teori evolusi runtuh

Author: permonoajar

Post on 13-Jul-2015

1.106 views

Category:

Documents


0 download

Embed Size (px)

TRANSCRIPT

Khasanah Natural Science

PENGANTAR Pembaca yang budiman, di dunia ilmu alamiah

TEORI PERANCANGAN CERDASMENYANGGAH TEORI EVOLUSI

(natural science) terdapat pertarungan faham besar khususnya ihwal keberadaan mahluk hidup di dunia. Pertarungan tersebut melibatkan faham darwinisme (teori evolusi) disatu sisi dan di sisi lainnya terdapat aliran penciptaan (creationist), aliran penyanggahan (denial), serta teori perancangan cerdas (intelligent design theory). Pertarungan diawali antara teori evolusi dan faham penciptaan (yang diwakili kalangan gereja) yang sudah berlangsung lebih dari 150 tahun dan sepertinya dimenangkan oleh teori evolusi yang

mungkin karena dipandang lebih ilmiah dibanding sanggahan dari gereja yang dianggap bersifat dogmatis. Aliran penciptaan ini lahir sebagai reaksi terbitnya buku The Origin of Species buah karya Charles Darwin yang merupakan cikal bakal teori evolusi (meskipun

sebenarnya bibit teori evolusi sudah muncul ribuan tahun sebelumnya). mulailah Ajar Permono perlawanan Kemudian pada tahun 90-an muncul dari kubu teori

perancangan cerdas (dari para akademisi di Amerika) yang kemudian diikuti oleh aliran penyanggahan. Aliran penyanggahan ini dipelopori oleh Harun Yahya

1

2

akademisi berkebangsaan Turki. Harun Yahya banyak menyajikan ayat-ayat suci Al Qur an dan penafsiranya yang merupakan sanggahan terhadap teori evolusi, selain itu Harun juga menerbitkan buku bergambar berjudul Atlas Penciptaan yang menggegerkan Eropa karena memuat bukti-bukti fosil hewan dan tumbuhan yang berumur ratusan juta tahun yang fisiologisnya ternyata tidak berubah bahkan sama dengan hewan dan tumbuhan sekarang (ini membuktikan tidak adanya proses evolusi biologis seperti yang dipropagandakan Darwin dan pengikutnya). Lebih lanjut pengetahuan deteksi perancangan

Faham

materialisme

menyatakan

segala

sesuatu di alam semesta ini terdiri atas materi, bila sebatas ini tentu tidak mutlak salah, namun kemudian melanjutkannya dengan pengertian bahwa materi itulah satu-satunya yang ada dan berperan dalam segala hal, lain tidak. Faham ini jelas menolak hal-hal yang bersifat non-materi termasuk agama (ateisme) dan ini sejalan dengan filsafat teori evolusi. Lagi pula faham

meterialisme ini mempunyai pengaruh besar di kancah bisnis dan ilmu pengetahuan dunia. Kritik paling keras atas perkawinan teori dari evolusi Harun dengan Yahya faham terkait

materialisme kini juga mulai diaplikasikan ke ilmu-ilmu sosial dan

datang

propaganda teori evolusi melalui lembaga penyiaran semacam Discovery Channel, National Geographic, budaya, filsafat dan agama. Dalam bidang filsafat dan History agama TPC dapat dipakai untuk menghadang faham penemuan darwinisme (teori evolusi). Bahwa intisari teori evolusi adalah anggapan keberadaan mahluk hidup di alam semesta ini buah dari seleksi alam secara acak tanpa ada peran ilahiah didalamnya. Selanjutnya dalam perjalanan waktu teori evolusi telah bersenyawa dengan berbagai faham negatif yang banyak misalnya yang menganggap bangsa merekalah yang menimbulkan kerusakan di muka bumi yakni: ateisme, terunggul karena merupakan hasil proses evolusi materialisme, rasisme, fasisme dan komunisme. ilmiah terbaru teori(x)

Channel

yang

sering

mempublikasikan evolusi dan

menyebarkannya ke penjuru dunia , dan sayangnya beberapa stasiun televisi dan media masa di Indonesiai sering mengekspos penemuan ilmiah tersebut (yang sesungguhnya sebatas propaganda) tanpa filtrasi secara memadai. Kemudian faham rasisme dan fasisme Hitler

3

4

manusia yang terakhir jelas sejalan dengan pemikiran teori evolusi. Demikian juga dengan ajaran komunisme yang sekuler jelas jumbuh dengan teori evolusi. Itulah

pembanding teori evolusi yang sudah diajarkan lebih dahulu. Pembaca yang budiman, sejatinya buku ini

gambaran peran strategis TPC disamping secara aplikatif dapat bersinergi terhadap displin ilmu-ilmu lain, disamping itu secara filsafati dapat memerangi faham-faham negatif diatas. Pertarungan antara teori perancangan cerdas (intelligent design theory) terus berlangsung terutama

diperuntukkan bagi khalayak umum. Oleh karenan itu penyajian yang bersifat detail teknis dibatasi. Besar harapan penulis akan umpan balik pembaca guna penyempurnaan mengingat teori perancangan cerdas masih sangat terbuka untuk dieksplorasi. Wallahualambisawab

di negara-negara yang tradisi atau budaya ilmiahnya tinggi. Di Amerika perdebatan seru antara teori evolusi dengan teori perancangan cerdas berlangsung setiap bulan yang diliput secara meluas oleh media cetak maupun elektronik. Bahkan saking seru dan teori Penulis

kontroversialnya perancangan

keputusan

perlu

tidaknya

cerdas

diajarkan

dibangku

sekolah

bersamaan dengan teori evolusi hingga diputuskan oleh pengadilan masing-masing negara bagian. Di beberapa negara seperti Inggris, Perancis TPC mulai dikenalkan di bangku sekolah berdampingan dengan teori evolusi. Untuk Indonesia , kiranya perlu dipikirkan untuk memasukkan TPC dalam kurikulum biologi di SMA dan mata kuliah ilmu alamiah dasar di universitas sebagai

5

6

DAFTAR ISI halaman Pengantar

SEKILAS TEORI EVOLUSI Evolusi yang diartikan perubahan inkremental memang ada dan terjadi diberbagai bidang , namun ironinya justru bukan dibidang biologi yang mengawali

Sekilas Tentang Teori Evolusi .............................. Sanggahan Harun Yahya ................................ Teori Perancangan Cerdas Model Matematis E.coli DNA dan Perancangan-------------------Keserasian Makrokosmos ---------------------TPC Ilmu Yang Berkembang ....................... Catatn kaki ............................................ Daftar Pustaka Tentang Penulis

lahirnya istilah tersebut. Teori evolusi yang banyak diketahui orang adalah berawal dari pemikiran Charles Darwin melalui bukunya berjudul The Origin of Species yang di terbitkan pada tahun 1859. Namun sebenarnya landasan pemikiran teori evolusi telah ada jauh sebelumnya. Adalah salah satu aliran filasafat Yunani yakni filasafat materialisme pada kurun waktu ribuan tahun sebelum masehi ditengarai mendasari pemikiran teori evolusi. Ada kesamaan antara filsafat materialisme dengan teori evolusi yakni pemahaman segala sesuatu di alam semesta ini bertitik tolak dari materi semata. Mereka menolak sesuatu yang tidak bisa ditangkap oleh panca indera. Mereka menolak kekuatan supranatural , menolak kegaiban, menolak adanya Tuhan. Titik tolak faham materialisme adalah bahwa segala sesuatu, hidup ataupun tak hidup, hadir di alam semesta adalah kebetulan semata yang kemudian pelan-pelan

7

8

mencapai kondisi teratur. Filsafat materialisme, yang sejatinya bertentangan dengan akal manusia ini, mendorong munculnya teori evolusi di pertengahan abad ke-19 tersebut. Dalam the origin of species yang terdiri atas 14 bab dengan total 247 halaman tersebut menjelaskan berbagai hal terkait dengan asal-usul berbagai macam spesies di bmuka bumi. Namun secara ringkas inti dari teori evolusi (disebut juga darwinisme) adalah seleksi alam dan mutasi acak. Diakatakan bahwa bahwa suatu mahluk yang secara kebetulan beradaptasi pada

karena bernasib mujur dalam perjalanan waktu, nama Darwin begitu menjulang jauh meninggalkan Lamarck. Selain daripada sebab adaptasi atau seleksi alam, mekanisme evolusi menurut penganutnya juga disebabkan mutasi acak. Mutasi acak ini lama-kelamaan secara terakumulasi akan mengubah suatu individu menjadi spesies lain yang sama sekali berbeda dengan nenek moyangnya, proses ini dinamakan evolusi. Dalam hal ini - menurut teori evolusi- manusia adalah hasil paling mutakhir dari proses evolusi ini. Ironinya Darwin sendiri hanya sedikit mengenyam pendidikan di bidang biologi yakni sewaktu mengikuti kuliah umum bidang botani yang diberikan Profesor John Henslow1. Namun dia memiliki minat yang besar pada alam dan makhluk hidup. Untuk itu di lalu bergabung secara sukarela dalam ekspedisi pelayaran dengan sebuah kapal bernama H.M.S. Beagle dan mengarungi berbagai belahan dunia selama lima tahun. Darwin begitu terpesona melihat kenakaragam spesies di setiap tempat yang dikunjungi antara lain jenis burung finch tertentu di kepulauan Galapagos. Terdapatnya variasi pada paruh burung-burung tersebut menimbulkan dugaan di benaknya akibat dari adaptasi terhadap

habitatnya dengan cara terbaik (seleksi alam), akan bertahan dan menurunkan sifat-sifat mereka kepada generasi berikutnya. Pendapat semacam ini sebenarnya jauh hari pernah dilontarkan Jean Lamarck dengan contoh jerapah. Jerapah dikatakannya berevolusi dari binatang yang menyerupai antelop. Perubahan terjadi dengan memanjangkan leher hewan tersebut sedikit demi sedikit dari generasi ke generasi ketika hewan tersebut berusaha menjangkau dahan yang lebih tinggi dalam rangka memperoleh makanan. Jjadi ide teori evolusi oleh Darwin sebenarnya hanya meneruskan filasafat materialisme Yunani dan teori Lamarck. Hanya

9

10

habitat. Darwin

-tanpa melakukan penelitian ilmiah

dan mikroevolusi. Penjelasan diatas mengenai evolusi dan juga penjelasan tentang teori evolusi pada umumnya dikategorikan sebagai makroevolusi. Teori evolusi (baca: makroevolusi) yang berujung pada pada pemahgaman adanya peringsutan dan perpindahan spesies (spesiasi) memang sulit untuk dibuktikan kebenarannya. Sejauh ini para penganut teori evolusi mencoba membuktikan adanya proses evolusi melalui ilmu paleontologi (cabang geologi yang mengkaji kehidupan pra-sejarah melalui fosil-fosil) . Fosil-fosil yang ditemukan kemudian direk-reka untuk mendukung teori evolusi berupa hewan dan fosil manusia. Mereka dengan dukungan media ilmiah (hampir seluruh media masa ilmiah di dunia adalah pendukung teori evolusi baik langsung maupun tidak langsung, hanya segelintir yang obyektif sperti Discovery Institute). Para penganut teori evolusi selalu berupaya mempropagandakan setiap penemuan spesies hewan baru dengan

bidang biologi- lalu menarik kesimpulan bahwa adanya aneka spesies makhluk hidup di dunia ini berasal dari nenek moyang yang sama, kemudian menjadi berbeda satu sama lain akibat dari habitat atau kondisi alam dimana makhluk tersebut hidup. Meski tanpa penelitian ilmiah, teori Darwin kemudian menjadi terkenal dan melegenda karena mendapat dukungan dari para ahli biologi materialis dan para filsuf materialisme pada masanya. Sejatinya, Darwin sendiri tidak begitu yakin dengan teorinya. Dia menuangkan keraguannya

tersebut dalam bab difficulties of the theory pada bukunya diatas. Dintakan bahwa kesulitan-kesulitan muncul terutama mengacu pada catatan fosil dan organ-organ rumit makhluk hidup (misalnya mata) yang keberadaanya kebetulan. musykil dijelaskan kemudian dengan dia konsep

Meskipun

mereka-reka

bagaimana mata bisa terbentuk, namun tidak bisa dipungkiri disitu sangat lemah argumentasi lemah. Makroevolusi dan Mikroevolusi Dalam perkembangannya teori evolusi

menyatakan sebagai spesies perantara dari spesies satu yang berubah ke spesies lain. Begitu juga dengan adanya penemuan serpihan ataupun kerangka manusia yang relatif utuh selalu kemudian dibawa-bawa sebagai makhluk peralihan anatar kera ke manusia.

kemudian dibagi menjadi dua ranah yakni makroevolusi

11

12

Sebagai

contoh

dengan

ditemukannya

kerangka

munculah kaki. Hewan yang konon hasil proses evolusi kemudian hidup di daratan. Begitu di darat mereka para hewan darat tersebut- melihat luasnya langit, maka lambat laun munculah sayap ditubuhnya sehingga sebagian menjadi burung. Sebagian hewan darat lain kemudian pelan-pelan menjadi hewan lain termasuk bangsa kera. Dari sebagian bangsa da yang kemudian pelan-pelan berevolusi menjadi manusia setengah kera. Manusia setengah kera tersebut kemudian berevolusi menjadi manusia purba yang terus berevolusi lanjut menjadi manusia seperti sekarang. Kalau melihat rangkaian proses evolusi seperti diatas tak ubahnya bak dongeng pengantar tidur anak-anak. Memang sejatinya teori evolusi itu hanya khayalan yang tak berbobot ilmiah. Hanya karena setiap kali ada penelitian ilmiah entah itu penemuan fosil maupun bidang biologi khusunya biologi molekuler kemudian diotak-atik dan dibawabawa seolah penemuan tersebut mendukung teori evolusi. Sejauh ini mereka sukses kaum evolusionis-

makhluk yang dinyatakan sebagai kera bipedal (berjalan dengan dua kaki) lantas dengan mudahnya dinyatakan sebagai makhluk hasil evolusi kera yang berjalan ddengan empat kaki (kuadrupedal), yang kemudian makhluk tersebut berevolusi lanjut menjadi manusia. Namun klaim-klaim mereka tentang adanya teori evolusi sesungguhnya sangat lemah bukti dan

cenderung

mengada-ada.

