This article was downloaded by: [York University Libraries]On: 12 November 2014, At: 13:12Publisher: Taylor & FrancisInforma Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,37-41 Mortimer Street, London W1T 3JH, UK

Journal of Environmental Science and Health, Part B:Pesticides, Food Contaminants, and Agricultural WastesPublication details, including instructions for authors and subscription information:http://www.tandfonline.com/loi/lesb20

The fate of recombinant plasmids during composting oforganic wastesJiewen Guan a , Maria Chan a & J. Lloyd Spencer aa Ottawa Laboratory (Fallowfield), Canadian Food Inspection Agency , Ottawa, Ontario,CanadaPublished online: 13 Apr 2010.

To cite this article: Jiewen Guan , Maria Chan & J. Lloyd Spencer (2010) The fate of recombinant plasmids during compostingof organic wastes, Journal of Environmental Science and Health, Part B: Pesticides, Food Contaminants, and AgriculturalWastes, 45:4, 279-284, DOI: 10.1080/03601231003704556

To link to this article: http://dx.doi.org/10.1080/03601231003704556

PLEASE SCROLL DOWN FOR ARTICLE

Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) containedin the publications on our platform. However, Taylor & Francis, our agents, and our licensors make norepresentations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of theContent. Any opinions and views expressed in this publication are the opinions and views of the authors, andare not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon andshould be independently verified with primary sources of information. Taylor and Francis shall not be liable forany losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoeveror howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use ofthe Content.

This article may be used for research, teaching, and private study purposes. Any substantial or systematicreproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in anyform to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http://www.tandfonline.com/page/terms-and-conditions

Journal of Environmental Science and Health Part B (2010) 45, 279–284Copyright C© 2010 Crown CopyrightISSN: 0360-1234 (Print); 1532-4109 (Online)DOI: 10.1080/03601231003704556

The fate of recombinant plasmids during composting oforganic wastes

JIEWEN GUAN, MARIA CHAN and J. LLOYD SPENCER

Ottawa Laboratory (Fallowfield), Canadian Food Inspection Agency, Ottawa, Ontario, Canada

Composting was investigated as a means for safe disposal of organic waste containing bacteria that carry transgenes in recombinantplasmids. To generate model recombinant plasmids, a mobile IncQ plasmid, RSF1010, and a non-mobile plasmid, pGFP, weregenetically modified to carry a DNA segment encoding both green fluorescent protein and kanamycin resistance and were designatedas RSF1010-GFPK and pGFPK. Escherichia coli (E. coli) C600 harboring these plasmids were inoculated into chicken manurespecimens that were placed in compost at 20 and 60 cm from the bottom of a 1.0-m high compost bin. Control specimens were heldat ambient temperature. By day 10, compost temperatures at the lower and upper levels of the bin had reached 45.3 and 61.5◦C,respectively, and at both levels the target E. coli had been inactivated and the plasmids had lost their capacity to be transformedor mobilized. Furthermore, based on real time Polymerase chain reaction (PCR), the transgene fragments along with the hostchromosomal DNA fragment from specimens at the upper level had been degraded beyond the detection limit. However, at thelower level where temperatures remained below 48◦C these fragment persisted to day 21. At ambient temperatures (0–8◦C), the E.coli, plasmids and the transgene fragments persisted in manure specimens throughout the 21 day test period. The study showed thepotential for composting as a safe procedure for disposal of bacteria carrying transgenes in recombinant plasmids.

Keywords: Recombinant plasmids; transgenes; composting; organic wastes.

