the lac operon 1961 , jacob and monod e. coli and other bacteria

*The Lac Operon 1961, Jacob and MonodE. coli and other bacteriaBacterial GenesMany genes constitutively expressed housekeeping genes

Other genes are more regulatedCan be turned on, or off depending on cell needs

HOUSEKEEPING GENESactin, beta (ACTB)glyceraldehyde-3-phosphate dehydrogenase ribosomal protein S27aH2B histone family, member LATP synthaseeukaryotic translation initiation factor 3, subunit 8nascent-polypeptide-associated complex alpha polypeptide adenosine deaminaseE2F transcription factor 4*

REGULATED GENESInsulin receptorMethylation enzymesDigestive enzymesNeurotransmittersTranscription factorsHormone genes*

Operongroup of coordinately regulated genes1 promoter for a number of genesPolycistronic mRNAInducer molecule turns operon on

*

*E. Coli Lac OperonE. coli cells normally grown in glucoseBUT, if lactose is used instead: convert lactose to glucose and galactose

*The Lac Operon allows for coordinate gene expressionNote: 1 mRNA, promoter, 3 genes

*THE OPERON HAS

A. 3 STUCTURAL GENES = Z, Y, A

Lac Z gene encodes betagalactosidase

b-gal lactose ------------- glucose + galactosesubstrateproducts

No lactose present ~ 3 molecules of bgalAdd lactose 3,000 molecules of bgal

*

*So.. b- gal is an inducible enzyme

What is the role of lactose?

inducer

*Lac Operon

B. promoter = allows transcription of ZYA C. operator = must be unbound for P to be open

What molecule are ALL of the components above?

*Lac Y gene encodes permease that transports lactose into cell

Lac A encodes a transacetylase

*D. Lac I geneEncodes a repressor proteinRepressor binds to operator

*

Is this operon ON or OFF?Is lactose PRESENT or ABSENT?

*Which components act in cis?In trans?

*Regulation of the Lac OperonIts normally repressed! = OFFBecause lactose is absentTherefore, it is an inducible operonWhen lactose is present

INDUCER (LACTOSE SUGAR)1. Lactose enters cell

*

2. Binds repressor protein causing conformational change

*

3. repressor cannot bind operator

*

4. RNA polymerase transcribes genes5. Cell metabolizes lactose

*

*Lactose (the inducer) enters the cellBinds repressor protein causing a conformational change

*repressor binds operatorpolymerase cannot bind promoterno transcription of ZYA genes

No lactose:

*Why study the lac operon?The lac operon is one of the most basic examples of gene regulation. Gene regulation is an important area of study in medicine as many diseases and conditions are as a result of deficiencies in gene regulation. Cancer is one such disease that results in the inability of a cell to control the genes that regulate its growth. Many systems of gene regulation in humans are quite complex and not understood by biologists and researchers. In studying simple models of gene regulation, we hope to perhaps gain some insight into how more complex gene regulatory systems work.

Lac operon animation*

Promoter region of the operon* -35 -10 +1GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA LACZCCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT

*Operon mutantsMutant Mutant Phenotype lac I - constitutive expression because

*This operon is not inducible

Mutant Mutant Phenotype

Oc constitutive expression because

*

Mutant Mutant Phenotype P- operon always off because*

MutantphenotypeZ- operon is?*

*Operon on, or off in the absence of lactose? Lac Oc I+P+OcZ+Y+A+

In presence of lactose? Is it Inducible?

Operon on, or off in the absence of lactose? Lac I- I-P+O+Z+Y+A+

In presence of lactose? Is it Inducible?

*

*Partial diploid cells contain a plasmid F I+ Inducible?I-P+O+Z+Y+A+

F I- P- Z+Y-A- I+P+O+Z- Y+A+

*Inducible?

*Repressor and polymerase = proteinsdiffusibleProteins can bind DNAact in TRANSpromoter, operator, and ZYA and I = genescannot moveact in CIS

Tips for plasmid analysis

Lac operon notesThe lac operon is under negative controlAllolactose binds to allosteric site on repressor causing shape changeIf both glucose and lactose are present, lac genes weakly transcribedMaximal transcription when lactose is only sourcecyclic AMP and a catabolite activator protein produce this effect.The concentration of cyclic AMP in E. coli is inversely proportional to the concentration of glucose: as the concentration of glucose decreases, the concentration of cyclic AWhen the concentration of glucose is low, cAMP accumulates in the cell. The binding of cAMP and the catabolite activator protein to the lac promoter increases transcription by enhancing the binding of RNA polymerase to the lac promoter. MP increases.Lac I gene has its own promoterRepressor is a 360 aa protein tetramer. Lac I promoter is weak, few repressor molecules in cellSuper repressor binds to operator even in presence of lactose*

Positive control of lac operonCAP binds to cAMPCAP-cAMP binds to CAP site upstream of promoterCAP recruits RNA pol

With glucose: + lactoseGlucose preferentially usedCatabolite repression because glucose reduces levels of cAMPLac operon at low levels*

**When grown in lactose sugar:At first are quiescent

Soon, growth begins with the lactose being rapidly consumed. *****************