Mereka

mengemukakan

hipotesa-hipotesa seolah-olah sebagai hasil penelitian yang sahih. Kembali ke dasar pemikiran teori evolusi dinyatakan bahwa nenek moyang segala mahluk hidup dalam hal ini hewan dan manusia berasal dari makhluk bersel tunggal. Bagaimana makhluk bersel tunggal hadir didunia karena pekerjaan alam yakni hasil rekasi-rekasi kimia yang entah bagaimana

bahan-bahan di alam kemudian membentuk mekhluk tersebut. Kemudian seiring dengan waktu dan dengan prinsip variasi acak berubahlah makhluk bersel tunggal tersebut menjadi hewan-hewan laut. Hewanhewan laut tersebut kemudian melihat daratan maka sebagian ingin hidup di daratan sehingga kemudian

mepropagandakan teori evolusi karena

berjumbuh dengan kaum meterialis dan kaum ateis yang bermodal besar. Tidak heran jika institusi raksasa

13

14

media masa semacam Discovery Channel (bedakan dengan Discovery Institute), BBC, National

dengan empat kaki (kuadrupedal) yang disebut dengan pro-consul. Pro-consul tersebut kemudian bercabang dua, satu cabang menurunkan kera dan monyet, satu cabang lagi menurunkan manusia. Cabang yang menurunkan manusia tersebut jenis makhluknya disebut Dryophitecus. Salah satu jenis Dryophitecus berkelanjutan dinamakan Ramaphitecus. berevolusi Secara menjadi

Geographic, The History Channel, New Sientist gemar sekali memuat cerita rekayasa teori evolusi tanpa reserve. Orang awam sering terpesona menyaksikan tayangan mereka di televisi atau di majalah yang kelihatannya sangat ilmiah . Ironinya kalau

dicermati dan dipelajari benar-benar pernyataanpernyataan ilmuwan evolusionis yang menjadi

Ramaphitecus

makhluk yang masih mirip kera tapi mampu berjalan tegak dengan dua kaki (bipedal) diduga hadir sekitar 7 juta tahun lalu. Proses evolusi kemudian terus berjalan hingga

rujukan terlalu spekulatif dan sering mengada-ada. Uraian lebih lanjut tentang masalah propaganda melalui media masa raksasa ini akan didapati pada bab Sanggahan Harun Yahya atas Teori Evolusi.

terbentuk makhluk yang dinamakan Australopithecus. Evolusi Manusia Kemudian mengenai evolusi manusia - sama Makhluk ini tingginya sekitar 1,5 meter (jantan) dan 1,2 meter (betina) dan biedal, volume otaknya kecil yakni kurang dari 750 cc.3 Kedua makhluk yakni makhluk bipedal dan Auastralophitecus masih

dengan teori evolusi hewan yang bersifat hipotesis ada banyak hipotesis yang dikemukakan para evolusionis. Diantaranya apa adalah yang dirangkum oleh Richard Leaky dari berbagai rujukan evolusi manusia sebagaimana skema dibawah.2 Dikatakan nenek moyang manusia adalah suatu bangsa kera purba yang hidup puluhan juta tahun lalu dan berjalan

digolongkan waktu

belum manusia . Seiring berjalannya tersebut kemudian dikatakan

makhluk

berevolusi terutama mengalami pembesaran otak. Pada saat mengalami pembesaran otak inilah periode sudah manusia ditetapkan oleh para evolusionis

15

16

dengan ciri penggunaaan kata homo yang artinya manusia.Bagan Teori Evolusi Versi Leakyrevolusi pertanian (10.000 th) revolusi industri (150 th) manusia Neanderthal (34.000 th) kota pertama (5.000 th)

semakin pandai dengan mulai bisa membuat api, itu sekitar 700.000 tahun lalu. Selanjutnya kebudayaan mereka terus meningkat dicirikan yang dengan semakin

kemampuanmanusia modern di Afrika (200.000 th) kemajuan besar dalam pembuatan perkakas (200.000 th )

membuat

perkakas

canggih

diantaranya. Itu terjadi sekitar 200.000

tahun lalu. Kemudian banyak fosil ditemukan yang berusia puluhan ribu tahun yang kemudian disebut sebagai manusia Neanderthal. Mereka semuanya

penggunaan api pertama (700.000 th) 1

0,1

0,01

masa kini

kemudian digolongkan senagai manusia modern ataubukti makan daging menguat

lebih dikenal dengan sebutan Homo sapiens. Namun demikian sebenarnya begitu banyakmakhluk bipedalisme di Afrika (7 juta th) Ramaphitecus

2

Homo erectus sebagiam berimigrasi dari Afrika ke Asia Homo hominid awal pembesaran otak otak Australophitecus

versiPro-consul

evolusi manusia

dimana kadang sering

3

terkesan mengada-ada. Teori evolusi sejatinya masih berupa hipotesa yang selama 150 tahun ini tidak ada5 juta th 10 juta th

4

buktiSumber : Richard Leaky (dengan sedikit modifikasi)

yang

mensahihkan

hipotesa

tersebut.

Penemuan fosil hewan atau manusia memang sering Pada saat terjadi pembesaran volume otak dikatakan terjadi peningkatan kemampuan dalam penggunaan peralatan sehingga disebut dengan Homo hominid (manusia perkakas). Seiring dengan kemampuan berburu binatang yang semakin terjadi. Namun kebanyakan fosil yang ditemukan hanya berupa serpihan sebagian tubuh seperti ruas jari atau sempalan tengkorak dan sebagainya. Tragisnya dengan elemen tubuh yang minor tersebut para evoluionis kemudian mereka-reka bahkan kadang memanipulasi agar segala sesuatunya

meningkat terjadi migrasi Homo erectus dari Afrika ke Asia. Senyampang dengan itu diakatakan mereka

bersesuaian dengan hipotesa yang dibangunnya.

17

18

Sebagai contoh penelitian terakhir menggunakan komputer canngih membuktikan bahwa yang mereka sebut sebagai kera bipedal sejatinya amat disangsikan keberadaannya karena praktis sistem tubuh seperti itu sangat tidak efektif sehigga musykil terbentuk. Berikutnya yang disebut Astralopithecus

Eldredge dan Stephen Jay Gould, mereka sebenarnya menyadari bahwa adanya suatu bentuk antara atau bentuk peralihan antar spesies tidak pernah ada, namun entah kerena malu atau gengsi mereka tetap tidak mau meninggalkan dogma evolusi. Untuk itu mereka mereka-reka dapat suatu model baru yang

sesungguhnya adalah kera asli (bukan bentuk peralihan kera ke manusia). Bahkan hasil penemuan fosil mutakhir menyebutkan bahwa Homo sapiens telah ada 7 juta tahun yang lalu. Ini berarti dalam periode panjang antara manusia, kera atau makhluk apapun yang menyerupai kera pernah hidup dalam kurun waktu yang sama. Jadi para evolusionis - kalau mereka mau jujur- telah gagal membuktikan hipotesa evolusi. Merasa gagal membuktikan kebenaran teori evolusi di ranah fosil, para penganut darwinisme kemudian mencoba mengalihkan argumen mereka tentang evolusi dengan teori lain. Salah satunya adalah apa yang disebut puncuated equilibrium. Teori menyatakan bahwa evolusi tidak terjadi sebagai hasil

barangkali

menolong

teori evolusi dari

knock out. Sebagai contoh dinyatakan bahwa kemunculan burung yang pertama di dunia berasal dari sebutir telur reptil yang megalami mutasi besarbesaran (gross mutation) karena mengalami Kemudian

kecelakaan besar pada struktur gen.

seekor hewan darat dapat mengalami perubahan menyeluruh secara tiba-tiba dan berubah menjadi ikan paus. Tentu saja teori puncuated equilibrium yang aneh ini tidak mendapat respon yang memadai baik dari kalangan penganut teori evolusi itu sendiri apalagi para pakar penentang darwinisme. Dalam dunia biologi praktis musykil adanya mutasi yang memperbaiki informasi genetis atau menambahkan informasi baru padanya. Kalaupun ada mutasi positif itu hanya perubahan internal genetis yang tidak

dari variasi minor, namun dalam perubahan besar dan memberi efek apapun tentang perubahan spesies. tiba-tiba. Pelopornya dalah trio O.H.Shindewolf, Niles

19

20

Mutasi pada dasarnya hanya merusak informasi genetis sehingga mutasi besar-besaran yang

SANGGAHAN HARUN YAHYA ATAS TEORI EVOLUSITeori evolusi dapat bertahan hingga sekarang tak lepas dari pandainya mereka berpropaganda melalui media masa dengan dana besar dukungan kaum meterialis-ateis. Namun patut disyukuri bahwa Tuhan menakdirkan hadirnya anak manusia dari bumi Turki yeng bernama Adan Oktar. Rasanya tidak berlebihan bila dikatakan bahwa Harun Yahya yang merupakan

digambarkan oleh model punctuated equilibrium hanya menhasilkan pengurangan atau perusakan besar-besaran atas informasi genetis. Begitulah akhir-akhir ini para penganut evolusi memasuki ranah baru yakni biologi molekuler dalam uapaya mencari pembenaran atas teori yang usang tersebut. Namun demikian kenyataannya teori evolusi babak belur dihajar penemuan dan pemahaman ternbarukan di bidang biologi molekuler. Salah satunya yakni penemuan spektakuler mesin

nama populernya merupakan orang yang paling paling gigih dalam memerangi faham darwinisme (kemudian disebut teori evolusi) di abad modern ini. Tulisan-tulisan dalam bentuk buku, kumpulan gambar maupun artikelnya menyebar di seluruh antero dunia dalam berbagi bahasa. Sanggahan-sanggahan atas teori evolusi membuat merah telinga dan panas hati para penganut teori evolusi. Berikut beberapa sanggahan Harun Yahya dari berbagai sisi yang begitu telak men-smack down teori evolusi, yang diambil dari berbagai sumber dengan penulisan ulang tanpa meninggalkan substansinya.4 Homo Erectus adalah manusia Salah satu bagian yang kontroversial dalam teori evolusi adalah mengenai skema evolusi manusia .

molekuler yakni falegala bakteri E. coli dimana sistem perputaran flagela sebagai hasil dari perpaduan banyak komponen dari riset ilmiah terbukti tidak

sejalan dengan proses evolusi. Sistem ini kemudian oleh penelitinya diberi nama kerumitan tak teruraikan (irreducible complexity). Mengenai pendalaman

mekanisme flagela bakteri E. coli akan dijelaskan lebih lanjut pada bab Teori Perancangan Cerdas. Namun sebelunya perlu dipahami juga bahwa Teori Evolusi sesungguhnya dalam keadaan compang camping karena ulah seseorang yang bernama Harun Yahya.