Introduction

Genetically modified organisms (GMOs) including plants,animals and microorganisms are increasingly being usedin the agriculture, food, pharmaceutical and environmen-tal industries, with the result that large amounts of or-ganic waste may contain GMOs.[1] To prevent deliberateor accidental release of GMOs and their transgenes intothe environment, methods are needed for safe disposal ofsuch wastes. These methods must be efficient in destruc-tion of both the organisms and the genetic material sincetransgenes might be acquired by microorganisms throughhorizontal gene transfer.[2] Most transgenes locate in thechromosomes of GMOs and horizontal transfer of chro-mosomal DNA to other organisms rarely occurs under nat-ural conditions. However, under optimal laboratory con-ditions, plant chromosomal DNA has been transferred tobacteria.[3,4] Currently there is an interest in developing oralvaccines for animals and humans composed of live probi-otic bacteria carrying recombinant plasmids.[5] There is a

Address correspondence to Jiewen Guan, Ottawa Laboratory(Fallowfield), Canadian Food Inspection Agency, 3851 Fallow-field Road, Ottawa, Ontario, Canada, K2H 8P9; E-mail: guan-jiewen2005@hotmail.com or Jiewen.Guan@inspection.gc.caReceived November 27, 2009.

possibility that the plasmids may contain genes encodingfor virulence factors or antibiotic resistance that could betransferred to other organisms in the environment.[6] Thereis also the possibility of contaminating the environmentwith industrial microorganisms containing recombinantplasmids that have been used for production of antibioticsand pharmacologically relevant secondary metabolites.[7]

Transfer of plasmids, especially mobile plasmids, is the ma-jor means of horizontal gene transfer and has occurredamong bacteria in soil, activated sludge, animal digestivetracts and in the human gut.[8−12] Consequently, there isa need to address the risk that organic waste containingGMOs could transfer potentially dangerous novel genes tonatural organisms.

Compost can be managed to reach high temperaturesand this process has been considered effective and eco-nomical for destruction of bacterial pathogens in organicwastes.[13] Our previous studies have demonstrated thatrapid degradation of GMOs and their transgenes located inthe chromosome(s) can take place during composting.[14,15]

However, there is a need for information on the fate of re-combinant plasmids and their transgenes during the com-posting process.

In this study, a mobile plasmid (RSF1010) and a non-mobile plasmid (pGFP) were genetically modified andused as model recombinant plasmids. RSF1010 is an IncQ

Dow

nloa

ded

by [

Yor

k U

nive

rsity

Lib

rari

es]

at 1

3:12

12

Nov

embe

r 20

14

280 Guan et al.

Table 1. Summary of bacteria, plasmids, and transposons used in this study.

Bacteria, plasmids, or transposons Relevant characteristics Reference

BacteriaE. coli C600 K12 derivative Gotz and Smalla [12]

E. coli CV601 K12 derivative, rifamycin resistance Gotz and Smalla [12]

E. coli J53 K12 derivative Gotz and Smalla [12]

E. coli C600-M Harboring RSF1010-GFPK This studyE. coli C600-NM Harboring pGFPK This study

PlasmidspGEM-T PCR product cloning vector Fisher ScientificpGFP Green fluorescent protein (GFP) ClontechpGFPK Kanamycin resistance, GFP This studyRP4 Ampicillin, kanamycin and tetracycline resistance Rawlings and Tietze [16]

RSF1010 Streptomycin and sulfonamide resistance Rawlings and Tietze [16]

RSF1010-GFPK Streptomycin, sulfonamide, and kanamycin resistance, GFP This studyTransposons

ME<KAN-2>ME Kanamycin resistance gene EpicentreME<GFPK>ME GFP and kanamycin resistance genes This study

plasmid, which has a small size of 8.9 kb and can repli-cate in a wide range of gram negative bacteria and in somegram positive bacteria. This plasmid is efficiently mobi-lized by a number of self-transmissible plasmids, especiallyIncP plasmids.[16] Insertion of a DNA segment encodingfluorescent protein (GFP) and kanamycin resistance (Kan)into the plasmids was to facilitate detection of transgenesby polymerase chain reaction (PCR) and recovery of hostbacteria by culture methods. This study compared the sur-vival of the host E. coli harboring the two recombinantplasmids, the biological function (survival) of the plasmidsand the stability of the transgene fragments in chicken ma-nure specimens that were placed in compost or were heldat ambient temperatures.

