the first benchtop next-generation sequencer - ion proton™ sequencer

of 27/27
Ion Proton™ System Ion Proton™ System January 2012 The content provided herein may relate to products that have not been officially released and is subject to change without notice.

Post on 04-Aug-2015

1.020 views

Category:

Technology

0 download

Embed Size (px)

TRANSCRIPT

1. Ion Proton System yJanuary 2012 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice. 2. Highly Disruptive TechnologiesEEmpower E Everyone MainFrameMiniComputer PersonalComputerSangerSequencing NextGenSequencing IonSemiconductorSequencingTechnology generations are defined by who can use them2 3. Semiconductors Disrupt Industries3 4. Ions Semiconductor Chip Sees ChemistryBiological Information Ion Semiconductor Chip Digital InformationLeverages $1 Trillion investment and $50 Billion annual spend4 5. Ion PGM Sequencer:The Fastest Selling Sequencer in the World Speed:1.5 Speed:1 5 hour runs Scalability:10 Mb to 1 Gb Simplicity: Automated workflows, benchtop convenience Affordable Aff d bl5 6. The Promise of Semiconductor SequencingFirst 100-Fold Scaling Delivered and More100 FoldAchieved i 2011A hid in100-fold scaling and 200 bp kits,Ion 318Chip* 525 base perfect reads achievedBreakthrough Ion AmpliSeq app, microbial and RNA-seq apps Ion 316 Chip 5,000 member Ion CommunityIon 3142012 RoadmapChip2 x 200 paired end kit, 400 bp kitsCustom and fixed AmpliSeq panelsFDA submission and CE-IVD certification6The content provided herein may relate to products that have notbeen officially released and is subject to change without notice. 7. Introducing Ion Proton ChipsThe Next 100-Fold Scaling 100 Fold7The content provided herein may relate to products that have notbeen officially released and is subject to change without notice. 8. $500 Exome and $1,000 GenomeSequencing in a Few Hours on the Benchtop Ion Proton I ChipIon Proton II Chip 2 human exomes1 human genome 165 million wells 660 million wells $1,000 per run $1,000 per runHighest Throughput8The content provided herein may relate to products that have notbeen officially released and is subject to change without notice. 9. Introducing the Ion Proton SequencerThe Benchtop Genome Center 9 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice. 10. Introducing the Ion Proton SequencerThe Benchtop Genome Center 10The content provided herein may relate to products that have notbeen officially released and is subject to change without notice. 11. Introducing the Ion Proton SequencerThe Benchtop Genome Center 11The content provided herein may relate to products that have notbeen officially released and is subject to change without notice. 12. Introducing the Ion Proton SequencerThe Benchtop Genome Center Supports Ion Proton I andProtonProton II chips $149K List Price (USD)$99K for Ion PGM owners State-of-the-art electronics tosupport highest throughput 12The content provided herein may relate to products that have notbeen officially released and is subject to change without notice. 13. and Rack-Mountable!Broad, Baylor,Broad Baylor and Yale have already signed up for this configuration13The content provided herein may relate to products that have not been officially released and is subject to change without notice. 14. Harnessing a Decade of Moores Law inO LOne LeapNature 475, 348 352 (21 July 2011) 475 348352 Ion Proton I Chip: 165 million wells(>100-fold( 100 fold more wells than Ion 314 Chip) 31414The content provided herein may relate to products that have not been officially released and is subject to change without notice. 15. While Seamlessly Scaling Ions PostLight Sequencing Ch i t S i ChemistryIon 314 Chip Signal Ion Proton I Chip Signal Nucleotide Incorporation Signal Signal,Same Signal Same Speed Internally generated R&D data shown 15 The content provided herein may relate to products that have not been officially released and is subject to change without notice. 