21

22

Penemuan fosil-fosil yang kemudian digolongkan dalam kelompok Homo erectus ditempatkan setelah era Australopithecus. Homo erectus oleh para evolusionis diartikan sebagai kera yang berjalan tegak . Penekanan kemampuan tegak begitu penting untuk membedakan dengan spesimen Australopithecus atau Homo habilis. Namun kenyataannya tidak terdapat perbedaan antara rangka manusia modern dengan Homo erectus. Penemuan fosil Anak lelaki Turkana yang semula dengan

otak dan bukan volumenya. Belakangan terbukti bahwa fosil tersebut merupakan kerangka dari anak lelaki berumur 12 tahun, yang ketika dewasa dapat mencapai 1,83 meter yang tidak berbeda dari manusia masa kini. Bahkan seorang evolusionis akhirnya mengakui bahwa Richard Leakey perbedaan antara Homo erectus dan manusia modern tidaklah lebih dari perbedaan ras. Manusia Neanderthal Bagian lain yang juga kontroversial dalam teori evolusi adalah gambaran manusia Neanderthal. Manusia Neanderthal hidup dalam kurun waktu 25.000 hingga 34.000 tahun lalu. Sudah menjadi lazim di buku-buku ajar kalau manusia NeanderthalGambaran manusia Neanderthal

dimasukkan ke dalam kelas Homo erectus

alasan spesimen tersebut mempunyai ukuran rongga otak pada tengkoraknya (900-1100 cc), yang berukuran lebih kecil dari milik manusia modern serta tonjolan alis matanya yang tebal. Namun saat inipun, terdapat banyak orang di zaman sekarang yang memiliki volume otak sebesar Homo erectus misalnya bangsa pigmi. Selain daripada itu terdapat pula sejumlah bangsa yang memiliki alis mata yang menonjol sebagaimana bangsa Aborigin dari Australia. Ilmu biologi modern sudah meninggalkan pemahaman bahwa perbedaan volume otak menunjukkan perbedaan tingkat kecerdasan atau keterampilan. Penelitian mutakhir menunjukkan bahwa kecerdasan lebih bergantung pada pengaturan internal

Sumber: Harun Yahya

23

24

digambarkan begitu primitif dengan muka menonjol seolah-olah dimirip-miripkan dengan muka simpanse. Kemudian mereka biasanya digambarkan

dinosaurus menjadi burung. Ada dua item penting terkait dengan klaim evolusi yakni cakar pada sayap dan giginya. Dari fosil diketahui bahwa Archaeopteryx memiliki cakar pada sayapnya serta gigi dalam paruhnya. Akan tetapi sesungguhnya kedua ciri ini tidak berarti klaim Archaeopteryx adalah makhluk peralihan adalah benar. Pada kenyataannya saat inipun terdapat dua spesies burung masa kini yakni touraco dan hoatzin yang juga memiliki cakar pada sayapnya. Cakar tersebut digunakan untuk bertengger pada dahan pohon. Kedua makhluk ini adalah burung seutuhnya, tanpa mengandung sisa-sisa reptil.

menggunakan pakaian dari kulit binatang dan sedang memegang senjata jenis tombak. Padahal dari penilitian mutakhir ternyata manusia Neanderthal bisa dikatakan sama dengan manusia masa kini. Ibaratnya jika ada seorang Neanderthal menggunakan kemeja dan celana modis mungkin tidak kalah keren dibanding Uya Kuya.Gambaran manusia Neanderthal sesungguhnya

Terbukti sama sekali tidak ada dasar mengatakan Archaeopteryx adalah makhluk peralihan, hanya karena sayapnya bercakar. Kemudian gigi pada paruhFosil Archaeopteryx

Sumber: Wikipedia

Archaeopteryx Adalah Burung Seutuhnya Archaeopteryx, adalah makhluk yang hidup sekitar 150 juta tahun silam dianggap oleh kalangan evolusionis sebagai bentuk peralihan dari reptil jenisSumber: Harun yahya

25

26

Archaeopteryx bukan pula tanda bahwa dia adalah makhluk transisi. Klaim penganut teori evolusi keliru ketika menyatakan adanya gigi-gigi pada Archaeopteryx adalah sisa yang berasal dari reptil. Nyatanya di zaman sekarang pun terdapat reptil yang bergigi, dan ada pula yang tidak. Lagi pula struktur gigi Archaeopteryx dan burung bergigi lainnya sama sekali berbeda dengan struktur gigi dinosaurus. Pun Archaeopteryx bukanlah satu-satunya burung yang bergigi. Dalam catatan fosil, tampak bahwa di masa hidup sesudahnya, terdapat jenis burung lain yang dapat digolongkan sebagai burung bergigi . Terbukti fakta-fakta tersebut menunjukkan bahwa

bukti kebenaran evolusi. Pendapat yang diajukan tersebut berdasar pada pertanyaan, Jika,

sebagaimana pernyataan sumber-sumber agama samawi, kehidupan diawali oleh seorang lelaki (Adam) dan seorang perempuan (Hawa), mengapa beragam ras muncul? Untuk menjawab pertanyaan diatas

dapat dirujuk pada hukum-hukum genetika khusunya tentang variasi. Variasi adalah sebuah istilah dalam ilmu genetika yang merujuk pada peristiwa genetika yang menyebabkan timbulnya berbagai macam ciriciri satu atau sekelompok individu dalam satu spesies. Sumber variasi adalah informasi genetika yang dimiliki setiap individu. Sebagai akibat perkawinan antara individu ayah dan ibu, terjadi pertukaran materi antara khromoson keduanya sehinga gen saling bercampur-baur pada anak-anaknya dan generasi berikutnya. Oleh karenanya tidaklah mengherankan bila akhirnya terdapat ciri-ciri individual yang sangat beragam. Sesungguhnya ciri-ciri fisik yang berbeda antar-ras manusia ditimbulkan oleh variasi informasi genetis yang tidak berarti berevolusi. Untuk jelasnya diilutrasikan sebuah

Archaeopteryx maupun burung-burung purba lainnya yang sejenis bukanlah makhluk peralihan. melainkan burung seutuhnya yang hidup pada masanya. Catatan fosil tidak menunjukkan bahwa berbagai spesies burung mengalami evolusi dari satu jenis ke jenis lainnya. Keragaman Ras Manusia Bukan Bukti kebenaran Evolusi Para penganut teori evolusi berusaha

mengajukan teori keragaman ras manusia sebagai

masyarakat di mana terdapat kelompok individu

27

28

berambut coklat dan bermata coklat lebih dominan, dibandingkan individu-individu berambut pirang dan bermata biru. Dalam perkembabngannya terjadi

orang tuanya bersifat resesif. Demikian juga dengan ciri fisik lainya seperti telinga, hudung akan berpadu seperti itu. Disini jelas terbukti terjadinya variasi yang sangat beragam. Namun demikian ini bukan fenomena evolusi sebagaimana yang dipropagandakan para evolusionis. Ledakan Kambrium Dari ilmu paleontologi diperoleh data sahih bahwa sekitar setengah milyar tahun atau tepatnya 550 juta tahun yang lalu telah muncul tiba-tiba suatu kelompok hewan yang muncul secara tiba-tiba di muka bumi. kurun waktu tersebut berlangsung pada zaman kambrium, sehingga kemunculan berbagai jenis hewan semacam siput, ubur-ubur, udang, kerang, trilobit dan sebaginya secara mendadak dalam jumlah besar disebut dengan ledakan

perbauran dan pernikahan silang yang menghasilkan keturunan berambut coklat dan bermata biru. Disini berarti ciri fisik kedua kelompok itu telah bergabung dalam keturunan berikutnya dan menghasilkan

penampilan baru. Pemahamannya adalah bahwa setiap ciri fisik seseorang ditentukan oleh dua gen. Bisa jadi salah satu gen lebih dominan atau malah keduanya sama kuat. Misalkan ada sepasang gen satu gen dari ibu dan satunya lagi dari ayah - yang menentukan warna mata seseorang. Dalam hal ini warna mata keturunan pasangan tersebut ditentukan oleh gen yang dominan. Pada umumnya, warna gelap lebih dominan daripada warna terang. Jadi, bila seseorang memiliki gen mata coklat dan gen mata biru, maka warna mata keturunannya akan coklat, karena yang dominan adalah gen warna mata coklat. Namun demikian gen yang bersifat resesif tetap diturunkan, dan mungkin muncul pada beberapa generasi berikutnya. Sehingga pasangan ayah dan ibu yang keduanya bermata coklat bisa jadi didapati anaknya bermata hijau. Hal ini disebabkan karena gen warna tersebut pada kediua

kambrium. Yang mengherankan para ahli (baca: memusingkan ditemukannya para hewan evolusionis) apapun adalah sebelum tidak jaman

kambrium tersebut, kecuali sedikit makhluk bersel tunggal dan bersel majemuk yang amat primitif . Ini membuktikan tidak adanya hewan pendahulu atau makhluk peralihan atas hewan-hewan jaman

29

30

kambrium tersebut, berarti tidak ada proses evolusi sama sekali. Yang ada adalah hewan-hewan tersebut sudah berwujud amat kompleks dan saling berlainan sejak saat pertama kali muncul di Bumi. Atlas Penciptaan Atlas Penciptaan merupakan srial buku bergambar buah karya Harun Yahya yang

Lalat 45 juta tahun lalu sama dengan lalat sekarang

Sumber:Harun Yahya Bintang laut 420 juta tahun lalu sama dengan sekarang

menghebohkan Eropa. Pasalnya didalamnya memuat banyak sekali foto yang memuat heawn dan tumbuhan antara yang hidup puluhan juta tahun bahkan ratusan lalu dan yang hidup sekarang. Ternyata praktis tidak ada perbedaan diantara keduanya ini membuktikan evolusi itu tidak ada.Udang Karang 146 juta tahun lalu sama dengan yang sekarang Sumber:Harun Yahya

Pernyataan kesamaan gen manusia dan simpanse adalah kebohongan Gagal di ranah paleontologi, para evolusionis berupaya memperkuat barisan dengan memasuki ranah biologi molekuler. Mereka merilis propaganda tanpa dukungan penelitian ilmiah dan memanfaatkan

Sumber:Harun Yahya

ketidak tahuan kahalayak umum dengan mengatakanLaba-laba Polompat 25 juta tahun lalu sama dengan sekarang

manusia dan simpanse memiliki kesamaan sebesar 99% pada informasi genetis sebagai bukti evolusi kera ke manusia. Ini adalah bukti palsu yang diajukan

Sumber:Harun Yahya

31

32

kaum evolusionis yang memanfaatkan ketidaktahuan orang awam akan masalah ini. Sebuah studi ilmiah yang dilakukan Roy Britten dari California Institute of Technology mengungkapkan bahwa kesamaan genetis anatar manusia dan simpanse ternyata hanya sekitar 95%, Kesimpulan ini diambil berdasarkan data program komputer dengan membandingkan 780.000 dari 3 miliar pasang basa dari heliks DNA manusia dan simpanse. Ia menemukan lebih banyak

mengherankan. Ini dikarenakan molekul penyusun tubuh makhluk hidup adalah sama yakni karbon, nitrogen, hidrogen dan oksigen. Kemudian air dan udara yang dikonsumsi adalah sama, demikian pula makanan makhluk hidup tersusun dari molekul yang sama. Akan tetapi hal sama sekali tidak membuktikan bahwa makhluk hidup berasal dari satu nenek moyang sebagai mana pernyataan teori evolusi. Teori evolusi berlawanan dengan hukum termodinamika Menurut hukum kedua termodinamika (dikenal

ketidakcocokan daripada dugaan sebelumnya yakni 99%. Kesamaan hingga 95% itu sendiri adalah cukup juga sebagai hukum entropi) bahwa dalam keadaan besar mengingat keduanya adalah mamalia (makhluk wajar semua sistem yang dibiarkan sendiri cenderung menyusui). Bandingkan dengan cacing dan nyamuk, teruarai, menjadi acak dan rusak seiring dengan waktu. ternyata DNA manusia juga punya banyak kesamaan. Menurut hukum ini semua benda baik hidup maupun Hasil penelitian menunjukkan bahwa kesamaan benda mati di alam semesta ini akan mengalami hukum antara DNA cacing nematoda dan DNA manusia adalah 75%. Begitu juga Drosophila dengan gen gen lalat buah genus manusia menunjukkan ini. Sebagai contoh jika anda mempunyai sebuah motor model kuno yang sudah tidak dipakai lagi kemudian diletakkan di sudut halaman rumah dan dibiarkan hingga berbulan-bulan bahkan hingga tahunan. Kalau diamati maka seiring dengan berjalannya waktu maka motor tersebut akan rusak. Contoh sebuah rumah yang

kesamaan sebesar 60%. Timbulnya kesamaan sebagian besar gen manusia dan beberapa hewan sebenarnya tidaklah

