Available online at www.sciencedirect.com

gy 578 (2008) 114–122www.elsevier.com/locate/ejphar

European Journal of Pharmacolo

Temporal expression of brain-derived neurotrophic factor (BDNF) mRNAin the rat hippocampus after treatment with selective and mixed

monoaminergic antidepressants

Marianne H. Larsen a,b,⁎, Anders Hay-Schmidt b, Lars C.B. Rønn a, Jens D. Mikkelsen a

a Neurosearch A/S, Ballerup, Denmarkb Department of Neuroscience and Pharmacology, University of Copenhagen, Denmark

Received 15 May 2007; received in revised form 13 August 2007; accepted 28 August 2007Available online 26 September 2007

Abstract

Strong evidence suggests that antidepressants work by induction of neuroplastic changes mediated through regulation of brain-derivedneurotrophic factor (BDNF). This study was undertaken to investigate the time-course of the effect of three antidepressants; fluoxetine,imipramine and venlafaxine, which differentially affect monoamine reuptake, on BDNF mRNA expression in the hippocampus. The consequencesof increased BDNF in the hippocampus are still indefinite. Here, we also determined the effects on the expression of two other genes(synaptophysin and growth-associated protein-43 (GAP-43)) known to be involved in synapse formation and axonal growth and likely regulatedby BDNF. The effects were determined in rats after sub-chronic (7 days) and chronic (14 and 21 days) treatment using semi-quantitative in situhybridisation. BDNF mRNA levels in the dentate gyrus (DG) were increased after treatment with venlafaxine (7, 14 and 21 days) and imipramine(14 and 21 days), but not after treatment with fluoxetine, indicating that stimulation of BDNF mRNA expression is dependent on thepharmacological profile and on the time-course of drug treatment. A transient increase in synaptophysin mRNAwas observed after treatment withvenlafaxine and fluoxetine whereas imipramine had no effect. In the CA3 region a reduction of GAP-43 mRNAwas observed after treatment withimipramine (21 days) and fluoxetine (7 and 14 days). These results suggest that venlafaxine and imipramine, but not fluoxetine, induceneuroplastic effects in the hippocampus through stimulation of BDNF mRNA expression, and that the effect on BDNF is not directly translatedinto regulation of synaptophysin and GAP-43 mRNA.© 2007 Elsevier B.V. All rights reserved.

Keywords: Antidepressant; Brain-derived neurotrophic factor; Growth-associated protein-43; Synaptophysin; Hippocampus; Neuroplasticity

1. Introduction

Several weeks of treatment with monoaminergic antidepres-sants is required to obtain therapeutic effect. The time delay intherapeutic action indicates that these drugs, in addition to theimmediate inhibition of monoamine reuptake and subsequentenhancement of monoamine neurotransmission, may workthrough induction of long-term adaptations in neurotransmittersystems. A neuronal network plasticity hypothesis has evolvedsuggesting that neuronal communication may be compromised

⁎ Corresponding author. NeuroSearch A/S Pederstrupvej 93, 2750 Ballerup,Denmark. Tel.: +45 44608000; fax: +45 44608080.

E-mail address: haldlarsen@hotmail.com (M.H. Larsen).

0014-2999/$ - see front matter © 2007 Elsevier B.V. All rights reserved.doi:10.1016/j.ejphar.2007.08.050

in depressed patients and that antidepressants work through itsrecovery (Castren, 2005; Nestler et al., 2002).

The neurotrophin brain-derived neurotrophic factor (BDNF)stimulates neuroplasticity during development and in adulthood(Huang and Reichardt, 2001; McAllister et al., 1999). BDNF hasbeen closely associated with the pathophysiology of depressionand it has been suggested to play a key-role in the neuroplasticmechanisms that occur during antidepressant treatment (Hashi-moto et al., 2004; Russo-Neustadt and Chen, 2005). In support,increased BDNF levels were observed in post-mortem hippo-campal tissue of patients treated with antidepressants (Chen et al.,2001) and several clinical studies report that antidepressanttreatment increases serum BDNF of depressed patients (Aydemiret al., 2006; Aydemir et al., 2005; Gervasoni et al., 2005; Gonul

115M.H. Larsen et al. / European Journal of Pharmacology 578 (2008) 114–122

et al., 2005). Pre-clinical studies suggest that BDNF exhibitsantidepressant activity on its own, as infusion of BDNF into themidbrain or hippocampus in rats induces antidepressant effects(Shirayama et al., 2002; Siuciak et al., 1997). Interestingly, loss offorebrain BDNF does not induce depressive behaviour in itself,but it can attenuate the antidepressant effect of desimipramine inthe forced swim model (Monteggia et al., 2004). Long-termadministration of different monoaminergic antidepressants isknown to enhance BDNF expression in the hippocampus ofnormal rats (Altar et al., 2003; Coppell et al., 2003; Nibuya et al.,1995). However, the results of the reported studies are incon-sistent as clinically effective compounds showed varied effect onBDNF expression in the rat hippocampus (Altieri et al., 2004;Conti et al., 2002; Dias et al., 2003; Jacobsen and Mørk, 2004;Vinet et al., 2004). It appears likely that the effect of a givenantidepressant on BDNF expression may depend on theselectivity and/or pharmacodynamic profile of the drug. Wetherefore aimed to compare monoaminergic compounds withdifferent pharmacological profiles and examine the temporaleffect and efficacy on BDNF mRNA expression in the differenthippocampal sub-regions.

The effect of the selective serotonin reuptake inhibitor (SSRI)fluoxetine was compared with the dual-action compound (SNRI)venlafaxine and the tricyclic antidepressant imipramine. The drugswere given in doses that have been shown to produceantidepressant effects in behavioural models (Gambarana et al.,2001; Reneric and Lucki, 1998). The effect was measured 24 hafter the last drug injection, as it has been reported that BDNFmRNA levels are stabilized at this time point (Coppell et al., 2003).