Materials and methods

Preparation of compost

Compost was prepared by mixing chicken manure andwood shavings on a 1:1 dry weight basis to obtain a car-bon to nitrogen ratio of 30:1. Sufficient water was addedto adjust the moisture content of the mixture to approxi-mately 65%, as measured with an IR-35 moisture analyzer(Denver Instrument, Denver, CO). The compost bin wasconstructed with bales of hay and its interior was linedwith a heavy plastic sheet as previously described.[14,17] Thebin had internal dimensions of 1.0 × 1.0 × 1.0 m and wasfilled with the compost mixture. Two perforated drainagepipes, 10 cm in diameter, were buried 40 cm apart in thecompost and their ends extended out of the top of the com-post into open air. The top of the compost was coveredwith a vapour barrier fabric followed by a 30 cm layer ofwood shavings that served as insulation.

Specimens consisting of 10 g of the compost mixture wereinoculated with suspensions of bacteria as described belowand were contained in nylon mesh bags with a pore size of 2

mm2. Comparable control specimens were not inoculated.Triplicate specimen bags were contained within a plasticnetting with openings that were about 2 cm in diameter. Ametal chain was attached to the netting to aid in removalof the specimens during composting. The specimens wereburied in the compost at 20 and 60 cm from the bottom ofthe bin. The ambient temperature controls were specimensheld outside of the bins. On days 3, 7, 10, 15 and 21, oneplastic netting that contained three inoculated specimensand three uninoculated specimens was retrieved from eachlevel in the compost bin. Likewise, controls were retrievedfrom outside of the bin. The specimens were immediatelystored at - 80◦C until they were tested. Compost tempera-ture was recorded using stainless steel Hobo©R Temp Dataloggers U12-015 (Onset Computer Corporation, Bourne,MA) which were attached to the plastic nettings buried inthe compost or held outside.

Bacterial strains, plasmids and inocula

Strains of bacteria, plasmids and transposons used in thisstudy were listed in Table 1. To study the survival of the re-combinant plasmids, specimens were inoculated with E. coliC600 harboring the genetically modified mobile and non-mobile plasmids designated as E. coli C600-M and E. coliC600-NM, respectively. Modification of the two plasmidsis described below. Each bacterial inoculum was preparedfrom a 10 mL overnight culture in Luria-Bertani (LB) broth(Fisher Scientific, Ottawa, ON, Canada). The bacterial cellswere pelleted, washed and suspended in 1.0 mL of water.Approximately 5.0 × 108 cells served as bacterial inoculumfor each specimen.

Plasmid construction

The pGFPK (green fluorescent protein + kanamycin resis-tance) was developed by insertion of a Kan gene next tothe GFP gene in a pGFP vector (Clontech Laboratories

Dow

nloa

ded

by [

Yor

k U

nive

rsity

Lib

rari

es]

at 1

3:12

12

Nov

embe

r 20

14

Recombinant plasmids during composting 281

Table 2. Nucleotide sequences of oligonucleotide primers and probes.

Primers and probes Sequence (5′ → 3′) Application

EK-1 TACGCCGAATTCAACCATCATCGATGAATTGTGTCT Amplify KanEK-2 CTATCCGAATTCTTAGAAAAACTCATCGAGCATCAA sequenceME-1 CTGTCTCTTATACACATCTACGACAGGTTTCCCGACT Generate ME<GFPK>MEME-2 CTGTCTCTTATACACATCTGGCCTATTATTTTTGACACCAK12-IS-L CGCGATGGAAGATGCTCTGTA Generate DNAK12-R ATCCTGCGCACCAATCAACAA standard for the K12 fragmentK12-1 CCCGTAATATAAAGCCGTAAGCA Quantify the K12 fragmentK12-2 GATCACCGCGCTGAATGCK12-P FAM-TATACTTATTTGCGAACATTCCAGGCCGC-TAMRAGFP-1 CCTGTCCTTTTACCAGACAACCA Quantify the GFPK fragmentGFP-2 CACGCTTTTCGTTGGGATCTGFP-P FAM-TACCTGTCGACACAATCTGCCCTTTCGA-TAMRA