33

34

baru dibangun, setelah bebera waktu karpet dan jendelanya perlu dibersihkan , lama kelamaan perlu diganti. Demikian juga bagian-bagian lain perlu diperbaiki dan diganti. Belakangan bangunannya sendiri berserta fondasinya perlu direnovasi. Pada akhirnya biaya perawatan dan penggantian komponen rumah tersebut menjadi sangat mahal melebihi biaya bila mebangun rumah yang baru. Itu contoh untuk benda mati, bagaimana dengan benda hidup? Menurut para ahli biologi hukum entropi ini juga bekerja pada makhluk hidup dimana dinyatakan bahwa sang waktu akan melenyakpkan keseluruhan energi yang tersedia bagi kehidupan di alam ini. Dalam keadaan alamiah, tidak ada molekul organik yang rumit dapat terbentuk tiba-tiba melainkan cenderung teruraikan. Propaganda di saluran National Geographic

siasat kaum evolusionis dalam pembohongan kepada publik. dari penelitian yang semakin dealam diketahu dengan pasti bahwa Australopithecus adalah kera seutuhnya yang tidak jauh beda dengan kera saat ini. Banyak ciri-ciri detail yang bisa dikatakan sam dengan kera masa kini seperti tengkorak, kedekatan letak matanya, gigi gerahamnya yang tajam, bentuk

rahangnya, lengannya yang panjang serta tungkainya yang pendek - menjadi bukti bahwa makhluk-makhluk tersebut tidak berbeda dengan kera yang ada saat kini. Pendapat NGC bahwa Australopithecus berjalan tegak adalah pandangan yang dipegang oleh palaeontolog seperti Richard Leakey dan Donald C. Johanson selama puluhan tahun.Namun banyak ilmuwan yang telah melakukan sejumlah besar penelitian tentang bentuk kerangka Australopithecus telah membuktikan tidak validnya pendapat ini. Penelitian besar-besaran yang

Satu film dikumenter berjudul Who Are We? (Siapakah Kita?) telah disiarkan oleh Saluran National Geographic (NGC). Film tersebut yang berisi rekayasa sebagai spesies nenek

dilakukan pada berbagai spesimen Australopithecus oleh dua ahli anatomi tingkat dunia asal Inggris dan Amerika, Lord Solly Zuckerman dan Prof. Charles Oxnard, menunjukkan bahwa makhluk-makhluk

Australopithecus

disebutkan

moyang manusia pertama yakni kera yang berjalan tegak dengan dua kaki (bipedal). Sekali lagi ini hanya

tersebut tidak berjalan tegak sebagaimana manusia, dan bergerak sebagaimana halnya kera modern. Setelah

35

36

mempelajari fosil tulang-belulang selama belasan tahun disimpulkan bahwa Australopithecus adalah spesies

TEORI PERANCANGAN CERDAS Teori Perancangan Cerdas (TPC) adalah

kera biasa, dan sama sekali tidak berjalan dengan dua pengetahuan yang bergerak diranah ilmu alamiah kaki. Barangkali penelitian terpenting yang (natural science) terkait dengan pembuktian ilmiah mengenai adanya perancangan dibalik keberadaan obyek alam (biologi maupun non-biologi). Para menunjukkan bahwa Australopithecus tidak mungkin bipedal dilakukan oleh kelompok ilmuwan dari

Universitas Liverpool yang dipimpin oleh Fred Spoor di 1994. Mereka melakukan penelitian bagian dalam

pendukung perancangan cerdas mengklaim bahwa TPC sama absahnya atau bahkan lebih bila dibandingkan

telinga spesimen fosil Australopithecus. Di bagian dalam dengan teori ilmiah lain saat ini terkait dengan telinga manusia dan makhluk hidup tingkat tinggi pencarian asal muasal kehidupan. lainnya, terdapat organ yakni koklea yang berfungsi mengatur kesimbangan dengan menentukan posisi tubuh dari tanah mirip gyroscope alat pengatur ketinggian pada terbang pesawat. Kesimpulan Barangkali secara meyakinkan - dengan merujuk pada kitab suci - orang mengatakan bahwa keberadaan mahluk hidup di dunia ini tentu bukanlah buatan manusia apalagi alam (dan kenyataannya memang tidak ada seorangpun dapat membuat mahluk hidup. Robot yang tercanggihpun hanya seolah-olah menyerupai mahluk hidup dan faktanya memang tidak sama). Namun kemudian ketika orang tersebut membuktikan secara terperinci diminta atas

penelitian tersebut adalah bahwa Australopithecus berjalan dengan empat kaki (kuadrupal).Ini berarti Australopithecus adalah spesies kera seutuhnya yang tidak ada hubungannya dengan manusia.

(terstuktur)

pernyataannya tersebut, barangkali yang bersangkutan tidak mudah untuk menjabarkannya. Ini menyangkut keyakinan atau kepercayaan dan absah dan sulit untuk

37

38

diperdebatkan.

Kelemahan (kesulitan menjabarkan

(merujuk teori evolusi). TPC lebih bernuansa ilahiah dibanding teori evolusi yang cenderung sekuler. Namun begitu harap dibedakan antara den TPC dengan paham penciptaan (creationist) yang pernah muncul lebih dahulu. Meskipun bernuansa ilahiah TPC berada dalam koridor ilmu alamiah bukan ilmu agama. Namun begitu rasanya tidak perlu mempersilangkan teori perancangan cerdas dengan agama karena sesungguhnya ada keselarasan diantara keduanya. Bahwa dengan

atau membuktikan secara ilmiah) ini dipakai senjata oleh penganut teori evolusi dengan menyatakan bahwa tidak ada bukti campur tangan ilahiah atas keberadaan mahluk hidup, semua itu berlangsung di alam apa adanya . Pun oleh sebagian orang- terutama yang

senang membuat demarkasi ilmiah dan tidak ilmiah pernyataan orang tersebut dikategorikan sebagai dogmatis sehingga oleh mereka tidak dimasukkan dalam ranah ilmiah (perlu diketahui bahwa

pembuktian keberadaan mahluk hidup dan alam semesta tidak terlepas dari peran kekuatan yang teramat cerdas dan dahsyat - diluar kemampuan manusia - maka keimanan sesorang tentunya dapat meningkat ke taraf yang lebih tinggi. Pengetahuan pendukung teori perancangan cerdas adalah: biologi (biokimia dan biologi molekuler), matematika komputasi, teori informasi dan (sedikit) filasafat. Dengan demikian struktur teori perancangan cerdas cukup kokoh sehingga absah dikategorikan sebagai pengetahuan ilmiah (bukan sekedar pseudo ilmiah apalagi tidak ilmiah sebagaimana sangkaan sebagaian orang yang belum / tidak memahaminya). Sebenarnya pengetahuan deteksi tanda-tanda

pandangan terkini dunia filsafat ilmu mengenai segregasi ilmiah , pesudo-ilmiah atau tidak ilmiah sesungguhnya mulai goyah karena dari observasi terkini batasan tersebut menjadi sumir dan absurd . Sekali lagi bahwa teori perancangan cerdas yang selanjutnya disingkat TPC adalah ilmu yang mempelajari informasi atau tanda-tanda perancangan (signs of design) pada obyek alam. Dengan demikian obyek alam - termasuk makhluk hidup - pada dasarnya mengandung unsur atau jejak kreasi kecerdasan. Ini berlawanan dengan faham yang menyatakan bahwa keberadaan mahluk hidup adalah buah dari proses seleksi alam dan variasi acak yang tak terbimbing(x)

39

40

perancangan secara umum telah diterapkan pada bidang arkeologi dalam kategorisasi artefak apakah sebagi hasil karya (perancangan) manusia atau produk alam . Kemudian pada bidang transmisi sinyal kode untuk mendeteksi keberadaan mahluk luar angkasa (search for extra terestrial intelligent, SETI). Dalam bidang forensik, deteksi perancangan dipakai untuk mengenali apakah luka/cacat yang menimpa seseorang sebagai hasil perbuatan manusia atau bukan. Difahami bahwa pembuktian secara kualitatif

teori perancangan cerdas adalah explanatory filter

(x)

.

Obyek alam yang lolos sistem tersebut terindikasi mengandung tanda-tanda perancangan (sign of design) sekaligus menyanggah bahwa kemunculan obyek hidup merupakan hasil dari seleksi alam dan mutasi acak semata (merujuk teori evolusi). Oleh karenanya

menarik dan menantang untuk dilakukan penelitian terhadap obyek alam - seperti makhluk hidup dan yang masuk dalam kategori

kosomolgi alam semesta

kerumitan spesifik. Diduga kuat bahwa semua obyek biologi (mahluk hidup) maupun obyek alam non-biologi dan kuantitatif perlu dihadirkan agar lebih mudah mempunyai kandungan CSI dan sebagian masih mudah dicerna, semata untuk memperkuat tersamar pembuktian adanya perancangan dibalik kehadiran eksplorasi lebih lanjut. Meskipun demikian dalam obyek di alam semesta. Salah satu pendekatan beberapa obyek biologi terdapat petunjuk begitu kuat kuantitatif dalam perancangan cerdas adalah melalui obyek yang sarat dengan CSI diantaranya ada pada otak informasi kerumitan spesifik (complexity specified information, CSI). Didalam CSI terdapat teorema kerumitan spesifik (specified complexity). Kerumitan merujuk pada keadaan obyek yang amat rumit (highly complex) sekaligus amat jarang terjadi (highly dan mata manusia, peristiwa pembekuan darah, bakteri Esherichia coli , DNA (keduanya masuk kategori mikrokosmos) serta alam semesta (masuk kategori makro kosmos). Ketiga obyek terakhir inilah yang akan dibahas lebih lanjut terkait pemahaman TPC. improbable), sedangkan spesifik menandakan adanya pola (pattern) tertentu yang khas dan informatif pada obyek tersebut. Salah satu piranti (sistem) penyeleksi Pada akhir dekade 80-an TPC mulai (tersembunyi) sehingga memerlukan

diperkenalkan, namun perkembangan secara pasti baru

41

42

dimulai di pertengahan 90-an dimana kehadirannya mengguncang jagad ilmu alamiah dan filsafat khususnya di Amerika yang dengan hadirnya buku-buku tentang TPC. Contoh buku yang mulanya dinilai kontroversial seperti The Design Inference dan No Free Lunch karya William Dembski, Darwin Black Box karya Michela Behe serta beberapa artikel ilmiah berbobot tulisan Stephen Meyer. William Dembski adalah profesor bidang filsafat sekaligus pakar statistik inferen, Michael Behe, profesor bidang biologi molekuer dan Stephen Meyer adalah direktur The Discovery Institute. Mereka bertiga

(rpm) dan dapat berganti arah putarannya hanya secara tiba-tiba. Flagela berfungsi sebagai alat penggerak laju bakteri dalam mendekati makanan. Bila diamati dengan mikrograf elektron terlihat bahwa flagela mempunyai komponen yang sangat mekanis layaknya mesin penggerak buatan manusia yakni terdapat stator, ring, sambungan dan sebagainya dan karena saking reniknya maka oleh kalangan biologi disebut sebagai mesin molekuler (mesin berskala molekul). Salah satu upaya agar faham perancangan cerdas dapat lebih diukur, perlu dikembangkan teorema informasi kompleksitas spesifik (complexity specified information, CSI). Analisis kompleksitas itu sendiri dapat

bersama Phillip Johnson dan Jonathan Wells dianggap sebagai pelopor TPC. Model Matematis E.coli Model matematis E.coli diperlukan dalam rangka prembuktian kemustahilan teori evolusi dengan seleksi alamnya. Bakteri Escherichia coli disingkat E.coli mempunyai ukuran hanya beberapa mikron, satu mikron adalah seperseribu milimeter, bisa dibayangkan betapa reniknya. Bakteri tersebut mempunyai flagela (semacam ekor ) yang dapat berputar dengan

menjadi lebih terukur manakala dituangkan dalam suatu model matematis. Pemilihan atas pendekatan statistik Fisherian dan Bayesian menjadi krusial, tetapi sejauh ini pendekatan Fisherian dipandang lebih sesuai. Teori probabilitas (stokastik) model Fesherian matematika

digunakan untuk

melakukan analisis

terhadap terminologi kerumitan spesifik. Diketahui bahwa spesifikasi merupakan unsur penting dalam pengujian signifikasi statistik. Pendekatan Fisherian

kecepatan hingga puluhan ribu putaran per menut

43

44

tentang hipostesa statistik signifikasi, diantaranya adalah tentang eliminasi suatu hipotesis peluang

semacam ekor oleh karena letaknya bisa diujung atau disamping sel bakteri dengan jumlah bervariasi mulai dari satu, dua, tiga, empat hingga delapan flagela per sel seperti terlihat pada gambar 1.Foto Bakteri E.coli dengan flagela

dimana sampel jatuh dalam pra-spesifikasi daerah penolakan Dalam bidang biologi molekuler salah satu penelitian fenomenal yang dilakukan oleh Michael Behe adalah eksplorasi flagela bakteri Escherichia coli . Dalam penelitian tersebut tergambar bahwa flagela bakteri E. coli berbentuk sangat mekanis sebagaimana layaknya kelengkapan mesin penggerak buatan manusia.