In the rat, antidepressant treatment has been shown to increasethe density of serotonergic axons and dendritic spine synapseformation (Hajszan et al., 2005; Zhou et al., 2006). It is likely thatsuch effects are mediated through BDNF and this might provideother biomarkers of antidepressant effect in animal models. Inorder to investigate possible molecular events, triggered byBDNF, we also analyzed the hippocampal mRNA expression ofgrowth-associated protein-43 (GAP-43) and synaptophysin in thesame animals. GAP-43 is a neural-specific phosphoproteinimportant for guiding the growth of axons (Benowitz andRouttenberg, 1997; Widmer and Caroni, 1993) and it can be usedas a marker of presynaptic axonal plasticity. Synaptophysin is anintegral membrane protein of presynaptic vesicles where it isinvolved in exocytosis and neurotransmitter release (Greengardet al., 1993; Rehm et al., 1986; Wiedenmann and Franke, 1985),and it is accepted as a useful marker for synaptic density (Masliahet al., 1991; Masliah et al., 2001). Post-mortem studies havereported that GAP-43 and synaptophysin levels are decreased inbrains of patients suffering from affective disorders (Eastwoodand Harrison, 2001; Hrdina et al., 1998), and pre-clinical studiessuggest that both synaptophysin and GAP-43 are regulated byantidepressant treatment (Chen et al., 2003; Rapp et al., 2004).

This is the first study to present detailed temporal profiles ofthe effects of three antidepressants with different pharmacologicalprofiles on the expression of BDNF mRNA and to correlatechanges in BDNF to changes in neuronal plasticity evaluated bymeasuring GAP-43 and synaptophysin mRNA expression levels.The three antidepressants were tested under the same conditions

and all genes were analyzed in the same animals allowing adetailed comparison of the effects of each drug on each of thethree gene transcripts and their time-course of activity.

2. Materials and methods

2.1. Animals

Male Sprague–Dawley rats (200–250 g, Crl:SD) were caged intype 3 macrolon cages (2 rats/cage) under a 12 h light/dark cyclewith free access to standard food and tap water. All animals wereallowed to acclimate under the same conditions for 5 days beforethe first injection. The experiments were conducted in accordancewith the Declaration of Helsinki, the Danish National Guide forCare and Use of Laboratory animals and the European Commu-nities Council Directive of 24 November 1986 (86/609/EEC).

2.2. Drug treatment and tissue processing

Animals (n=7–8 in all groups) were randomly subjected toeither acute, sub-chronic or chronic treatment with fluoxetine(synthesized by Siegfried Ltd, Zofingen, Switzerland), venlafax-ine (synthesized by Department of Medicinal Chemistry,NeuroSearch A/S, Denmark), imipramine hydrochloride (Sigma-Aldrich Chemie GmbH, Steinheim, Germany) or physiologicalsaline. All animals were weighed weekly throughout theexperiment. In the acute experiment, rats received a single i.p.injection with one of the three drugs (10 mg/kg, 5 ml/kg) or withvehicle (5ml/kg). In the chronic studies, animalswere divided intofour groups receiving a daily (between 9 and 11 a.m.) i.p. injection(10mg/kg, 5 ml/kg) for either 1, 7, 14, or 21 days. Importantly, thedifferent antidepressants were studied in three separate experi-ments. The animals were anesthetized with mebumal (SAD,Denmark) (50 mg/kg, i.p.) immediately before decapitation 24 hafter the last injection. The brains were quickly removed andfrozen on dry ice, and stored at −80°C until further processing.

Twelve μm coronal sections were cut from the dorsalhippocampal formation (−3.60 to −4.16 relative to bregma)(Paxinos and Watson, 1998) using a Leica CM 3050 cryostat.Four consecutive sections were collected directly on poly(L-lysin)-coated microscope glass slides (Superfrost Plus Object-träger, Menzel-Glaser, Germany). Slides were stored at −80 °Cuntil used for in situ hybridisation.

2.3. In situ hybridisation histochemistry (ISHH)

Sections from all animals from the same experiment wereprocessed in the same in situ hybridisation experiment for each ofthe transcripts in order to obtain the highest level of standardi-zation and to avoid inter-assay variability. Slides were incubatedfor 5 min in 4% paraformaldehyde in 0.2 M PBS, washed twicefor 1 min in PBS before acetylation for 10 min (0.25% aceticanhydride, 0.1 M triethanolamine in 0.9% NaCl, pH 8.0) at roomtemperature. The slides were then delipidated and dehydrated in aseries of ethanol (70%/5 min; 80%/1 min; 95%/2 min; and 99%/1 min) and finally incubated for 5 min in chloroform. Excessivechloroform was washed off the slides in 99% and 96% ethanol,

116 M.H. Larsen et al. / European Journal of Pharmacology 578 (2008) 114–122

and the slides were air-dried. Synthetic oligonucleotides comple-mentary or identical tomRNAencoding the following genes wereused (DNA Technology A/S, Denmark): BDNF (exon V) (5′GGT CTC GTA GAA ATA TTG CTT CAG TTG GCC TTTTGATACCGGGAC3′), GAP-43 (5′CGTCTTTGAGCTTTTTCC TTG TTA TGT GTC CAC GG) (Coppell et al., 2003;Gregersen et al., 2001). Three different oligonucleotidescomplementary to the bases 157–190; 558–604; 770–812 ofthe rat synaptophysin cDNA (Südhof et al., 1987) weresynthesized. The three oligonucleotides produced identical ex-pression profiles in the hippocampus similar to those reported byEastwood et al. (1994). It was decided to use the synaptophysin(bases 157–190) (5′TGTTGGCACACTCCACGCTCAGCCGAA GCT CCC CGG TGT AGC TGC 3′) for the study. Theoligonucleotides were 3′-tail labelled with α-[35S]dATP(N3000 Ci/mmol, GE Healthcare, UK) using terminal deoxynu-cleotidyl transferase (Roche Diagnostics GmbH, Germany). La-belled probewas added at a specific activity of 1×106 cpm/100μlto the hybridisation buffer containing 45% formamide (v/v),4×saline sodium citrate (SSC) (1×SSC in 0.15MNaCl, 0.015MNaCitrate·2H2O, pH 7.2), 1×Denhardts solution (0.02% ficoll,polyvinylpyrrolidone and bovine serum albumin) (Sigma), fishsperm DNA (0.5 mg/ml) (Roche Molecular Biochemicals A/S,Denmark), 0.25 mg/ml yeast t-RNA and 10% (w/v) dextransulphate and 10 mM dithiothreitol. After overnight incubationwith 100 μl of the hybridisation mixture/slide (37 °C) the slideswere transferred to 4 rapid consecutive washes in 1×SSC (roomtemperature) followed by washing for 4 times 15 min in 1×SSC(55 °C) and for 2 times 30 min in 1×SSC at room temperature.Finally, the sections were dried and exposed together with 14Cmicroscales (Amersham Bioscience, England) to a KodakBiomaxMR film (GE Healthcare) for 2–18 days depending onthe level of expression of the mRNA.