Inc., Palo Alto, CA). The Kan gene fragment was ampli-fied from a Tn5 transposon ME<KAN-2>ME (EpicentreBiotechnologies, Madison, WI) by polymerase chain reac-tion (PCR) using primers EK-1 & EK-2 containing EcoRI restriction site (Table 2). The PCR product was purifiedusing the PCR preps DNA purification system (Fisher Sci-entific) and digested by EcoR I (New England BioLabsInc., Ipswich, MA). The digested product was inserted intothe EcoR I site of the pGFP vector according to the con-ventional cloning method.[18] The resultant plasmid wasdesignated as pGFPK and the GFPK gene construct wasinserted into the RSF1010 to generate RSF1010-GFPK.In brief, pGFPK served as a template in a PCR for gen-erating a Tn5 transposon containing the GFPK construct(ME<GFPK>ME) using primers ME-1 & ME-2 that in-cluded the 19-bp mosaic end of the Tn5 tansposase recog-nition sequence (Table 2). Insertion of the GFPK constructinto RSF1010 was carried out by in vitro transposition ofthe ME<GFPK>ME using the EZ::TN transposase (Epi-centre Biotechnologies) according to the manufacturer’sinstructions. The transposition product was transformedinto electrocompetent E. coli C600, which was prepared asdescribed by Sharma and Schimke[19] through eletropora-tion using a MicroPulser Electroporator (BioRad Labora-tories Inc., Hercules, CA) according to the manufacturer’sinstructions. The resultant transformants were screened forharboring of the RSF1010-GFPK plasmid using selectivemedia as described below.

Bacterial enumeration

To study the survival of E. coli C600 harboring the aboveplasmids, each manure specimen retrieved was suspendedin 9.0 mL of LB broth supplemented with 50 µg/mL ofkanamycin, 100 µg/mL of ampicillin and 10 µg/mL ofFungizone. The latter antimicrobial was to inhibit fungiderived from manure. Following 2 min of vortexing, 1.0mL of suspension was serially diluted for enumeration ofE. coli C600 harboring pGFPK (E. coli C600-NM) on LB

agar supplemented with antibiotics as described above orwith an additional 50 µg/mL of streptomycin for E. coliC600 harboring RSF1010-GFPK (E. coli C600-M). Allantibiotics used in the study were purchased from Sigma-Aldrich (St. Louis, MO) except for Fungizone (Squibb,Montreal, QC, Canada). Colonies were enumerated afterthe plates were incubated at 37◦C overnight. The rest of thesuspension was incubated for 24 h at 37◦C, and 10 µL ofthe overnight culture was streaked on the above media fordetection of the low number of the target bacteria in manurespecimens. In addition, the overnight culture was also usedfor exogenous recovery of the plasmids RSF1010-GFPKand pGFPK as described below.

Exogenous recovery of plasmids

For exogenous recovery of pGFPK, 1.0 mL of the aboveovernight culture from the manure specimens was subjectedto plasmid extraction using Minipreps DNA purificationsystem (Fisher Scientific). The purified plasmids were trans-formed into electro-competent E. coli CV601 which weresubsequently plated on LB agar supplemented with 50µg/mL of kanamycin, 100 µg/mL of ampicillin and 30µg/mL of rifamycin. The transformers harboring the tar-get plasmid were confirmed by colony hybridization using adigoxigenin (DIG)-labeled oligonucleotide probe with thesame sequence as GFP probe (GFP-P) (Table 2). Probelabeling was carried out using the DIG DNA Labelingand Detection Kit (Roche Diagnostics Canada, Laval, QC,Canada) and hybridization was performed in accordancewith the manufacturer’s instructions. Exogenous recoveryof RSF1010-GFPK was done by tri-parental mating, us-ing the above overnight culture as the source of plasmiddonors, E. coli CV601 as recipients and E. coli J53 harbor-ing RP4 as helpers. The mating was carried out on cellu-lose nitrate filters as described previously.[20] For controlpurpose, the transfer frequency of RSF1010-GFPK andRSF1010 from E. coli C600 to CV601 was also determinedusing tri-parental mating. The bacterial transconjugants

Dow

nloa

ded

by [

Yor

k U

nive

rsity

Lib

rari

es]

at 1

3:12

12

Nov

embe

r 20

14

282 Guan et al.

were isolated using LB agar supplemented with 50 µg/mLof kanamycin, 50 µg/mL of streptomycin, and 30 µg/mLof rifamycin.