Pengamatan atas struktur flagela bakteri E. coli mengungkap adanya keadaan kerumitan(x)

takSumber: Jurnal PNAS Foto bagian pangkal flagela

tersederhanakan (irreducible complexcity)

. Diartikan

bahwa kemunculan seluruh komponen flagela adalah secara bersamaan dalam kesatuan yang tak

terpisahkan alih-alih terbentuk melalui proses evolusi. Dengan demikian manakala salah satu komponen dihilangkan maka hilanglah seluruh fungsi flagela. Bakteri E. coli merupakan bakteri jenis prokariot penyebab sakit perut atau diare. Bakteri ini mempunyai flagela. Flagela adalah semacam ekor yang berfungsi sebagai lokomotif pergerakan bakteri. DikatakanSumber: Jurnal PNAS

45

46

Gambar Komponen Flagela

Flagela dapat berputar belasan ribu hingga puluhan ribu rpm dalam pergerakannya untuk memburu makanan. Seperti pada gambar komponen flagela terdiri atas tiga bagian utama yakni bagian filamen, bagian sudut (hook) dan basal body. Bagian filamen terdiri atas filamen dan tip diujungnya. Bagian sudut terdiri atas sudut dan sambungan. Bagian basal body terdiri atas

Sumber: Jurnal PNAS

ring-L, rod, ring-P, ring-MS, stator, ring-C dan export apparatus. Masing-masing komponen ini mengandung

Fenomena perputaran flagela begitu mekanis hingga mirip dengan mesin hasil rekayasa manusiaGambar komponen flegela bakteri E. Coli

protein yang berbeda-beda terkait dengan fungsinya masing-masing. Deteksi Perancangan Metode deteksi perancangan tertuang dalam skema explanatory filter obyek sangat(x)

seperti pada gambar 5. manakala probabilitas probable)

bahwa suatu keberadaanya

sering

(highly

dikategorikan sebagai produk kebiasaan atau hukum alam . Selanjutnya bila suatu obyek probabilitas kehadirannya lumayan sering (intermmediate

probability) dapat dikategorikanSumber: Wikipedia

sebagai kebetulan .

Bilamana lolos dari filter kedua ini maka yang terakhir obyek diuji melalui filter ketiga yakni kerumitan spesifik

47

48

(specified complexity). Obyek statistiksukses melewati Melalui pendekatan yang fisherian atas filter ketiga diartikan explanatory filter maka sebagai obyek hasil dapat diperoleh model

perancangan dengan ciri polanya (pattern) sangat pola matematis kerumitan spesifik yang kemudian rumit dan mempunyai bersifat mutual yakni berdiri sendiri. flagela bakteri E.coli disubstitusikan kedalamnya .Skema Explanatory Filter Mencari Model Matematis

Basis pencarian MULAI matematis merupakan model turunan dari analisis yang dilakukan William Dembski AnalisisFisherian melalui metode Metode

Explanatory Filter

1YaHigh Probable

N(X; Q,W) =Kebiasaan

e 1/2[(x-Q)/W]22TW2

pendekatan

statistik

fisherian tidakIntermmediate Probability

dengan

modifikasi

dibeberapa bagian. Pendekatan Yafisherian melalui distribusi normal begitu banyak dimanfaatkan dalam statistik terapan diberbagai tidak bidang. Kurva distribusi normal berbentuk seperti gambar tidak 4 dibawah dengan KerumitanSpesifik

Kebetulan

Kebetulan Ya

bentuk yang simetris. Kurva mencapai puncak pada saat X= Q. Luas daerah di bawah kurva adalah 1; di sisi BiologiFlagela

Perancangan

E.coli kanan nilai tengah dan di sisi kiri.

Model Matematis CSI Gambar Kurva Distribusi Normal Flagela E.coli

Sumber: William Dembsky (dengan modifikasi)

50 49

Dalam hal ini X suatu variabel acak dengan harga -w< x 1. Seperti diketahui sebelumnya N

merupakan jumlah agen semiotik yang menyaksikan even dan K adalah jumlah kesempatan dari even untuk terjadi. Menurut Dembski yang melansir perhitungan

untuk terjadi (sejumlah panah). Hanya karena seorang pemanah menggunakan satu panah mungkin tidak

65

66

komputer Seth Loyd batasan yang menaungi N.K sebesar 10120. Namun penulis menetapkan batasan probabilitas semesta (universal probability bound) sebesar 10143. Dasarnya adalah perkalian kumulatif jumlah partikel elementer di alam semesta sebesar 1080 dengan frekuensi maksimum perubahan fisik meteri sebesar 1045 dengan perkiraan umur alam semesta 1018 detik. Dengan demikian besaran 10n y(T) = 10143 adalah untuk model matematis umum kerumitan spesifik: = log2[10n. y(T)P(T|H)] > 1. Besaran y(T) ketika dievaluasi dengan pola (R), menghasilkan kompleksitas tertentu. Dasar penentuan besaran tersebut adalah pola (pattern) protein homolog seluruh elemen flagela. Pola E.coli dan Kerumitan Tak tidak mudah karena pola yang perlu dikonversikan ke bilangan matematis masih belum banyak diteliti. Terkait dengan persamaan informasi kerumitan spesifik atau CSI pola (pattern) informasi diatas, pola yang dipilih adalah bangun protein Tersederhanakan MenentukanSumber: Jurnal PNAS

pada keseluruhan flagela seperti pada gambar 6. Alasan pemilihan adalah bahwa struktur protein terkait langsung dengan fungsi atau sifat yang dibawanya. Jumlah protein yang terkandung dalam flagela bakteri

kerumitan spesifik (CSI) bakteri E.coli memang

67

68

E.coli memang ada beberapa pendapat. Namun menurut penelitian biologi molekuler terkini jumlahnya lebih dari 20 jenis protein. Protein yang terkandung dalam elemen flagela bakteri E.coli niscaya saling terkait satu sama lain dalam suatu yang disebut dengan homolog. Homolog protein diklaim kelompok

Gambar Urutan nukleotida fliDatggcaagtatttcatcgctgggagtcgggtcaggtctggatttaagttccatccttgat agcctcaccgccgcgcaaaaagcgacgctaacccccatttcaaatcagcaatcgtcgttt accgctaaacttagcgcctacggtacgctgaaaagcgcgctgacgactttccagaccgcc aatactgcattgtctaaagccgatcttttttccgccaccagcaccaccagcagcaccacc gcgttcagtgccaccactgcgggtaacgccatcgccgggaaatacaccatcagcgtcacc catctggcgcaggcgcaaaccctgaccacgcgcaccaccagagacgatacgaaaacggcg atcgccaccagcgacagtaaactcaccattcaacaaggcggcgacaaagatccgattacc attgatatcagcgcggctaactcatcgttaagcgggatccgtgatgccatcaacaacgca aaagcaggcgtaagcgcaagcatcattaacgtgggtaacggtgaatatcgtctgtcagtc acatcaaatgacaccggccttgataatgcgatgacactctcggtcagcggtgatgatgcg ctacaaagttttatgggctatgacgccagtgccagcagcaacggtatggaggtctcggtt gccgcccagaatgcgcagctgacagtcaacaacgtcgccatcgagaacagcagcaacacc atcagcgacgcgctggaaaacatcaccctgaacctgaacgatgtcaccacgggcaaccag acgctaaccatcactcaggacacctccaaagcgcaaacggcgattaaagactgggtgaat gcctacaactcgctaatagataccttcagcagcctgaccaaatacaccgccgtagatgcg ggagctgatagccagagttctagcaatggtgcactgctcggcgactccacgctgcggacg attcagacgcagttgaaatcgatgctgagtaataccgtcagttcttccagctataaaacg ttggcgcagattggtatcacgaccgatcccagcgatggcaaactggaactggatgccgac aaactcaccgctgcactgaaaaaagatgccagcggcgtaggtgcattgattgttggcgat ggtaaaaaaaccggcatcacgaccaccatcggcagcaacctgaccagttggctttcgaca acgggcattattaaagccgctaccgatggcgttagtaagaccctgaataaattaactaaa gactacaacgccgccagcgatcgcattgatgcgcaggtcgctcgctacaaagaacaattt acccaactggacgttttaatgacctcgttaaacagcaccagcagctacttaacgcagcag ttcgaaaacaacagtaattccaagtaa

evolusionis sebagai bukti proses evolusi. Namun klaim tersebut belum pernah dibuktikan di laboratorium. Justru pendapat tersebut terbantahkan dengan

penelitian mutakhir yang membuktikan fenomena protein homolog pada bermacam elemen terbentuk melalui kerumitan complexity). Perhitungan pola persamaan CSI flagella E.coli diawali dengan melihat sekuen nukleotida penyusun DNA yang merupakan cetak biru pembentukan protein pada tiap-tiap elemen flagela. Macam nukleotida adalah adenine (a), guanine (g), cytosine (c) and thymine (t). Pertama dilihat urutan nukleotida pada ujung filamen yang terdapat semacam topi (fillament cap) yakni gen fliD atau protein FliD. Urutan pada fliD kemudian dicoba dipasangkan dengan fliC (pairwise allignment) yakni proses tak simultan (mengikuti atau fenomena irreducible

Sumber: KEGG Gambar 8. Urutan nukleotida fliCatggcacaagtcattaataccaacagcctctcgctgatcactcaaaataatatcaacaag aaccagtctgcgctgtcgagttctatcgagcgtctgtcttctggcttgcgtattaacagc gcgaaggatgacgcagcgggtcaggcgattgctaaccgtttcacctctaacattaaaggc ctgactcaggcggcccgtaacgccaacgacggtatctccgttgcgcagaccaccgaaggc gcgctgtccgaaatcaacaacaacttacagcgtgtgcgtgaactgacggtacaggccact accggtactaactctgagtctgatctgtcttctatccaggacgaaattaaatcccgtctg gatgaaattgaccgcgtatctggtcagacccagttcaacggcgtgaacgtgctggcaaaa aatggctccatgaaaatccaggttggcgcaaatgataaccagactatcactatcgatctg aagcagattgatgctaaaactcttggccttgatggttttagcgttaaaaataacgataca gttaccactagtgctccagtaactgcttttggtgctaccaccacaaacaatattaaactt actggaattaccctttctacggaagcagccactgatactggcggaactaacccagcttca attgagggtgtttatactgataatggtaatgattactatgcgaaaatcaccggtggtgat aacgatgggaagtattacgcagtaacagttgctaatgatggtacagtgacaatggcgact ggagcaacggcaaatgcaactgtaactgatgcaaatactactaaagctacaactatcact tcaggcggtacacctgttcagattgataatactgcaggttccgcaactgccaaccttggt gctgttagcttagtaaaactgcaggattccaagggtaatgataccgatacatatgcgctt aaagatacaaatggcaatctttacgctgcggatgtgaatgaaactactggtgctgtttct gttaaaactattacctatactgactcttccggtgccgccagttctccaaccgcggtcaaa ctgggcggagatgatggcaaaacagaagtggtcgatattgatggtaaaacatacgattct gccgatttaaatggcggtaatctgcaaacaggtttgactgctggtggtgaggctctgact gctgttgcaaatggtaaaaccacggatccgctgaaagcgctggacgatgctatcgcatct gtagacaaattccgttcttccctcggtgcggtgcaaaaccgtctggattccgcggttacc aacctgaacaacaccactaccaacctgtctgaagcgcagtcccgtattcaggacgccgac tatgcgaccgaagtgtccaatatgtcgaaagcgcagatcatccagcaggccggtaactcc gtgttggcaaaagctaaccaggtaccgcagcaggttctgtctctgctgcagggttaa

tersederhanakan

Sumber: KEGG

69

70

urutan nukleotida pada filamen menggunakan program harga y(T) adalah 1021 sehingga diperoleh probabilitas BLAST (Basic Local Allignment Tool). Pertautan antara sebesar: dua sekuen mempunyai nilai dengan perhitungan: (*) P(T|H)] < . 10- 143 yang diberi nilai +1 , tidak cocok ( | ) yang diberi nilai 0 dan gap Gambar hubungan antar protein pada flagella ( _ ) yang diberi nilai -1. Menggunakan proses BLAST akan diperoleh konfigurasi optimum

pasangan yang merupakan homolog protein antara keduanya. Demikian juga antara FliD dengan FlgL dan seterusnya hingga protein yang terkandung dalam semua elemen terhubung satu sama lain. Gambar diatas adalah sekuen nukleotida fliD dan fliC. Hasil perhitungan secara menyeluruh yang dilakukan Renyi Liu dan Ochman adalah dengan melakukan perkalian atas protein homolog untuk E.coli diperoleh pola y(T) sekitar 1021. Dengan demikian harga n adalah hasil pengurangan 143 dengan 21 yakni 122. Manakala n disubstitusikan ke persamaan kerumitan spesifik hasilnya adalah: log2 [10122. y(T).P(T|H)] > 1Sumber: Jurnal PNAS

demikian persamaan diatas merupakan Aplikasi riil atas persamaan diatas dapat persamaan umum dimana harga pola y(T) tergantung dilakukan melalui apa yang dinamakan dengan dari obyek yang ditelaah. Dalam kasus flagela E.coli