2.4. Data analysis and statistics

Micrographs were taken (Nikon DN 100) and standardcurves were created using 14C microscales. Using the computerimage analysis system (ImagePro®Plus, Media Cybernetics,Maryland) equivalent areas of the hippocampal sub-regions,CA1, CA3, and granular cell layer of the dentate gyrus wereoutlined and the grey density value of mRNA signal wasmeasured in terms of nCi/g tissue. Hippocampal sub-regions

Fig. 1. Photomicrographs of representative coronal sections from vehicle treated rats,revealed by 35S radioactive in situ hybridisation. In the experimental studies the BDdentate gyrus (DG) and in the CA3 region of the hippocampus. The synaptophysin mRin the CA3 and CA1 regions of the hippocampus. GAP-43 mRNA levels were quan

were analyzed bilaterally on 3–4 sections from each animal toobtain a mean value by an observer not aware of the nature ofthe animals. In order to eliminate any variation in backgroundlevels, the grey density value (nCi/g tissue) of the corpuscallosum white matter from each section (background) wassubtracted from each measurement. No signal was detected byBDNF oligonucleotide sense probe.

In order to allow a full comparison of the temporal profile forall drugs and all gene transcript profiles, the expression levels areexpressed as % change relative to acute treatment with therespective drug or saline as all sections could not be exposed to thesame film. The data were analyzed using a one-way ANOVAfollowed by Fisher's LSD post-hoc test. All statistical analyseswere performed with SigmaStat 2.03 (SigmaStat StatisticalSoftware). Differences were considered statistically significantat P valuesb0.05.

3. Results

Temporal effects of antidepressant treatment on the BDNF,synaptophysin and GAP-43 mRNA expression in the rathippocampus were investigated by radioactive in situ hybridisa-tion using 35S-labelled oligonucleotide probes. The distribution ofBDNFmRNA, synaptophysin mRNA andGAP-43mRNA in thevehicle treated rat brain is shown in Fig. 1. The expression leveland distribution of the mRNAs are similar to previous reports(Coppell et al., 2003; Meberg and Routtenberg, 1991; Phillipset al., 1990). In particular, BDNF mRNA levels are much higherin the CA3 and granular cell layer compared to CA1 whereas theexpression of GAP-43 in the granular cell layer is close tobackground levels, while synaptophysinmRNA levels are high inall the hippocampal sub-regions (Fig. 1). Accordingly, expressionwas onlymeasured in hippocampal sub-regionswhere levelswereclearly distinguishable from background levels.

3.1. Chronic treatment with venlafaxine and imipramineincreased BDNF mRNA expression in the granular cell layerof the dentate gyrus

Densitometric analysis of the BDNF mRNA expression wascarried out on the granular cell layer and on the CA3 region of thehippocampal formation. In line with previous findings (Coppellet al., 2003; De Foubert et al., 2004; Nibuya et al., 1995) no effect

depicting the expression pattern of BDNF, synaptophysin and GAP-43 mRNA asNF mRNA expression levels were quantified in the granular cell layer of theNA levels were measured in the granular cell layer of the dentate gyrus (DG) andtified in the CA3 and CA1 regions of the hippocampus.

Table 1Effects of fluoxetine, imipramine or venlafaxine on BDNF, synaptophysin andGAP-43 mRNA expression levels in the granular cell layer (GCL), CA1 andCA3 regions of the rat hippocampus, 24 h after a single injection

Saline Fluoxetine Imipramine Venlafaxine

BDNF GCL 100±8.6 105.1±7.1 107.9±7.2 105.6±5.1CA3 100±3.7 99.3±2.9 105.2±3.7 102.4±2.9

Synaptophysin GCL 100±1.8 101.5±3.4 98.9±2.9 96.0±1.8CA1 100±2.9 98.9±3.5 102.7±3.2 98.2±2.7CA3 100±2.5 102.0±1.9 99.6±2.6 96.2±1.5

GAP-43 CA1 100±8.4 97.9±6.5 104.1±2.1 102.0±3.5CA3 100±4.4 100.7±4.9 100.4±2.4 101.9±1.9

Data are expressed as % change of vehicle treatment. Data are presented asmean±S.E.M. (n=7–8).

117M.H. Larsen et al. / European Journal of Pharmacology 578 (2008) 114–122

was seen on BDNF mRNA expression after a single treatmentwith any of the antidepressants as compared to vehicle (Table 1).Expression of BDNF mRNA in the hippocampus after 1 and21 days of treatment is illustrated in Fig. 2. Quantitations ofthe changes observed following antidepressant treatments areshown in Fig. 3. In the granular cell layer a significant increase(38%; F(3,28)=11.51; Pb0.05) in BDNF mRNA expressionwas observed after 7 days of treatment with venlafaxine and thiseffect was sustained for both 14 and 21 days of treatment(Fig. 3A). A significant increase in BDNF mRNA expression inthe granular cell layer was also seen after treatment withimipramine, but only after 14 and 21 days of treatment (21%;F(3,28)=3,8; Pb0.05) (Fig. 3A). By contrast, no effect on theBDNF mRNA expression in the granular cell layer was found atany time points after treatment with fluoxetine or vehicle (Fig.3A). BDNF mRNA levels in the CA3 region were unaffected bytreatment with fluoxetine, venlafaxine or vehicle whereaschronic treatment (21 days) with imipramine resulted in asignificant reduction (Fig. 3B; 24%; F(3,28)=5.5; Pb0.05).Levels in the CA1 were too low for quantification.