Quantification of the GFPK fragment using real time PCR

For quantitative detection of the GFPK fragment, DNAwas extracted and purified from 1-g manure specimens asdescribed by Guan et al.[15] For control purpose, the DNAextract was subjected to quantitative detection of the K12fragment in the orf264 region of E. coli C600, a E. coli K12derivative. PCR primers and probes targeting the GFPKand the K12 fragments were designed using the Primer Ex-press 3.0 software (Applied Biosystems, Foster City, CA).To generate DNA standard for quantification of the K12fragment, PCR products amplified using K12-IS-L andK12-R primers (Table 2) described by Kuhnert et al.[21]

were inserted into a pGEM-T vector (Fisher Scientific) ac-cording to the manufacturer’s instructions. The resultantplasmids were linearized and used as DNA standards. Forquantification of the GFPK fragment, the pGFP vectorwas linearlized and used as DNA standards. The PCRmixture, in a final volume of 25 µL, was as follows: 1 ×QuantiTect probe PCR master mix (Qiagen, Mississauga,ON, Canada), 400 nM each of primers GFP-1 & GFP-2 orK12-1 & K12-2 (Table 2), 250 nM probe GFP-P or K12-P(Table 2), and 1 µL of DNA extract or DNA standardsin serial dilutions. The reactions were performed in a 7500real-time PCR system (Applied Biosystems) with initial de-naturation at 95◦C for 15 min, followed by 40 cycles at 95◦Cfor 15 s, and at 60◦C for 60 s.

Statistical analysis

Student’s t tests were performed using Microsoft Excel soft-ware to compare the colony forming units (cfu) of E. coliC600-M with those of E. coli C600-NM and the copy num-bers of the GFPK and the K12 fragments in specimens con-taining the two bacteria on each sampling day. Data wereconsidered to be statistically significant when P < 0.05.

Results and discussion

This study assessed the survival of bacteria carrying trans-genes in mobile and non-mobile plasmids in compost. Thisinvolved monitoring the survival of the host E. coli byconventional culture methods on selective media; testingthe biological function of the mobile plasmid RSF1010-GPFK by exogenous tri-parental mating; testing the non-mobile plasmid pGFPK by exogenous transformation andquantifying the transgene fragment GFPK using real timePCR. The insertion of kanamycin resistant and green flu-orescent protein genes between Mob and Tra genes inRSF1010 to generate RSF1010-GFPK did not alter thetransfer efficiency of the RSF1010 plasmid, that remainedat about 6.1 × 10−1 per donor cell. Also, the efficiency

of transforming the electro-competent E. coli CV601 withpGFPK remained similar to that of pGFP, which was 2.2× 107cfu/ng.

During the first 7 days the temperature in compost re-mained below 6◦C (Fig. 1 A) and the numbers of E. coliC600-M and E. coli C600-NM decreased by only 1.5–3.1log10. Also, during this period, the biological function ofplasmids RSF1010-GFPK and pGFPK remained stableas tested by exogenous tri-parental mating or transforma-tion. Previous studies had shown these methods are effi-cient for recovery of mobile or non-moblie plasmids fromenvironmental samples and do not require isolation of hostbacteria.[22−24] Temperatures increased rapidly after day 7and by day 10 they had reached 45.3◦C and 61.5◦C at thelower and upper levels of the compost bin, respectively. Onday 10 neither E. coli C600-M nor E. coli C600-NM was de-tected by culture in specimens that had been held at eitherlevel (Fig. 1 B1 and B2), and both plasmids had lost their bi-ological function. A review by Lorenz and Wackernagel,[25]

indicated that without host protection, plasmid DNA couldbe degraded within minutes into short DNA fragments bynucleases in the environment, thus destroying biologicalfunctions, such as the ability to be transformed or mo-bilized. In comparison, at ambient temperatures rangingfrom 0–8◦C, both E. coli strains survived (Fig. 1 B1 andB2) and the biological activity of RSF1010-GFPK andpGFPK was retained during the 21 day test period. It wasexpected that the mobile plasmid could have survived evenlonger at these temperatures, since an IncQ mobile plasmidsurvived in chicken manure specimens that had been heldunder similar conditions for 27 days.[20]