Dengan

72 71

probabilistic hurdle . Metode ini cukup unik yakni mengukur kecilnya probabilitas ketidakmungkinan

DNA DAN PERANCANGAN Beberapa kalangan sinema internasional beberapa kali

pembentukan flagela melalui pengandaian proses telah mengangkat film dengan tema yang terkait evolusi. Jadi semacam pembuktian terbalik. Akumulasi berbagi probabiltas yang ada manjadi besaran dengan DNA . DNA kepanjangannya deoxyribonucleic acid merupakan cetak biru pembentukan elemen pembangun dan fungsional pada mahluk hidup. DNA yang mempuyai stuktur double helix merupakan polimer hidup dengan unit monomer berjumlah hingga dipastikan mengadung kerumitan spesifik jadi jutaan. Bentuk double helix dapat dianalogikan dengan merupakan CSI dan mengindikasikan obyek tersebut tangga yang dipelintir. Anak tangganya merupakan hasil dari perancangan cerdas. Pembahasan secara nukleotida (terdiri atas empat jenis yakni adenine (A), terperinci mengenai probabilistic hurdle memerlukan guanine (G), penelitian bidang biomatematika lebih lanjut. Drama Penemuan DNA Sejarah penemuan DNA dapat

probabilitas yang kemudian dibandingkan dengan bilangan . 10- 143 . Manakala hasilnya lebih kecil atau sama dengan bilangan pembanding diatas maka obyek

dianalogikandengan permainan puzzle dimana elemenelemen penyusunnya coba untuk diidentifikasi

kemudian dirangkaikan hingga mendapatkan suatu bentuk yang utuh. Dalam kasus memahami DNA permainan puzzle itu berlangsung sekitar 83 tahun ! Perburuan dimulai saat Friederich Miesher pria berkebangsaan Swiss tertarik pada penelitian senyawa kimia sel darah putih. Itu terjadi pada tahun 1869. Dia

73

74

lalu mencoba mengisolasi sel darah putih menggunakan mengurai khromosom menjadi senyawa yang kemudian asam khlorida untuk melarutkan komponen sel kecuali dinamakan asam deoksiribosa atau deoxyribonucleic nukleus (inti pengertian asam yang diturunkan dari inti acid (dengan sel). Nukleus yang tersisa kemudian dimurnikan dengan asam dan basa lemah hingga tersisa sel atau nukleus dan mengandung molekul gula yakni bentuk yang olehnya diberi nama nuklein .elemen ribosa). Selain dari asam deoksiribosa dalam Pakar biologi lain juga terdeteksi adanya namun dengan khromosommelakukan upaya yang sama sejumlah basa metode nukleotida yang berbeda darinya dan ternyata yang kemudian secara berturut-turut mendapatkan bentuk senyawa yang sama (nuklein) dinamakan dengan Adenin (disingkat dengan A), Timin namun menamakannya dengan khromatin . beberapa (T), Citosin (C), Guanin (G) dan Urasil (U). Belakangan tahun berselang, beberapa penelitian mencoba diketahui Urasil (U) tidak terdapat di DNA melainkan di memasukkan indung telur dan sperma kedalam nuklei RNA . Penelitian tidak berhentu sampai disitu namun mendapatkan senyawa lain lagi yakni fospat. atau khromatin tersebut dan ternyata mengindikasikan hadirnya Gambar pita DNA: gula deoksiribosa dan fosfat fenomena hereditas (keturunan). Belakangan nuklein atau khromatin dikenal luas dengan naman khromosom. Selanjutnya penelitian tentang

khromosom tidak begitu berkembang hingga tahunGula Sutton menerbitkan jurnal Fospatberisi hasil 1903 Walterdeoksiribosa yang

riset tentang khromosom dikaitkan dengan hukum Mendel. Enam tahun kemudian upaya mencari faktor utama terkait hereditas ini kemudian dilanjutkan oleh peneliti dari Universitas Kolumbia, Amerika yakni Thomas Morgan dengan spesimen lalat buah. Dalam kurun waktu yang bersamaan peneliti lain telah dapatGambar empat basa nukeotida anak tangga DNA

76 75

Adenin

Timin

menjadi begitu terkenal dan menjadi rujukan selama beberapa puluh tahun sampai pada akhirnya terbukti keliru! Dalam konteks ini memang yang

bersangkutan(Lavene) tidak bisa disalahkan. Hal yang demikian memangGuanin Citosin

lumrah

terjadi di dunia ilmu

pengetahuan, bahwasanya untuk mendapatkan suatu kebenaran ini sering sekali memerlukan kesalahanMekipun pembentuk sepertinya semua komponen (elemen

kesalahan. Ini memang semacam hukum besi bahwa kebenaran yang diperoleh niscaya bersifat sementara sebelum terbukti salah dan digantikan dengan

elemen

khromosom

selanjutnya disebut dengan DNA singkatan dari deoxyribonucleic acid ) sudah diperoleh, namun pendekar-pendekar biologi molekuler tersebut belum mendapatkan bentuk DNA yang sesungguhnya. Mereka telah mengetahui elemen-elemen puzzle namun belum dapat menyusunnya menjadi bentuk yang utuh dan jelas. Upaya berikut dilakukan oleh P. A. Levene yang mencoba mendeskripsikan DNA dengan hipotesanya yang pada masanya sanagat terkenal yakni hipotesa tetranukleotida . Hipotesa ini mengatakan bahwa empat basa nukleotida yang terkandung dalam DNA (A, T, C, G) membentuk rantai berulang yang sangat panjang dengan . urutan Model ini

kebenaran

berikut, demikian seterusnya. Di dunia

ilmiah, pengorbanan semacam ini memang tidak terhindarkan dan kadang kadang sampai ditebus dengan nyawa. Ingat bagaimana Copernicus harus dipenggal kepalanya gara-gara melontarkan pendapat (teori) yang mengatakan bahwa bumilah yang

mengelilingi matahari bukan sebalikanya, padahal dikemudian hari justru pendapat dialah yang terbukti benar. Contoh lain adalah teori gravitasi Newton yang begitu tersohor harus turun panggung dengan

hadirnya koreksi dari Einstein. Menyikapi hal ini maka tidak heran bila Stephen Hawking - pakar astrofisika yang dikalangan ilmuwan digolongkan selebritis karena

ATCGATCGATCGATCGATCGATCG......

77

78

saking pintarnya meski seluruh badannya lumpuh total,dalam suatu peristiwa pernah bermaklumat bahwa kelompok yang perlu sering-sering minta maaf kepada publik adalah para ilmuwan karena kerap membuat kesalahan dalam berkarya. Tonggak penting berkutnya dalam perburuan sifat dan struktur DNA adalah penelitian yang dilakukan Oswald Avery pada tahun 1944. Avery yang bekerja untuk Institut Rockefeller membuat serangkain

Sampai disini tidak ada yang ganjil tentunya. Langkah berikut yang dilakukan Avery adalah mencampur dua jenis bakteri dan mencampurkannya. Disini berarti bakteri mematikan yang sudah mati dicampur dengan bakteri hidup yang tidak mematikan (dari koloni pertama). Campuran bakteri tersebut kemudian

disuntikkan ke tikus-tikus percobaan hasilnya semua mati. Ini mengejutkan ! Bagaimana mungkin bakteri yang sudah mati tiba-tiba bisa hidup kembali? Ini hal yang mustahil, dan kenyataanya mamang bukan ini yang terjadi. Oleh karenanya Avery dibantu dengan dua asistennya Colin MacLeod dan Maclyn McCarty membuat hipotesa adanya medium transfer dari bakteri mematikan yang sudah mati ke bakteri tidak mematikan yang masih hidup, dan itu tidak lain adalah DNA. Dengan memahami salah satu sifat DNA tersebut dan penelitian lanjutan yang dilakukan oleh Chargaff maka struktur DNA semakin difahami (walau pada saat itu justru membuktikan hipotesa tetranukleotida adalah tidak benar). Tahun dilakukan berjalan untuk terus, penelitian banyak

percobaan sebagai berikut. Dia membuat dua koloni bakteri , pertama adalah bakteri yang tidak mamatikan, koloni kedua terdiri atas bakteri yang mematikan. Dari koloni kedua (bakteri yang mamatikan) dia mengambil sebagian untuk kemudian dipanaskan hingga

seluruhnya mati, sebagian sisa koloni dibiarkan hidup. Kemudian dia mangambil bakteri yang sudah dimatikan dan menyuntikkan ke beberapa tikus, hasilnya semua tikus tetap hidup. Selanjutnya dia mengambil bakteri dari sisa koloni yang masih hidup dan menyuntikkan ke tikus, hasilnya tikus tersebut langsung mati. Langkah percobaan berikutnya adalah dengan menyuntikkan ke tikus bakteri dari koloni pertama (bakteri hidup yang tidak mamatikan) hasilnya tikus tatap hidup sehat.

namun

benar-benar

memahami

struktur DNA belum ada lagi kemajuan yang berarti.

79

80

Hingga seorang pemuda dari Indiana , Amerika Serikat, memberikan kontribusi terbesar dalam upaya menguak tabir strukturDNA mengalami saat-saat yang kritis. Disebut pemuda karena masih berusia 23 tahun, namun begitu dalam usia tersebut dia telah menggondol gelar S-3 (Ph.D) bidang genetika virus ! Namanya James Watson. Dengan komunikasi seadanya waktu itu Watson mengetahui bahwa di Eropa terjadi perburuan besar-besaran di kalangan ilmuwan untuk mengetahui dengan persis stuktur DNA. Dengan semangat menyalanyala terbanglah Watson ke benua Eropa tepatnya ke Denmark. Di Denmark dia mendapat banyak informasi yang intinya meyakinkan dirinya untuk ikut fokus kepada ilmu informasi genetika, lebih tepatnya perburuan DNA. Untuk memanuhi gelora penelitian ilmiahnya itulah dia kemudian hijrah ke Inggris karena disanalah pusat perburuan sesungguhnya. Itu terjadi pada tahun 1951. Di habitat baru di Universiras Cambridge itulah Watson kemudian bertemu dengan partner mudanya Francis Kirk. Kirk sebenarnya bukan ahli biologi, dia adalah seorang fisikawan muda yang juga mandalami matematika sinar-X dalam untuk rangka

struktur protein, dan bidang kepakaran itulah yang banyak dibutuhkan Watson. Mereka berdua bekerja dibawah kewenangan Profesor Lawrence Bragg. Dalam beberapa bulan kedepan keduanya telah berhasil melakukan riset yang outputnya - menurut pandangan mereka - sudah struktur DNA. Model berhasil menemukan mereka

DNA

tersebut

presentasikan di laboratorium. Hadir dalam acara tersebut tim dari King s Collage yakni Maurice Wilkins dan seorang peneliti laboratorium namanya Rosalind Franklin. Dalam seminar tersebut justru wanita itulah yang menentang keras model DNA yang ditawarkan Watson-Kirk dengan sanggahan yang sangat logis dan tak terbantahkan. Model triple strand helix yang ditawarkan Watson-Kirk meskipun tidak semuanya keliru namun secara keseluruhan tidak cocok dengan analisis sinar-X. Dalam hal menempatkan gula-fosfat ditepi dianggap langkah maju dari hipotesa sebelumnya yang dilansir beberapa pakar yakni menempatkan gulafosfat di tengah-tengah. Sebenarnya DNA dapat dianalisis dengan beberapa cara, namun metode yang dianggap paling akurat adalah dengan pemindaan dengan sinar-X. Prinsip kerjanya adalah bahwa sampel

pengembangan piranti

mendeteksi

81

82

DNA disinari dengan sinar-X sedemikian sehingga sebagian sinar terhalang oleh elemen DNA sebagian lain (yang tidak mengenai elemen) akan diteruskan, pola ini lah yang kemudian dianalisis. Rosalind termasuk salah satu pakar analisis sinar-X yang mumpuni saat itu. Warson dan Kirk tentu saja kecewa dengan kenyataan itu , tetapi ada yang lebih membuat mereka gundah yaitu bahwa dengan kegagalan menghadirkan model DNA yang sahih, Profesor Bragg atasan mereka memutuskan menghentikan penyelidikan struktur DNA oleh mereka berdua. Watson diminta fokus pada penelitian virus dan Kirk meneruskan program S-3 nya. Waktu terus berjalan Watson dan Kirk sibuk dengan pekerjaan masing-masin. Namun nampaknya keduanya tak bisa ke lain hati sulit melupakan DNA. Bahwa perburuan mencari struktur DNA mereka rasakan sudah kepalang basah, maka sambil bekerja sesuai perintah Profesor Bragg - secara informal mereka tetap meneruskan penelitiannya tentang DNA. Mereka sebenarnya juga berkejaran dengan waktu karena peneliti-peneliti DNA lainnya terus bekerja dan

contoh telah ditemukan oleh penelitian lain bahwa basa Adenin (A) selalu berpasangan dengan Timin (T) dan Guanin (G) selalu berpasangan dengan Citosin (C), sedangkan Urasil (U) adanya tidak di DNA namun di RNA, juga ditemukan varian DNA yang nantinya dikenal dengan DNA-A dan DNA-Z selain DNA-B yang jadi fokus penelitian). Ini ibarat balapan Moto GP dimana pembalap lain terus melintas sirkuit sementara mereka diminta masuk pitstop, tidak menyelesaikan lomba. Imajinasi mereka akan struktur DNA harus tetap menyala selain itu mereka juga pasang mata dan telinga memantau sejauh mana kemajuan penelitian-penelitian lain dalam perburuan struktur DNA yang sedang berjalan. Sampai suatu ketika Watson memberanikan diri menemui Franklin Rosevelt lagi untuk

mengkonfirmasi hasil analisis terakhir mereka, sekalian juga melihat hasil pemindaan DNA dengan sinar-X yang terkini. Watson mengatakan bahwa DNA pasti

berstruktur helix , sedangkan Franklin mengatakan belum ada bukti tentang itu. Selanjutnya entah karena Franklin menganggap Watson tidak berhak lagi (secara formal) terlibat dalam penelitian struktur DNA atau mungkin Watson dianggap terlalu agresif maka Franklin

perlahan sebagian sudah menambah elemen puzzle, sementara mereka malah diminta berhenti (sebagai