3.2. Transient induction of synaptophysin in the hippocampusafter treatment with fluoxetine and venlafaxine

The temporal effects of antidepressant treatment on synap-tophysin mRNA expression were examined in the granular cell

Fig. 2. Representative micrographs of in situ hybridisation for BDNF mRNA in rat(a single injection) or chronically (21 days) with saline, fluoxetine, venlafaxine or im

layer, the CA1 and CA3 regions of the hippocampus. As forBDNF no effects on synaptophysin mRNA expression wereobserved in any of the regions after a single treatment with anyof the antidepressants, as compared to vehicle (Table 1). Bothfluoxetine (Fig. 4A; 12%; F(3,26)=3.8; Pb0.05) and venlafax-ine (Fig. 4A; 12%; F(3,28)=4.7; Pb0.05) produced asignificant increase in synaptophysin mRNA levels in thegranular cell layer, but only after 7 days of treatment. Longerexposure to the drugs had no effect in this region. In the CA1,synaptophysin mRNA level was significantly increased after7 days of treatment with venlafaxine (Fig. 4B; 15%; F(3,28)=10.5; Pb0.05) and this effect persisted after 14 days oftreatment (Fig. 4B). A similar expression profile was observedafter treatment with fluoxetine, however, significance was onlyreached after 14 days of treatment (Fig. 4B; 16%; F(3,26)=3.2;Pb0.05). A significant increase was also seen in the CA3 after7 days of treatment with venlafaxine (Fig. 4C; 16%; (F(3,28)=6.0; Pb0.05) whereas no effects were observed after treatmentwith fluoxetine in this region. In all three hippocampal sub-regions the synaptophysin mRNA levels returned to baselinelevels after 21 days of treatment (Fig. 4A–C). Neither imip-ramine nor vehicle treatment affected synaptophysin mRNAexpression in any of the hippocampal sub-regions at any timepoint (Fig. 4A–C).

3.3. GAP-43 mRNA expression is reduced in the CA1 and CA3regions after chronic treatment with fluoxetine and imipramine

GAP-43 mRNA levels were measured in the CA1 and CA3regions of the hippocampus. GAP-43 mRNA levels were notaffected in any of the hippocampal sub-regions after a singletreatment with any of the antidepressants, as compared to vehicle(Table 1). The temporal effects of antidepressant treatment onGAP-43 mRNA expression in the hippocampus are shown inFig. 5. Treatment with venlafaxine did not affect the GAP-43mRNA expression in the CA1 region significantly at any timepoint (Fig. 5A). A modest decrease (19%) was observed in theCA1 region after 7 and 14 days of treatment with fluoxetinewhereas a significant reduction in GAP-43 mRNA expressionwas seen after 21 days of treatment with imipramine (Fig. 5A;

hippocampus. The micrographs show sections from rats treated either acutelyipramine. In all cases the animals were sacrificed 24 h after the last injection.

118 M.H. Larsen et al. / European Journal of Pharmacology 578 (2008) 114–122

22% decrease; F(3,28)=3.9; Pb0.05). In comparison to acutetreatment, a decrease in GAP-43 mRNA was found in the CA3region after 7 days (Fig. 5B; 26% decrease; F(3,28)=6.4;Pb0.05) and 14 days (Fig. 5B; 27% decrease; F(3,28)=6.4;Pb0.05) of treatment with fluoxetine. The expression level ofGAP-43mRNA in the CA3 regionwas also lower after 21 days oftreatment with fluoxetine (Fig. 5B; 14%;P=0.066), but it was notsignificantly different from acute treatment. A similar temporalprofile was seen after treatment with imipramine; however, asignificant reduction of GAP-43 mRNA expression in the CA3region was only observed after 21 days of treatment withimipramine (Fig. 5B; 24% decrease; F(3,28)=7.7; Pb0.05).

Fig. 3. Effects of antidepressant treatment on BDNF mRNA expression levelsmeasured in the granular cell layer of the dentate gyrus (A) and in the CA3region (B) of the hippocampus. A significant increase in BDNF mRNAexpression was observed in the granular cell layer after 7 days of treatment withvenlafaxine (A) and after 14 days of treatment with imipramine (A). No effect offluoxetine was seen in any of the brain regions at any of the time pointsinvestigated here. A modest decrease in BDNF mRNA expression was observedin the CA3 region after chronic treatment with imipramine (B). Results arepresented as mean±S.E.M. (n=7–8) relative to 1 day treatment of the respectivedrug or vehicle. ⁎Pb0.05 in comparison to 1 day treatment (one-way ANOVAfollowed by Fisher's LSD post-hoc test).

Fig. 4. Synaptophysin mRNA levels in the hippocampus of rats treated withantidepressants for 1, 7, 14 or 21 days. A transient increase in synaptophysin mRNAexpression was observed in the granular cell layer of the dentate gyrus (A) and in theCA1 (B) and CA3 (C) regions of the hippocampus after treatment with venlafaxine.SynaptophysinmRNA levels were also transiently increased in the granular cell layer(A) and in theCA1 region (B) after treatmentwith fluoxetinewhereas imipramine hadno effect on synaptophysinmRNA expression in any of three hippocampal regions atany time point. Results are presented as mean±S.E.M. (n=7–8) relative to 1 daytreatment of the respective drug or vehicle. ⁎Pb0.05 in comparison to 1 day treatment(one-way ANOVA followed by Fisher's LSD post-hoc test).

Fig. 5. Effects of antidepressant treatment on expression levels of GAP-43mRNA in the CA1 region (A) and in the CA3 region (B) of the hippocampus. Adecrease in GAP-43 was observed in the CA1 region after treatment withfluoxetine and imipramine, however, the difference only reached significanceafter chronic treatment with imipramine (A). A significant decrease in GAP-43mRNA expression was seen in the CA3 region after treatment with bothfluoxetine and imipramine (B). No effect was observed on the GAP-43 mRNAexpression in the CA3 or CA1 region after treatment with venlafaxine (A, B).Results are presented as mean±S.E.M. (n=7–8) relative to 1 day treatment ofthe respective drug or vehicle. ⁎Pb0.05 in comparison to 1 day treatment (one-way ANOVA followed by Fisher's LSD post-hoc test).

119M.H. Larsen et al. / European Journal of Pharmacology 578 (2008) 114–122

Venlafaxine had no effect on the GAP-43 mRNA expression inCA3 at any time point (Fig. 5B).