16. Maintaining 200 Base Read Lengths 200 Base Q20 Reads on Ion Proton I Chip TCTTCTTCTGGCTGCCAGCACGCCGGTTGTAGTGGGATCTCTTCGCGATC |||||||||||||||||||||||||||||||||||||||||||||||||| TCTTCTTCTGGCTGCCAGCACGCCGGTTGTAGTGGGATCTCTTCGCGATC 11020304050 AAACGCCAGATCACCCCCGTTAACCACTTCAGAACCGTGGGTGATGACCT ||||||||||||||||||||||||||||||||||||||||||||||+||| AAACGCCAGATCACCCCCGTTAACCACTTCAGAACCGTGGGTGATG-CCT 5160708090 100 TTGAAATCGAATCAGGTTGGTATCGCACAGATGCGACGGCACCACATTCT |||||||||||+|||||||||||||||||||||||||||||||||||||| TTGAAATCGAA CAGGTTGGTATCGCACAGATGCGACGGCACCACATTCT TTGAAATCGAA-CAGGTTGGTATCGCACAGATGCGACGGCACCACATTCT 101110 120 130 140 150 GCATCGCGCTGAACATCGTCTCGATACGCCCTGGATAACGTTTATCCCAG |||||||||||||||||||||||||||||||||||||||||||||||||| GCATCGCGCTGAACATCGTCTCGATACGCCCTGGATAACGTTTATCCCAG 151160 170 180 190 200 TCA ||| TCA 201 Internally generated R&D data shown16The content provided herein may relate to products that have not been officially released and is subject to change without notice. 17. Single Day Workflow with Highest Throughput Ion Kits Ion ProtonIon Proton Sequencer Proton Torrent ServerOneTouch S tO T h System17The content provided herein may relate to products that have not been officially released and is subject to change without notice. 18. Streamlined Bioinformatics InfrastructureServer Room & Informaticists in a Box and in the CloudIon ReporterSolutionProtonProton Torrent Serverand Torrent Suite Software18 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice. 19. Overcoming Data Bottlenecks Full Genomes in Ion Reporter pHigh Datag Hours vs. WeeksSolution Quality More uniform coverage Single genome Flexible cloud-based enables higher quality sequencing in hours solution to manage manage, variant calls with less raw greatly eases analysisannotate, and archive data. Longer reads bottleneck (vs. batch-variants of interest for enable better mappability processing) future interpretation with less raw data19The content provided herein may relate to products that have not been officially released and is subject to change without notice. 20. Ion Proton System Availability January 2012Ion Proton System available for quotes Proton Ion Proton I Chip to commence shipment Mid-2012(Ion Proton II Chip to be available 6 months later) Early Access for 4-unit rack-mounted configuration4 unit rack mounted Unrestricted launch of Ion Proton Sequencer and End of Q3:2012 standalone Proton Torrent Server to commence20The content provided herein may relate to products that have not been officially released and is subject to change without notice. 21. Ion Semiconductor SequencingRapid,Rapid Benchtop Sequencing for All1.25 1 GenesGenomes Ion 3 Series Chips 3-Series Ion Proton Chips Ion PGM Sequencer Ion Proton Sequencer21 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice. 22. Unprecedented Scaling Every 6 Months22 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice. 23. Enabling All Applications23The content provided herein may relate to products that have not been officially released and is subject to change without notice. 24. 5500 Wildfire24The content provided herein may relate to products that have not been officially released and is subject to change without notice. 25. Wildfire Offered to Existing 5500 CustomersMid-2012 Delivery Wildfire simplifies workflow and improves economics while retaining ultra high accuracy and p y p g g y pay-per-lane sequencingqg 1.Simpler Workflow:2 hour on flowchip template preparation 2.Lower Price / Gb:$25 / Gb guaranteed 3.Higher Throughput: gg p > 20 Gb / day throughput yg p25The content provided herein may relate to products that have not been officially released and is subject to change without notice. 26. Purchasing Options for 5500 andSOLiD C tCustomers Ion Proton Sequencer + Wildfire upgradeqpg (discounted package for 5500 customers) Ion Proton Sequencer + 5500 Wildfire (discounted package for SOLiD customers) Ion Proton Sequencer (discounted, standalone for 5500/SOLiD) Wildfire upgrade (list price, standalone for 5500/SOLiD)26 The content provided herein may relate to products that have notbeen officially released and is subject to change without notice. 27. All products mentioned in this presentation are for Research Use Only,not i t d d f any animal or ht intended fori l human th therapeutic or di ti diagnostic use. ti27 Confidential and ProprietaryDO NOT DUPLICATE