83

84

tidak memberikan hasil pemindaan terakhir. Yang terjadi justru perdebatan (lebih tepatnya pertengkaran) seru, sampai-sampai akhirnya Watson gentar dan

perjuangan yang tidak kenal lelah, mereka meyakinkan diri bahwa kali ini mereka harus benar-benar

menemukan model yang sekian lama diburu banyak ilmuwan. Banyak persyaratan dipenuhi yakni:1. Diameter penampangnya 20 Angstrom dan 34 Angstorm untuk kelokannya, jarak antar basa 3,4 Angstrom (1 Angstrom = 10 2. 3.-10

berbalik badan. Tetapi sebelum mencapai pintu laboratorium sekonyong-konyong Watson berbelok ke meja Maurice Wilkins kepala laboratorium Maurice Franklin. Entah bagaimana cara Watson membujuk Wilkins akhirnya gambar pemindaian terakhir dapat diperlihatkan. Pada memoarnya Watson mengatakan mengapa saat bertengkar dengan Franklin dia

teknis yang harus

meter).

Posisi gula fosfat mengikuti pola 5 ke 3 di kedua sisi. Pasangan nukleotida mengikuti aturan Chargaff yakni Adenin Timim (A-T) dan Guanin Citosin (G-

menyerah karena dia takut dipukul oleh Franklin.... Dengan hanya diperlihatkan sekilas (tidak boleh dipinjam) maka di kereta Watson mencoba4.

C). Secara keseluruhan model harus cocok dengan pemindaian sinar-X yang dibuat Franklin dan Wilkins.

menggambar ulang hasil pemindaan terakhir yang barusan dilihat tadi. Setelah bertemu dengan Kirk, Watson berdiskusi panjang dan mencoba membuat model DNA yang baru, namun belum juga memberi hasil seperti yang diharapkan. Waktu terus berjalan, bulan berganti tahun, perobaan dan diskusi terus dilakukan tidak hanya antara mereka berdua namun dengan pakar-pakar lain yang tertarik dengan penelitian mereka. Sampai pada akhirnya pada bulan Februari 1953 Watson-Kirk masih terus berkutat dalam

Buah kerja keras Watson dan Kirk didukung tim laboratorium King s Collage dan tentu saja input baik langsung maupun tidak langsung dengan pakar-pakar lain di seluruh dunia, akhirnya membuahkan hasil yakni dengan Hadiah Nobel yang mereka terima di tahun 1962. Hanya saja anugrah Nobel tersebut serasa agak kontroversial, sebab hadiah tersebut selain mereka berdua juga diberikan kepada Maurice Wilkins. Andai Franklin Rosevelet masih hidup (Franklin meninggal tahun 1958) bukan Wilkins tetapi Franklinlah yang lebih

85

86

berhak menerima Nobel. Kemudian masih ada nama satu lagi yang rasanya juga berhak menerima Nobel dia adalah Linus Pauling. Kenyataannya dalam kurun waktu yang panjang Pauling yang bersama Coret menemukan asam nukleat penyusun DNA, juga melakukan riset yang sama yakni mencari sifat dan struktur DNA dan rupanya arah yang dia meskipun hasilnya belum sempurna namun secara langsung dan tidak langsung

1.

Gula. Molekul deoksiribosa.

gula

penyusun

DNA

adalah

2. 3.

Fosfat. Molekul fospat berupa PO4. Basa. Basa nitogen penyusun molekul DNA terdiri a. Citosin (C) dan Timin (T) yang dihubungkan oleh 2 atom H Adenin (A) dan Guanin (G) yang dihubungkan oleh 3 atom H

b.

Seperti diceritakan sebelumnya bahwa setelah melalui perjalanan yang berliku Watson dan Crick akhirnya menemukan stuktur DNA. Keduanya mengemukakan bahwa kebanyakan molekul DNA berbentuk pita spiralFoto rantai DNA

mempercepat penemuan struktur DNA oleh Watson dan Kirk. Memang begitulah kenyataannya bahwa pemberian hadiah Nobel - sebagaimana pemberian piala Oscar bagi bintang film - acap kali dipenuhi kontroversi.

DNA CETAK BIRU KEHIDUPAN Struktur DNA Keberadaan DNA (deoxyribonuclec acid) pada makhluk hidup sebagian besar terdapat di dalam khromosom. Asam nukleat (nucleic acid) tersusun atas nukleotida yang terdiri atas gula, fosfat dan basa. Molekul DNA merupakan suatu polinukleotida yakni terusun dari sekian banyak nukleotida. Berikut senyawa penyusun DNA: ganda yang saling berpilin (double helix). Deretan gula deoksiribosa dan fosfat merupakan pita (semacam tiang tangga) molekul DNA sedangkan basa yang berupaSumber: Miqel

87

88

ATGC merangkai bagai anak tangga. Model DNA Watson - Crick menggambarkan bahwa satu pilinan penuhGambar DNA dan penjelasannya Gambar DNA dan penjelasannya

A= Adenin T = Timin C = Citosin G = Guanin

S = Gula P = fosfatSumber: acessexelent (dengan modifikasi)

merupakan persenyawaan ester kovalen, sehinggaSumber: Berkely.edu (dengan modifikasi)

ikatannya kuat, tidak mudah putus. Setelah tiang atau pita fosfat dan gula terbetuk, maka keempat basa tersusun sebagai anak tangga dengan komposisi

(360o) terdiri atas 10 basa, sedangkan jarak antara satu basa dengan basa lainnya ialah 3,4 A (1 Angstrom = 10-7 mm). Jadi sebuah pita spiral dalam double helix membuat pilinan penuh setiap 34 A, sedangkan lebar molekul DNA sepanjang double helix adalah konstan sebesar20A. Fosfat terletak diantara molekul gula dan terikat pada 3 C dari satu molekul gula dan pada 5 C dari molekul gula berikutnya. Persenyawaan fosfat ini

tertentu (tetapi A selalu berpasangan dengan T dan G selalu berpasangan dengan C, ini dikenal dengan aturan Chargaff). Selanjutnya diketahui bahwa sebuah

nukleotida selalu memiliki ujung 3

OH dan 5 P,

sehingga dalam double helix terdapat sebuah pita dengan keteraturan susunan 3 --> 5 , sedang pita pasangannya 5 --> 3 .

89

90

Gambar DNA dengan susunan pita dan basa

Gambar Replikasi DNA

Sumber: wikipedia (dengan modifikasi)

Sumber: Cliffsnote (dengan modifikasi)

Replikasi DNA Seperti telah disebutkan diatas bahwa DNA pada umumnya terdapat didalam khromosom dan khromosom terletak di dalam inti sel. Diketahui bahwa dalam tubuh mahluk hidup dari waktu kewaktu selalu terjadi pembelahan sel. Sel yang membelah selalu diawali dengan pembelahan inti sel. Konekuensinya khromosom ikut membelah, demikian pula molekul DNA. dari aturan Chargaff diketahui bahwa sekali urutan nukleotida tertentu terbentuk pada salah satu pita dari double helix, maka urutan nukleotida pada pita

komplementernya

(pasangannya)

dapat

diketahui.

Misalnya saja salah satu pita dari double helix terbaca sebagai 5 ....CCGTACGA...3 maka pita pasangsannya terbaca sebagai 3 ...GGCATGCT...5 . Dengan demikian suatu double helix tertentu pilinan pitanya dapat terbelah dan berfungsi sebagai pasangan untuk

terbentuknya pita polinukleotida baru sehingga DNA baru akan terbentuk. Proses pelipatgandaan molekul DNA itulah yang disebut dengan replikasi DNA. Proses replikasi DNA ini merupakan proses yang rumit namun sangat presisi. Proses sintesis rantai DNA baru memiliki

91

92

suatu mekanisme yang mencegah terjadinya kesalahan pemasukan monomer yang dapat berakibat fatal. Karena mekanisme inilah kemungkinan terjadinya

Namun demikian banyak hal yang berbeda antara RNA dan DNA.51. RNA pada umumnya berbentuk pita tunggal (single strand) sedang DNA pita dobel (double helix). Ukuran molekul RNA lebih pendek daripada molekul DNA. 2. Meskipun molekul RNA juga merupakan

kesalahan sintesis amatlah kecil. Itulah mengapa banyak ahli biologi molekuler yang meyakini bahwa proses ini dapat terjadi melalui suatu perancangan proses yang luar biasa canggih diluar kemampuan manusia. Bagi pakar biologi yang agamis mengakui keberadaan Sang Perancang dan Pencipta yakni Tuhan YME dibalik replikasi DNA. Begitu pula bagi pakar yang berfaham atheis, secara implisit mereka mengakui adanya suatu skenario hebat dibalik replikasi DNA namun mereka menolak bahwa Tuhanlah yang berperan. Bahwa seorang pakar biologi sebut saja Richard Dawkins yang secara akal mengakui adanya kekuatan yang amat dahsyat dibalik keberadaan mahluk hidup namun hanya sebatas itu, dia tidak mengakui dan tdak bisa merasakan kehadiran Tuhan.Inilah misteri hidayah. DUNIA RNA Selain DNA, sel mahluk hidup juga mempunyai asam nukleat lain yakni asam ribonukleat (RNA). Sebagaimana DNA, RNA juga merupakan polinukleotida.3.

polinukleotida namun berbeda dengan DNA yakni pertama, gula penyusunnya adalah ribosa (gula penyusun DNA deoksiribosa). Kedua, salah satu

basanya adalah urasil (U) yang untu DNA adalah timin. Keberadaan DNA umumnya dalam khromosom, sedangkan RNA adanya tergantung dari jenisnya: Massenger RNA (mRNA) terdapat dalam nukleus. mRNA dicetak oleh salah satu pita DNA yang berlangsung di dalam nukleus. Jika urutan basa dalam pita DNA yang mencetak adalah 5 GTCAT --

> 3 maka urutan basa dalam mRNA hasil cetakan adalah 3 SAGUA --> 5 .