4. Discussion

In the current study we directly compare (in the same set ofanimals) the temporal effects of the antidepressants; fluoxetine,imipramine, and venlafaxine, on the expression of BDNF, GAP-43 and synaptophysin in different hippocampal sub-regions. Thisallows a comprehensive and comparative analysis that helps todefine differences in the effectiveness of the different drugs on theregulation of gene transcripts associated with neuronal plasticity.However, it does not necessarily predict the effect on the proteintranslated from these transcripts. An increase in BDNF mRNAwas observed in the granular cell layer of the dentate gyrus after

treatment with venlafaxine and imipramine but not fluoxetineindicating that dual-action antidepressants might be superior inregulation of BDNF in the hippocampus compared to moreselective compounds. Moreover, evidence that GAP-43 andsynaptophysin expression in the hippocampus is regulated byantidepressant treatment is established but no direct correlationbetween the effects on BDNF and the other transcripts wasobserved.

Several studies have shown that BDNF mRNA expression isincreased in the rat hippocampus after chronic treatment withdifferent classes of antidepressants (Coppell et al., 2003; DeFoubert et al., 2004; Nibuya et al., 1995; Nibuya et al., 1996;Rogoz et al., 2005; Russo-Neustadt et al., 1999). In the presentstudy a significant increase in the BDNF mRNA in granular celllayer was observed after both venlafaxine and imipraminetreatment. In contrast, no effect was observed after treatmentwith fluoxetine at any time points. These results are in agreementwith several studies reporting no effect on BDNF mRNAexpression in the hippocampus after fluoxetine treatment (Altieriet al., 2004; Conti et al., 2002; Dias et al., 2003;Miro et al., 2002).However, it challenges the hypothesis that antidepressant effect ismediated via BDNF. In the CA3 region BDNFmRNA expressionwas unaffected by treatment with fluoxetine and venlafaxinewhereas 21 days of imipramine treatment resulted in a decreasedBDNF mRNA expression. Several studies report an increase inBDNF mRNA expression in the hippocampus after chronicantidepressant treatment, however, many of these studies onlyinvestigate the BDNF mRNA expression in the whole hippo-campus and do not distinguish between the expression of BDNFmRNA in the different hippocampal sub-regions (Altieri et al.,2004; Conti et al., 2002; Nibuya et al., 1995; Rogoz et al., 2005).Importantly, only some of the studies that distinguish between thehippocampal sub-regions also describe an increase in BDNFmRNA in the CA3 region after antidepressant treatment (DeFoubert et al., 2004; Martinez-Turrillas et al., 2005; Nibuya et al.,1996) whereas several studies, in line with our results, report thatchronic antidepressant treatment has no effect on the BDNFmRNA expression in the CA3 region (Coppell et al., 2003; Diaset al., 2003; Molteni et al., 2006) or down-regulate the expressionof BDNF mRNA in the CA3 region (Miro et al., 2002). BDNFmRNA expression in the CA1 region has also been reported to beregulated by antidepressant treatment (De Foubert et al., 2004;Martinez-Turrillas et al., 2005; Nibuya et al., 1996). However, inthe current study it was not possible to obtain reliable quantitativemeasurements of BDNF mRNA expression in the CA1 region asthe expression level was close to background levels. The reasonfor this discrepancy is likely due to differences in experimentalconditions.

The increase in BDNF mRNA expression in the granular celllayer after treatment with venlafaxine and imipramine but notafter fluoxetine suggests that regulation of both the serotonergicand noradrenergic systems might be sufficient whereas enhance-ment of serotonergic neurotransmission alone by fluoxetine isinsufficient in itself. Activation of the serotonergic andnoradrenergic neurotransmitter system would be expected toactivate different downstream cascades that are both able toincrease the transcription of BDNF. Following 1-week treatment

120 M.H. Larsen et al. / European Journal of Pharmacology 578 (2008) 114–122

with venlafaxine, but not imipramine or fluoxetine, resulted in asignificant up-regulation of BDNF mRNA in the granular celllayer indicating that venlafaxine has a faster onset of action onBDNFmRNA expression. Whether or not this effect is a result ofan additive effect on noradrenergic and serotonergic systems isunclear (Ivy et al., 2003). It has been suggested that venlafaxineand other SNRIs have improved clinical response and remissionrates and have a faster clinical onset of action as compared to otherantidepressants (Golden and Nicholas, 2000; Kent, 2000;Rosenzweig-Lipson et al., 2006; Tran et al., 2003), however,the clinical evidence is not consistent (Kasper et al., 2006). Thepresent observations are in accordance with the hypothesis thatSNRIs promote BDNF expression and subsequent neuroplasticchanges more efficiently than SSRIs and therefore may have afaster clinical onset of action.

It has been hypothesized that the antidepressants in part workthrough induction of synaptic plasticity and reorganization ofneuronal networks and neuronal communication (Castren, 2005;Nestler et al., 2002). The underlying molecular mechanisms arelikely to involve increased levels of neurotrophins. However, amore detailed profiling of the molecular and cellular mechanismsinvolved in antidepressant treatment requires that BDNF expres-sion ismonitored in concert with othermarkers for neuroplasticity.More subtle structural remodelling such as neurite elongation andsprouting can be followed by studying the expression of GAP-43(Benowitz and Routtenberg, 1997), while synaptic changes can bestudied by measuring synaptic markers such as the presynapticprotein synaptophysin (Eastwood et al., 1994).

In the current study a decrease, rather than an increase, inGAP-43 expression was observed in the CA3 region after chronictreatment with both fluoxetine and imipramine, as compared toacute treatment, whereas no effect was found after treatment withvenlafaxine. In the CA1 region a decrease in GAP-43 mRNAexpression was only found after chronic treatment withimipramine. In line with our results, Iwata et al. (2006) showeda decrease inGAP-43 protein levels in the hippocampus after sub-chronic treatment with fluvoxamine. However, the observeddecrease in GAP-43 mRNA expression contrasts with previousstudies reporting increased GAP-43 protein and mRNA levels inthe hippocampus after chronic treatment with desimipramine orimipramine (Chen et al., 2003; Sairanen et al., 2007). Thecontrasting results might be caused by differences in the sub-regional areas of the hippocampus that were analyzed. Specifi-cally, in the study by Chen et al. (2003) the increase in GAP-43mRNA levelswas only seen in the dentate gyruswhereas no effectof desimipramine on the GAP-43 mRNA expression in the CA1or CA3 regions was observed. In line with several other studies(Bendotti et al., 1997; Meberg et al., 1993; Meberg andRouttenberg, 1991), we found that GAP-43 mRNA expressionin the dentate gyrus was close to the background level and it wastherefore not possible to obtain a reliable quantitation of the GAP-43 mRNA levels in this region.