Real time PCRs that were developed for quantificationof DNA fragments ranging from 1.0 × 102 to 1.0 × 108

copies/g of compost, successfully targeted a small frag-ment of the GFPK transgene and the K12 fragment in theE. coli chromosome. These fragments had been degradedto below the detection limit by day 10, where temperaturesin compost had reached 61.5◦C. At the lower level of thecompost bin that remained below 48◦C, the concentrationof both fragments was reduced by 3–4 log10 but they per-sisted beyond the recovery of their bacterial hosts. The rateof degradation of DNA at different temperatures was likelyinfluenced by differences in the intensity of microbial enzy-matic activity.[26] It is also possible that a small amountof the host E. coli may have remained viable but non-culturable at the lower temperatures and thus protectedthe DNA fragments from nuclease degradation.[27,28] An-other possibility is that the DNA fragments were protectedby the cell wall or other debris and retained the structureneeded for detection by PCR.[29] In comparison, at ambienttemperatures (0–8◦C), the concentration of the DNA frag-ments remained constant in the manure specimens duringthe 21-day test period. The concentrations of the transgenefragment in E. coli C600-M was significantly lower thanthat in E. coli C600-NM (P < 0.5), but the concentrationof the K12 fragment was similar in both strains in compost

Dow

nloa

ded

by [

Yor

k U

nive

rsity

Lib

rari

es]

at 1

3:12

12

Nov

embe

r 20

14

Recombinant plasmids during composting 283

Fig. 1. Survival of E. coli C600-M and E. coli C600-NM and persistence of green fluorescent protein + kanamycin resistance (GFPK)and K12 fragments in manure specimens during composting and at ambient temperatures. Temperatures (A) were the daily averagerecorded by 3 data loggers at the upper level (�) and lower level (�) in compost and outside of compost (•). Standard deviationswere less than 2◦C. Number of E. coli C600-M (B1) or E. coli C600-NM (B2) was the average of duplicate plate counts on triplicatespecimens. Standard deviations were less than 0.7 log10 colony forming units (cfu)/g of compost. Number of the GFPK fragment inE. coli C600-M (C1) or in E. coli C600-NM (C2) was the average of triplicate real time polymerase chain reaction (PCR) on triplicatespecimens. Standard deviations were less than 0.5 log10 copies/g of compost. Number of the K12 fragment in E. coli C600-M (D1)or in E. coli C600-NM (D2) was the average of triplicate real time PCR on triplicate specimens. Standard deviations were less than0.5 log10 copies/g of compost. Open bar = upper level, striped bar = lower level, solid bar = outside.

and at ambient temperatures (Fig. 1 C1, C2, D1, and D2).This indicated that the hosts had different copy numbersof the plasmids.[2] However, the persistent pattern of thetransgene fragment was the same for both plasmids and itwas similar to that of the host chromosomal DNA (K12fragment). This suggested that degradation of the plasmidDNA was not different from that of the chromosomal DNAin compost.

Conclusions

The results of this study give evidence that compostingcould be a safe and effective means for inactivation of bac-terial hosts, destruction of the recombinant mobile and nonmobile plasmids and degradation of transgenic and chro-mosomal DNA fragments that may be contained in organicwastes.

Dow

nloa

ded

by [

Yor

k U

nive

rsity

Lib

rari

es]

at 1

3:12

12

Nov

embe

r 20

14

284 Guan et al.

Acknowledgment

Sincere appreciation is expressed to the Fertilizer Section,Plant Health & Protection Division in the Canadian FoodInspection Agency (CFIA) for providing funds; to Dr. K.Smalla from Federal Biological Research Centre for Agri-culture and Forestry, Germany for providing the bacterialstrains and to M. Sampath, S. Sharma, A. Wasty, C. Gre-nier, who worked at the Ottawa Laboratory-Fallowfield inthe CFIA, for their technical contribution.