Transfer RNA (tRNA) terdapat di dalam sitoplasma. Molekul tRNA mempunyai bentuk seperti daun semanggi. Oleh Holley yang menemukannya dalam

93

94

tahun 1965 dikatakan bahwa pada beberapa bagian, basa-basa memperlihatkan pasangan tetapi tidak membentuk double helix seperti pada molekul DNA. Ribosome RNA (rRNA) terdapat terutama di dalam ribosom. Molekulnya berupa pita tunggal, tidak bercabang dan mempunyai bagian dimana basa komplementernya membentuk pasangan-pasangan tetapi tidak berupa double helix . 4. DNA berfungsi memberi informasi genetikaSumber: nigms

PROTEIN Protein merupakan senyawa yang berperan penting bagi mahluk hidup terkait informasi genetika. Protein dapat dilihat sebagai biopolimer raksasa yang monomernya (senyawa penyusunnya) adalah asam amino. Pada tubuh mahluk hidup umumnya, berat

sedangkan fungsi RNA tergantung dari macamnya yaitu: mRNA (messenger RNA) bertugas menerima

protein kurang lebih setengah dari berat kering. Protein mempunyai fungsi bermacam-macam sesuai dengan kebutuhan pada organisme. Berikut fungsi - fungsi biologi protein yang dilansir oleh Lehninger.6 Protein Pertahanan Banyak protein yang berfungsi mengatur pertahanan organisme atas serangan spesies lain atau melindungi organisme tersebut dari luka. Imunoglobulin yakni

informasi genetika dari DNA. tRNA (transfer RNA) bertugas mengikat asam amino yang terdapat dalam sitoplasma. rRNA (ribosome RNA) bersaman protein membentuk ribososom bertugas mensintesa protein dengan menggunakan bahan asam aminoGambar mRNA, tRNA dan rRNA

antibodi pada verebrata adalah protein yang dibuat oleh limposit berfungsi mengenali dan menetralisir serangan bakteri , virus atau protein asing dari spesies

95

96

lain. Fibrinogen dan trombin merupakan protein yang berfungsi menggumpalkan darah manakala sistem pembuluh terluka. Bisa ular, toksin bakteri dan protein tumbuhan beracun seperti risin juga berfungsi di dalam pertahanan tubuh. Protein Transport Protein transport dalam plasma darah mengikat dan membawa molekul atau ion dari organ ke organ lain. Hemoglobin pada sel darah merah mengikat oksigen ketika darah memgalir melalui paru-paru dan membawa oksigen ke jaringan periferi. Disini oksigen dilepaskan untuk melangsungkan oksidasi nutrien yang

Protein Nutrien dan Penyimpan Biji berbagai tumbuhan menyimpan protein nutrien yang dibutuhkan untuk pertumbuhan embrio tanaman. Contonya adalah protein biji pada gandum, jagung dan beras. Ovalbumin protein utama putih telur dan kasein protein utama susu merupakan contoh lain protein nutrien. Ferritin jaringan hewan merupakan protein penyimpan besi. Protein Pengatur Beberapa protein membantu mengatur aktivitas seluler atau fisiologi. Diantara jenis ini ada sejumlah hormon seperti insulin yang mngatur sejumlah gula yang apabila kurang mrnyebabkan penyakit diabetes , hormon pertumbuhan dan hormon para tiroid yang mengatur transport kalsium dan fosfat. Protein pengatur lain yang disebut represor mngatur biosintesa enzim oleh bakteri Protein Kontraktil Beberapa protein memberi kemampuan pada sel dan organisme untuk berkontraksi, mengubah bentuk dan bergerak. Aktin dan mosin adalah protein filamen yang berfungsi di dalam sistem kontraktil otot kerangka dan didalam banyak sel bukan otot. Contoh lain dalah tubulin, protein pembentuk mikrotiubul (komponen

menghasilkan energi. Plasma darah mengandung lipoprotein yang membawa lipid dari hati ke organ lain. Protein transport lain terdapat dalam membran sel untuk mengikat dan membawa glukosa, asam amino dan nutrien lain melalui membran menuju ke dalam sel. Enzim Enzim adalah protein yang mempunyai peran sebagai katalisator yakni mempercepat reaksi. Nyaris semua reaksi biokimia didalam sel memerlukan jasa enzim. Sampai dengan saat ini diketahi lebih dari 2.000 jenis enzim dengan berbagi macam fungsi katalisator.

97

98

paling

penting

dalam

flagela

dan

silia)

untuk

serangga mempunyai persendian yang terdiri atas protein resilin yang sangat elastis. Keseluruhan variasi fungsi protein diatas sangat ditentukan oleh kombinasi asam amino penyusunnya. Jumlah asam amino penyusun protein adalah hanya 20. Meskipun kelihatan sedikit namun kombinasi protein yang dihasilkan bisa tak terhingga. Coba kita buat simulasi matematis protein dengan penyususun 20 asam amino. Pada protein tripeptida yang tersusun dari tiga jenis asam amino A, B dan C dapat terbentuk enam kemungkinan susunan ABC, ACB, BAC, BCA, CAB dan CBA. Persamaan umum untuk menghitung jumlah kemungkinan deret dari sususnan tersebut adalah n ! (dibaca n fakultas). Bagi tetrapeptida dari jenis asam amino akan diperolah 4 ! = 4 . 3 . 2 . 1 = 24 kemungkinan deret. Bagi suatu polipeptida dari 20 jenis asam amino yang masing-masing terdapat satu kali akan diperoleh 20 ! = 20 . 19 . 18 .18

menggerakkan sel. Protein Struktural Banyak protein yang berfungsi sebagai filamen, kabel atau lembaran penyangga untuk memberikan struktur biologi kekuatan atau proteksi. Komponen utama dari urat dan tulang rawan adalah protein serabut kolagen yang mempunyai daya renggang yang amat tinggi. Hampir semua komponen kulit adalah kolagen murni. Persendian mengandung elastin suatu protein

struktural yang mampu meregang ke dua dimenasi. Rambut, kuku dan bulu burung atau ayam utamanya terdiri atas protein yang tidak larut dan liat yakini keratin. Komponen utama dari serat sutera dan jaring laba-laba adalah protein fibroin. Protein Unik Banyak protein yang fungsinya khusus dan unik yang tidak mudah diklasifikan. Monelin suatu protein tanaman di Afrika mempunyai rasa yang amat manis dan diduga bisa dipakai sebagi pemanis makanan yang tidak menggemukkan. Plasma darah beberapa ikan di Antartika mengandung protein anti beku yang

17

.

16

...

=

2.000.000.000.000.000.000 (2 .10

). Ini hanya satu

polipeptida yang amat kecil dengan berat molekul (BM) 2600. Bagi suatu protein yang mempunyai BM 34.000 yang mengandung 12 jenis asam amino dalam jumlah yang sama terdapat kemungkinan 10300. Oleh karananya

melindungi darah ikan dari pembekuan. Beberapa

99

100

suatu protein yang terususun dari kombinasi asam amino tertentu adalah semacam terprogam lebih dahulu, amat kecil kemungkinan terbentuk secara acak dan dan tanpa perencanaan sebagaimana klaim teori evolusi. Sebaliknya dengan tingkat kerumitan yang amat sangat tinggi dan membutuhkan akurasi proses yang memerlukan kecermatan super penyusunan asam amino menjadi protein membuktikan adanya suatu

Gambar Sel

Sumber: agedefyingbody (dengan modifikasi)

perancangan cerdas dari Zat Yang Maha Agung, yang tidak lain adalah Allah SWT. Bagaimana mekanisme pemrograman pembentukan protein berjalan Berikut tahapan pembentukan protein: Transkripsi Proses ini berlangsung di dalam inti sel. Mulamula sebagian dari double helix DNA membuka dibawah pengaruh enzim RNA polimerase. Setelah double helix membuka maka mRNA dibentuk sepanjang salah satu Sebelum ditemukannya struktur DNA dan RNA orang masih belum memahami bagaimana mekanisme pembentukan protein (sintesa protein). Untuk dari pita DNA yang terurai. Basa pada mRNA ini komplementer dengan basa yang menyusun pita DNA. Jadi andaikata basa pada pita DNA itu CCGAATG maka urutan basa mRNA adalah komplementernya yakni GGCTTAC (seperti diketahui bahwa C selalu

sedemikian sehingga dapat terbentuk tertentu dengan fungsi tertentu pula? Bagaimana Protein Terbentuk ?

protein jenis

memperjelas mekanisme pembentukan protein ada baiknya dilihat struktur sel.

berpasangan dengan G dan A berpasangan dengan T ). Dalam hal ini mRNA telah disalin

101

102

Proses Trankripsi

Translasi Setelah sampai di ribosom tiga basa dari tRNA diebut antikodon berpasangan dengan tiga basa mRNASintesa Protein

Sumber: phschool (dengan modifikasi)

dari DNA yang berarti mRNA telah membawa pesan atau informasi dari gen. Inilah proses transkripsi. Kemudian mRNA yang telah selesai menerima pesan genetik dari DNA segera meninggalkan inti sel melalui pori-pori membran menuju ke ribosom. Senyampang dengan itu tRNA dalam sitoplasma mengikat asam amino yang telah diaktifkan oleh ATP (adenosin tripospat). Sebuah molekul tRNA hanya bisa mengikat satu asam amino, oleh karena jumlah asam amino esensial 20 maka setidaknya diperlukan 20 tRNA. Selain daripada itu proses pengikatan ini dapat berlangsung dengan bantuan enzim amino asil sintetase. Selanjutnya tRNA yang telah mengikat asam amino bergerak menuju ribosom. yang disebut kodon. Sebagai contoh tRNA dengan antikodon CUG hanya dapat berpasangan dengan kodon GAC dari mRNA sambil melepaskan asam amino. tRNA dengan antikodon berikutnya datang untuk berpasangan dengan kodon mRNA dan melepas asam amino yang dibawanya untuk dirangkaian dengan deretSumber: Mariocopa.edu

103

104

asam amino yang ada. Proses ini berlangsung terus menerus dalam ribosom sehingga dihasilkan deret asam

KESELARASAN ALAM SEMESTA Bukti-bukti adanya perancangan di alam tidak

amino yang tidak lain adalah protein. Jenis dan hanya terdapat pada jagad mikrokosmos mahluk hidup banyaknya deret asam amino yang tersusun dalam protein menjadikan protein tersebut mempunyai fungsi tertentu pula (hal ini berseuaian dengan banyaknya organ tubuh yang mempunyai fungsi masing-masing).Foto sintesa protein

namun juga di jagad makrokosmos alam semesta. Alam semesta yang di dalamnya terdiri begitu banyak bintang dan planet yang diketahui masing-masing mempunyai pengaruh daya tarik berada sedemikian sehingga tercapai keselarasan diantaranya dan salah satunya menjadikan bumi dapat dihuni oleh manusia dan mahluk hidup lain. Pun kalau ada gejolak di lama semesta - misal supernova- yakni ledakan sangat dahsyat suatu bintang ternyata pada akhirnya juga bermanfaat mempertahankan keadaan selaras (fine tunned) alam semesta. Pemahaman tentang alam semesta bisa dimulai

Sumber: AES

dari menjajagi perhitungan luas alam semeta itu sendiri. Kesulitan utama menghitung luas alam semesta adalah bahwa alam semesta itu dalam keadaan dinamis yakni terus membesar atau mengembang sebagai efek lanjut dentuman besar awal penciptaannya. Dari percobaan dan analisis terkini para astronom modern yang dilansir oleh wikipedia, jagad raya dengan bentuk yang tertentu

105

106

mempunyai jarak dari ujung ke ujung kira-kira

93

yakni Bima Sakti yang diameternya hanya 100.000 tahun cahaya atau 9.460.800.000.000.000 km.

milyard tahun cahaya (dan ini terus menjauh sebagi efek alam yang terus mengembang). Coba bila dihitung dalam satuan kilometer. Cahaya (sementara ini diketahui sebagai materi yang paling cepat dialam semesta) mempunyai kecepatan 300.000 km / detik. Jadi jarak ujung ke ujung alam semesta sepanjang 93 milyard tahun cahaya adalah = 93.000.000.000 tahun cahaya x 365 hari/tahun x 24 jam/hari x 60 jam/menit x 60 detik / menit x 300.000 km/detik =

Katakanlah bumi berada di bagian tertentu galaksi yakni agak dipinggir (kira-kira 1:4 ujung ke ujung), maka jarak yang harus ditempuh untuk menuju ujung galaksi Bima Sakti adalah 2.365.200.000.000 km yang bila ditempuh dengan pesawat ulang alik memerlukan waktu

33.000.000 tahun (tiga puluh tiga juta tahun tahun) kurun waktu yang lumayan lama juga. Katakanlah suatu saat nanti orang bisa membuat kendaraan ruang angkasa dengan kecepatan cahaya sekalipun masih akan memerlukan 25.000 tahun untuk menuju tepi galaksi Bima Sakti. Rasanya mustahil, karena umur ratarata manusia dibawah 100 tahun. Jadi bagaimana orang bisa keluar galaksi ? Menurut Stephen Hawking (pakar astrofisika dari Inggris yang tubuhnya lumpuh total, namun dikaruniai kejeniusan yang diyakini tidak kalah dengan Einstein) ada jalan keluar ! Jalan keluar tersebut dinamakan lubang cacing (wormhole) yang secara mudahnya dianalogikan seperti kertas yang dilipat sehingga ujung bagian kertas yang tadinya berjauhan menjadi berimpit (sangat dekat) sehingga perjalanan keluar galaksi waktunya dapat dipersingkat dengan

879.854.400.000.000.000.000.000 km atau dibulatkan menjadi 8,8 x 1023 km, suatu jarak yang tak terperi jauhnya! Misalkan pesawat ulang alik dengan kecepatan 72.000 km / jam dianggap memilki bahan bakar yang tidak habis sampai kapanpun, maka untuk menempuh jarak dari ujung ke ujung alam semesta bila dihitung memerlukan waktu selam