It is possible that antidepressant treatment induces neuro-plastic changes through regulation of BDNF and several studiessupport the role of BDNF on neurite outgrowth (Horch et al.,1999; Huang and Reichardt, 2001; Patel and McNamara, 1995;Segal et al., 1995). However, no correlation between increased

BDNF mRNA levels and GAP-43 mRNA levels was found inthe current study. In support, no effect on GAP-43 mRNA levelsor on axonal sprouting was observed in the hippocampus oftransgenic mice over-expressing BDNF (Qiao et al., 2001).Given that GAP-43 is a marker of axonal growth neitherantidepressants nor BDNF induces axonal sprouting.

A transient increase in synaptophysin mRNA was observedafter treatment with fluoxetine and venlafaxine suggesting thatthese antidepressants affect synaptic formation. In line withthese data Rapp et al. (2004) showed increased synaptophysinmRNA levels in the rat hippocampus after treatment withfluoxetine and tranylcypromine, but not after treatment withdesimipramine. Antidepressant effects on synaptophysinmRNA expression could be mediated through induction ofBDNF expression. BDNF knockout mice exhibit a markeddecrease in levels of synaptophysin which can be reversed withBDNF (Pozzo-Miller et al., 1999), and it has been shown thatBDNF increases the levels of synaptophysin protein in vitro inhippocampal slice cultures (Tartaglia et al., 2001). However, inthe current study chronic treatment with imipramine inducedBDNF mRNA expression in the granular cell layer but had noeffect on the synaptophysin mRNA expression level in any ofthe hippocampal sub-regions (granular cell layer, CA1 or CA3).

Furthermore, fluoxetine had no effect on BDNF mRNAexpression but increased the expression of synaptophysin mRNAin the granular cell layer and in the CA1 region. In addition, a poorcorrelation in the temporal profiles of synaptophysin and BDNFmRNAexpression after treatment with venlafaxinewas observed.These results suggest that increased BDNF mRNA levels cannotper se be directly translated into an effect on synaptophysinmRNA levels in the in vivo situation.

The increase in synaptophysin mRNA expression seen aftervenlafaxine and fluoxetine treatment does support the hypoth-esis that antidepressant treatment induces synaptic plasticity. Insupport, a recent study showed that synaptic density is increasedin the CA1 and CA3 regions by short-term treatment withfluoxetine (Hajszan et al., 2005). However, the effects shownhere are transient and after 21 days of treatment synaptophysinmRNA levels return to baselines after all treatments.

These findings may reflect a transient reorganization ofneuronal networks and synaptic connections where pruningmechanisms over time selects out and stabilizes the activesynapses and networks. It is possible that antidepressants workpartly through facilitation of structural reorganization andstabilization of neuronal networks (Castren, 2005; Castren et al.,2007). The transient increase in synaptophysin mRNA could thusreflect an induction of synaptic plasticity, enhanced connectivityand structural reorganization, which over time turns into stableneuronal networks with normal connectivity.

In summary, this comparative study provides evidence thatantidepressant treatment increases BDNF mRNA expression inthe hippocampus, but it also emphasizes that different antide-pressants produce unique temporal and sub-regional expressionprofiles. The data indicate that the dual-action antidepressantvenlafaxine produces a faster and stronger response on BDNFmRNA as compared to more selective antidepressant drugs. It isalso reported that antidepressant treatment affects hippocampal

121M.H. Larsen et al. / European Journal of Pharmacology 578 (2008) 114–122

expression of synaptophysin and GAP-43 mRNA. IncreasedBDNF and synaptophysin mRNA expression indicate thatantidepressant treatment induces neuronal and synaptic reorga-nization. However, the effects on BDNF mRNA expression didnot correlate with the changes in synaptophysin and GAP-43mRNA expression.

Acknowledgements

The authors would like to thank Pia R Sandholm, TineEngelbrecht and Kirsten Hansen for skilful technical assistance.This study was supported by the Ministry for Technology andInnovation in Denmark.

References

Altar, C.A.,Whitehead, R.E., Chen, R.,Wortwein, G.,Madsen, T.M., 2003. Effectsof electroconvulsive seizures and antidepressant drugs on brain-derivedneurotrophic factor protein in rat brain. Biol. Psychiatry 54, 703–709.

Altieri, M., Marini, F., Arban, R., Vitulli, G., Jansson, B.O., 2004. Expressionanalysis of brain-derived neurotrophic factor (BDNF) mRNA isoforms afterchronic and acute antidepressant treatment. Brain Res. 1000, 148–155.

Aydemir, C., Yalcin, E.S., Aksaray, S., Kisa, C., Yildirim, S.G., Uzbay, T., Goka,E., 2006. Brain-derived neurotrophic factor (BDNF) changes in the serum ofdepressed women. Prog. Neuropsychopharmacol. Biol. Psychiatry 30,1256–1260.

Aydemir, O., Deveci, A., Taneli, F., 2005. The effect of chronic antidepressanttreatment on serum brain-derived neurotrophic factor levels in depressedpatients: a preliminary study. Prog. Neuropsychopharmacol. Biol. Psychi-atry 29, 261–265.

Bendotti, C., Baldessari, S., Pende, M., Southgate, T., Guglielmetti, F., Samanin,R., 1997. Relationship between GAP-43 expression in the dentate gyrus andsynaptic reorganization of hippocampal mossy fibres in rats treated withkainic acid. Eur. J. Neurosci. 9, 93–101.

Benowitz, L.I., Routtenberg, A., 1997. GAP-43: an intrinsic determinant ofneuronal development and plasticity. Trends Neurosci. 20, 84–91.

Castren, E., 2005. Is mood chemistry? Nat. Rev., Neurosci. 6, 241–246.Castren, E., Voikar, V., Rantamaki, T., 2007. Role of neurotrophic factors in

depression. Curr. Opin. Pharmacol. 7, 18–21.Chen, B., Dowlatshahi, D., MacQueen, G.M., Wang, J.F., Young, L.T., 2001.

Increased hippocampal BDNF immunoreactivity in subjects treated withantidepressant medication. Biol. Psychiatry 50, 260–265.

Chen, B., Wang, J.F., Sun, X., Young, L.T., 2003. Regulation of GAP-43expression by chronic desipramine treatment in rat cultured hippocampalcells. Biol. Psychiatry 53, 530–537.