References

[1] Singh, A.; Billingsley, K.; Ward, O. Composting: A potentially safeprocess for disposal of genetically modified organisms. Crit. Rev.Biotechnol. 2006, 26, 1–16.

[2] Heuer, H.; Smalla, K. Horizontal gene transfer between bacteria.Environ. Biosafety Res. 2007, 6, 3–13.

[3] Nielsen, K.M.; van Elsas, J.D.; Smalla, K. Transformation ofAcinetobacter sp. strain BD413 (pFG4�nptII) with transgenicplant DNA in soil microcosms and effects of kanamycin on se-lection of transformants. Appl. Environ. Microbiol. 2000, 66,1237–1242.

[4] Gebhard, F.; Smalla, K. Transformation of Acinetobacter sp. strainBD413 by transgenic sugar beet DNA. Appl. Environ. Microbiol.1998, 64, 1550–1554.

[5] Buddenborg, C.; Daudel, D.; Liebrecht, S.; Greune, L.; Humberg,V.; Schmidt, M.A. Development of a tripartite vector system forlive oral immunization using a gram-negative probiotic carrier. Int.J. Med. Microbiol. 2008, 298, 105–114.

[6] Frey, J. Biological safety concepts of genetically modified live bac-terial vaccines. Vaccine 2007, 25, 5598–5605.

[7] Blaesing, F.; Muhlenweg, A.; Vierling, S.; Ziegelin, G.; Pelzer, S.;Lanka, E. Introduction of DNA into actinomycetes by bacterialconjugation from E. coli—An evaluation of various transfer sys-tems. J. Biotechnol. 2005, 120, 146–161.

[8] Trobos, M.; Lester, C.H.; Olsen, J.E.; Frimodt-Møller, N.; Ham-merum, A. M. Natural transfer of sulphonamide and ampicillinresistance between Escherichia coli residing in the human intestine.J. Antimicrob. Chemother. 2009, 63, 80–86.

[9] McCuddin, Z.P.; Carlson, S.A.; Rasmussen, M.A.; Franklin, S.K.Klebsiella to Salmonella gene transfer within rumen protozoa: im-plications for antibiotic resistance and rumen defaunation. Vet. Mi-crobiol. 2006, 114, 275–284.

[10] Poppe, C.; Martin, L.C.; Gyles, C.L.; Reid-Smith, R.; Boerlin, P.;McEwen, S.A.; Prescott, J. F.; Forward, K.R. Acquisition of resis-tance to extended-spectrum cephalosporins by Salmonella entericasubsp. enterica serovar Newport and Escherichia coli in the turkeypoultry intestinal tract. Appl. Envrion. Microbiol. 2005, 71, 1184–1192.

[11] Geisenberger, O.; Ammendola, A.; Christensen, B.B.; Molin, S.;Schleifer, K.-H.; Eberl, L. Monitoring the conjugal transfer ofplasmid RP4 in activated sludge and in situ identification of thetransconjugants. FEMS Mocrobiol. Lett. 1999, 174, 9–17.

[12] Gotz, A.; Smalla, K. Manure enhances plasmid mobilization andsurvival of Pseudomonas putida introduced into field soil. Appl.Environ. Microbiol. 1997, 63, 1980–1986.

[13] Jones, P.; Martin, M. A review of the literature on the occurrenceand survival of pathogens of animals and humans in green compost.

The Waste and Resource Action Programme, www.wrap.org.uk (ac-cessed Nov 2003).

[14] Guan, J.; Spencer, J. L.; Ma, B.-L. The fate of the recombinant DNAin corn during composting. J. Environ. Sci. Health, Part B. 2005,40, 463–473.

