas a two-component system: a Helper plasmid

Fig. 1 All F0 pups born are mosaics because transcriptionfrom the introduced piggyBac plasmid might not com-mence until after the first cell division. Therefore, for bothICSI and pronuclear microinjected embryos, only cells thathave inherited the donor–helper plasmid express EGFP.Alternatively, epigenetic silencing could be occuring incertain tissues

Fig. 2 The oocyte donor females are homozygous for theshortened ZP3 promoter driven bicistronic cassette. ThesZP3 promoter is active only during oocyte developmentand oocytes transgenic for the piggyBac transposase arerecognizable by EGFP expression. At metaphase II stagearrested oocytes are loaded with the piggyBac transposaseprotein and the transgene offered to them by the donorplasmid is readily inserted into the single cell embryogenome

336 Transgenic Res (2007) 16:333–339

123

Transposon Aids transgene insertion

I.  Background





VI. Beyond mice

Outline

http://www.partners.org/researchcores/home.asp

IV. Resources and Protocols

http://www.partners.org/researchcores/home.asp

http://www.nucleis.com/

http://www.med.umich.edu/tamc/protocols.html

I.  Background





VI. Beyond mice

Outline

A. Rabbits

•  Experiments requiring larger animals e.g. endocrinology (repeated blood sampling), atherosclerosis

•  Advantages over other large lab species e.g. short gestation, yield a large number of embryos, embryos not particularly sensitive to in vitro handling.

•  Pronuclear microinjection method successful B. Fish

•  First transgenic fish reported in 1985. •  Microinjection through the cytoplasm, electroporation of embryos or sperm, retroviral infection and ES transplant •  3 general applications:

To enhance traits of commercial importance. To assay aquatic toxicants. To develop non-mammalian animal models for research

VI. Beyond mice…

C. Chickens

DNA microinjection and retroviral transduction methods Economically important species

•  develop better birds for production of meat and eggs •  confer disease resistance, •  increase the efficiency of production •  use eggs for the production of therapeutic proteins.

D. Pigs

•  First transgenic pig was reported in 1985 •  Transgenic pigs have been made by DNA

microinjection and fertilizing normal eggs with transgenic sperm

•  Source of transplanted organs for humans

VI. Beyond mice…

VII. Further Information

TBASE (The Transgenic/Targeted Mutation Database) http://tbase.jax.org/ JAX Mice Model Lists http://jaxmice.jax.org/models/index.html Mouse Genome Informatics (MGI) Mouse Genome Database http://www.informatics.jax.org/ The UC Davis Department of Pathology - The Visible Mouse http://ccm.ucdavis.edu/tvmouse/ Nagy Lab: Cre Transgenic and Floxed Gene Databases http://www.mshri.on.ca/nagy/cre.htm The Friedberg Transgenic Mouse Database http://www.niehs.nih.gov/cmgcc/friedsch.htm ORNL Mutant Mouse Database http://bio.lsd.ornl.gov/mouse/ The National Stem Cell Resource Site http://stemcells.atcc.org/ Genetic and Physical Maps of the Mouse Genome (MIT) http://www-genome.wi.mit.edu/cgi-bin/mouse/index The Mouse Atlas Project http://genex.hgu.mrc.ac.uk/

I.  Background





VI. Beyond mice

Outline


•  Insertion site problems: •  Ectopic expression •  Expression/ inactivation of gene at

insertion site •  No expression of transgene

•  Silencing of transgene: •  Tandem insertions •  Detection of ‘foreign’ DNA •  Mosaicism

•  Transgene design: •  Low or no expression •  Ectopic Expression

Select new founder Target insertion Reduce DNA injected Change vector: introns, promoter etc Use longer promoter BAC transgenesis

Xenotransplantation: •  Attempts to transplant hearts, livers, and kidneys from primates to humans have had limited success

•  Xenotransplants are immediately attacked by host antibodies resulting in hyperacute rejection

Pigs may be useful organ donors

•  Organs are the right size for use in humans •  They can be made transgenic for molecules that may circumvent hyperacute rejection •  They can be produced in the numbers needed •  Retroviruses may infect humans

(PERV = porcine endogenous retrovirus)

VI. Beyond mice…

transgenic mice - massachusetts general · pdf fileearly transgenic mice . ... rabbit, or pig:...

Documents