Conti, A.C., Cryan, J.F., Dalvi, A., Lucki, I., Blendy, J.A., 2002. cAMP responseelement-binding protein is essential for the upregulation of brain-derivedneurotrophic factor transcription, but not the behavioral or endocrineresponses to antidepressant drugs. J. Neurosci. 22, 3262–3268.

Coppell, A.L., Pei, Q., Zetterstrom, T.S., 2003. Bi-phasic change in BDNF geneexpression following antidepressant drug treatment. Neuropharmacology 44,903–910.

De Foubert, G., Carney, S.L., Robinson, C.S., Destexhe, E.J., Tomlinson, R.,Hicks, C.A., Murray, T.K., Gaillard, J.P., Deville, C., Xhenseval, V.,Thomas, C.E., O'Neill, M.J., Zetterstrom, T.S., 2004. Fluoxetine-inducedchange in rat brain expression of brain-derived neurotrophic factor variesdepending on length of treatment. Neuroscience 128, 597–604.

Dias, B.G., Banerjee, S.B., Duman, R.S., Vaidya, V.A., 2003. Differentialregulation of brain derived neurotrophic factor transcripts by antidepressanttreatments in the adult rat brain. Neuropharmacology 45, 553–563.

Eastwood, S.L., Burnet, P.W., McDonald, B., Clinton, J., Harrison, P.J., 1994.Synaptophysin gene expression in human brain: a quantitative in situhybridization and immunocytochemical study. Neuroscience 59, 881–892.

Eastwood, S.L., Harrison, P.J., 2001. Synaptic pathology in the anteriorcingulate cortex in schizophrenia and mood disorders. A review and a

Western blot study of synaptophysin, GAP-43 and the complexins. . BrainRes. Bull. 55, 569–578.

Gambarana, C., Scheggi, S., Tagliamonte, A., Tolu, P., De Montis, M.G., 2001.Animal models for the study of antidepressant activity. Brain Res. Brain Res.Protoc. 7, 11–20.

Gervasoni, N., Aubry, J.M., Bondolfi, G., Osiek, C., Schwald, M., Bertschy, G.,Karege, F., 2005. Partial normalization of serum brain-derived neurotrophicfactor in remitted patients after a major depressive episode. Neuropsycho-biology 51, 234–238.

Golden, R.N., Nicholas, L., 2000. Antidepressant efficacy of venlafaxine.Depress. Anxiety 12 (Suppl 1), 45–49.

Gonul, A.S., Akdeniz, F., Taneli, F., Donat, O., Eker, C., Vahip, S., 2005. Effectof treatment on serum brain-derived neurotrophic factor levels in depressedpatients. Eur. Arch. Psychiatry Clin. Neurosci. 255, 381–386.

Greengard, P., Valtorta, F., Czernik, A.J., Benfenati, F., 1993. Synaptic vesiclephosphoproteins and regulation of synaptic function. Science 259, 780–785.

Gregersen, R., Christensen, T., Lehrmann, E., Diemer, N.H., Finsen, B., 2001.Focal cerebral ischemia induces increased myelin basic protein and growth-associated protein-43 gene transcription in peri-infarct areas in the rat brain.Exp. Brain Res. 138, 384–392.

Hajszan, T., MacLusky, N.J., Leranth, C., 2005. Short-term treatment with theantidepressant fluoxetine triggers pyramidal dendritic spine synapseformation in rat hippocampus. Eur. J. Neurosci. 21, 1299–1303.

Hashimoto, K., Shimizu, E., Iyo, M., 2004. Critical role of brain-derivedneurotrophic factor inmooddisorders. BrainRes.BrainRes. Rev. 45, 104–114.

Horch, H.W., Kruttgen, A., Portbury, S.D., Katz, L.C., 1999. Destabilization ofcortical dendrites and spines by BDNF. Neuron 23, 353–364.

Hrdina, P., Faludi, G., Li, Q., Bendotti, C., Tekes, K., Sotonyi, P., Palkovits, M.,1998. Growth-associated protein (GAP-43), its mRNA, and protein kinase C(PKC) isoenzymes in brain regions of depressed suicides. Mol. Psychiatry 3,411–418.

Huang, E.J., Reichardt, L.F., 2001. Neurotrophins: roles in neuronal developmentand function. Annu. Rev. Neurosci. 24, 677–736.

Ivy, A.S., Rodriguez, F.G., Garcia, C., Chen, M.J., Russo-Neustadt, A.A., 2003.Noradrenergic and serotonergic blockade inhibits BDNF mRNA activationfollowing exercise and antidepressant. Pharmacol. Biochem. Behav. 75, 81–88.

Iwata,M., Shirayama, Y., Ishida, H., Kawahara, R., 2006. Hippocampal synapsin I,growth-associated protein-43, and microtubule-associated protein-2 immuno-reactivity in learned helplessness rats and antidepressant-treated rats.Neuroscience 141, 1301–1313.

Jacobsen, J.P., Mørk, A., 2004. The effect of escitalopram, desipramine,electroconvulsive seizures and lithium on brain-derived neurotrophic factormRNA and protein expression in the rat brain and the correlation to 5-HTand 5-HIAA levels. Brain Res. 1024, 183–192.

Kasper, S., Spadone, C., Verpillat, P., Angst, J., 2006. Onset of action ofescitalopram compared with other antidepressants: results of a pooled analysis.Int. Clin. Psychopharmacol. 21, 105–110.

Kent, J.M., 2000. SNaRIs, NaSSAs, and NaRIs: new agents for the treatment ofdepression. Lancet 355, 911–918.

Martinez-Turrillas, R., Del Rio, J., Frechilla, D., 2005. Sequential changes inBDNF mRNA expression and synaptic levels of AMPA receptor subunits inrat hippocampus after chronic antidepressant treatment. Neuropharmacology49, 1178–1188.

Masliah, E., Fagan, A.M., Terry, R.D., DeTeresa, R., Mallory, M., Gage, F.H.,1991. Reactive synaptogenesis assessed by synaptophysin immunoreactivityis associated with GAP-43 in the dentate gyrus of the adult rat. Exp. Neurol.113, 131–142.