[15] Guan, J.; Spencer, J. L.; Sampath, M.; Devenish, J. The fate of agenetically modified Pseudomonas strain and its transgene duringthe composting of poultry manure. Can. J. Microbiol. 2004, 50,415–421.

[16] Rawlings, D.E.; Tietze, E. Comparative biology of IncQ andIncQ-like plasmids. Microbiol. Mol. Biol. Rev. 2001, 65,481–496.

[17] Guan, J.; Chan, M.; Grenier, C.; Wilkie, D.C.; Brooks, B.W.;Spencer, J.L. Survival of avian influenza and Newcastle diseaseviruses in compost and at ambient temperatures based on virusisolation and real-time reverse transcriptase PCR. Avian Dis. 2009,53, 26–33.

[18] Sambrook, J.; Russel, D.W. Plasmid and their usefulness in molec-ular cloning. In Molecular cloning: A laboratory manual, 3rd Ed.;Sambrook, J., Russel, D. W., Eds.; Cold Spring Harbor LaboratoryPress: Cold Spring Harbor, NY, 2001; 1–162.

[19] Sharma, R.C.; Schimke, R.T. Preparation of electro-competentE. coli using salt-free growth medium. BioTechniques 1996, 20,44–46.

[20] Guan, J.; Wasty, A.; Grenier, C.; Chan, M. Influence of temperatureon survival and conjugative transfer of multiple antibiotic-resistantplasmids in chicken manure and compost microcosms. Poult. Sci.2007, 86, 610–613.

[21] Kuhnert, P.; Nicolet, J.; Frey, J. Rapid and accurate identification ofEscherichia coli K-12 strains. Appl. Environ. Microbiol. 1995, 61,4135–4139.

[22] Smalla, K.; Sobecky, P.A. The prevalence and diversity of mobile ge-netic elements in bacterial communities of different environmentalhabitats: Insights gained from different methodological approaches.FEMS Microbiol. Ecol. 2002, 42, 165–175.

[23] Demaneche, S.; Jocteur-Monrozier, L.; Quiquampoix, H.; Simonet,P. Evaluation of biological and physical protection against nucleasedegradation of clay-bound plasmid DNA. Appl. Environ. Micro-biol. 2001, 67, 293–299.

[24] Romanowski, G.; Lorenz, M.G.; Wackernagel, W. Use of poly-merase chain reaction and electroporation of Escherichia coli tomonitor the persistence of extracellular plasmid DNA introducedinto natural soils. Appl. Environ. Microbiol. 1993, 59, 3438–3446.

[25] Lorenz, M.G.; Wackernagel, W. Bacterial gene transfer by naturalgenetic transformation in the environment. Microbiol. Rev. 1994,58, 563–602.

[26] Miyatake, F.; Iwabuchi, K. Effect of high compost temperatureon enzymatic activity and species diversity of culturable bac-teria in cattle manure compost. Bioresour. Technol. 2005, 96,1821–1825.

[27] Reissbrodt, R.; Rienaecker, I.; Romanova, J. M.; Freestone, P. P. E.;Haigh, R. D.; Lyte, M.; Tchape, H.; Williams, P. H. Resuscitation ofSalmonella enterica serovar Typhimurium and enterohemorrhagicEscherichia coli from the viable but nonculturable state by heat-stable enterobacterial autoinducer. Appl. Environ. Microbiol. 2002,68, 4788–4794.

[28] Barer, M.R.; Gribbon, L.T.; Harwood, C.R.; Nwoguh, C.E. Theviable but non culturable hypothesis and medical bacteriology. Rev.Med. Microbiol. 1993, 4, 181–191.

[29] Nielsen, K. M.; Smalla, K.; van Elsas, J. D. Natural transformationof Acinetobacter sp. strain BD413 with cell lysates of Acinetobac-ter sp., Pseudomonas fluorescens, and Burkholderia cepacia in soilmicrocosms. Appl. Environ. Microbiol. 2000, 66, 206–212.

Dow

nloa

ded

by [

Yor

k U

nive

rsity

Lib

rari

es]

at 1

3:12

12

Nov

embe

r 20

14