Masliah, E., Mallory, M., Alford, M., DeTeresa, R., Hansen, L.A., McKeel Jr.,D.W., Morris, J.C., 2001. Altered expression of synaptic proteins occursearly during progression of Alzheimer's disease. Neurology 56, 127–129.

McAllister, A.K., Katz, L.C., Lo, D.C., 1999. Neurotrophins and synapticplasticity. Annu. Rev. Neurosci. 22, 295–318.

Meberg, P.J., Gall, C.M., Routtenberg, A., 1993. Induction of F1/GAP-43 geneexpression in hippocampal granule cells after seizures. Brain Res. Mol. BrainRes. 17, 295–299.

Meberg, P.J., Routtenberg, A., 1991. Selective expression of protein F1/(GAP-43)mRNA in pyramidal but not granule cells of the hippocampus. Neuroscience45, 721–733.

122 M.H. Larsen et al. / European Journal of Pharmacology 578 (2008) 114–122

Miro, X., Perez-Torres, S., Artigas, F., Puigdomenech, P., Palacios, J.M.,Mengod, G., 2002. Regulation of cAMP phosphodiesterase mRNAsexpression in rat brain by acute and chronic fluoxetine treatment. An insitu hybridization study. Neuropharmacology 43, 1148–1157.

Molteni, R., Calabrese, F., Bedogni, F., Tongiorgi, E., Fumagalli, F., Racagni,G., Riva, M.A., 2006. Chronic treatment with fluoxetine up-regulatescellular BDNF mRNA expression in rat dopaminergic regions. Int. J.Neuropsychopharmacol. 9, 307–317.

Monteggia, L.M., Barrot, M., Powell, C.M., Berton, O., Galanis, V., Gemelli, T.,Meuth, S., Nagy, A., Greene, R.W., Nestler, E.J., 2004. Essential role ofbrain-derived neurotrophic factor in adult hippocampal function. Proc. Natl.Acad. Sci. U. S. A. 101, 10827–10832.

Nestler, E.J., Barrot, M., DiLeone, R.J., Eisch, A.J., Gold, S.J., Monteggia, L.M.,2002. Neurobiology of depression. Neuron 34, 13–25.

Nibuya, M., Morinobu, S., Duman, R.S., 1995. Regulation of BDNF and trkBmRNA in rat brain by chronic electroconvulsive seizure and antidepressantdrug treatments. J. Neurosci. 15, 7539–7547.

Nibuya, M., Nestler, E.J., Duman, R.S., 1996. Chronic antidepressantadministration increases the expression of cAMP response element bindingprotein (CREB) in rat hippocampus. J. Neurosci. 16, 2365–2372.

Patel, M.N., McNamara, J.O., 1995. Selective enhancement of axonal branchingof cultured dentate gyrus neurons by neurotrophic factors. Neuroscience 69,763–770.

Paxinos, G., Watson, C., 1998. The Rat Brain in Stereotaxic Coordinates, fourthed. Academic Press, Ltd., London.

Phillips, H.S., Hains, J.M., Laramee, G.R., Rosenthal, A., Winslow, J.W., 1990.Widespread expression of BDNF but not NT3 by target areas of basalforebrain cholinergic neurons. Science 250, 290–294.

Pozzo-Miller, L.D., Gottschalk, W., Zhang, L., McDermott, K., Du, J.,Gopalakrishnan, R., Oho, C., Sheng, Z.H., Lu, B., 1999. Impairments inhigh-frequency transmission, synaptic vesicle docking, and synaptic proteindistribution in the hippocampus of BDNF knockout mice. J. Neurosci. 19,4972–4983.

Qiao, X., Suri, C., Knusel, B., Noebels, J.L., 2001. Absence of hippocampalmossy fiber sprouting in transgenic mice overexpressing brain-derivedneurotrophic factor. J. Neurosci. Res. 64, 268–276.

Rapp, S., Baader, M., Hu, M., Jennen-Steinmetz, C., Henn, F.A., Thome, J.,2004. Differential regulation of synaptic vesicle proteins by antidepressantdrugs. Pharmacogenomics J. 4, 110–113.

Rehm, H., Wiedenmann, B., Betz, H., 1986. Molecular characterization ofsynaptophysin, a major calcium-binding protein of the synaptic vesiclemembrane. Embo J. 5, 535–541.

Reneric, J.P., Lucki, I., 1998. Antidepressant behavioral effects by dual inhibitionof monoamine reuptake in the rat forced swimming test. Psychopharmacology(Berl.) 136, 190–197.

Rogoz, Z., Skuza, G., Legutko, B., 2005. Repeated treatment with mirtazepineinduces brain-derived neurotrophic factor gene expression in rats. J. Physiol.Pharmacol. 56, 661–671.

Rosenzweig-Lipson, S., Beyer, C.E., Hughes, Z.A., Khawaja, X., Rajarao, S.J.,Malberg, J.E., Rahman, Z., Ring, R.H., Schechter, L.E., 2006. Differenti-ating antidepressants of the future: efficacy and safety. Pharmacol. Ther. 113,134–153.

Russo-Neustadt, A., Beard, R.C., Cotman, C.W., 1999. Exercise, antidepressantmedications, and enhanced brain derived neurotrophic factor expression.Neuropsychopharmacology 21, 679–682.

Russo-Neustadt, A.A., Chen, M.J., 2005. Brain-derived neurotrophic factor andantidepressant activity. Curr. Pharm. Des. 11, 1495–1510.

Sairanen, M., O'Leary, O.F., Knuuttila, J.E., Castren, E., 2007. Chronicantidepressant treatment selectively increases expression of plasticity-related proteins in the hippocampus and medial prefrontal cortex of therat. Neuroscience 144, 368–374.

Segal, R.A., Pomeroy, S.L., Stiles, C.D., 1995. Axonal growth and fasciculationlinked to differential expression of BDNF and NT3 receptors in developingcerebellar granule cells. J. Neurosci. 15, 4970–4981.

Shirayama, Y., Chen, A.C., Nakagawa, S., Russell, D.S., Duman, R.S., 2002.Brain-derived neurotrophic factor produces antidepressant effects inbehavioral models of depression. J. Neurosci. 22, 3251–3261.

Siuciak, J.A., Lewis, D.R., Wiegand, S.J., Lindsay, R.M., 1997. Antidepressant-like effect of brain-derived neurotrophic factor (BDNF). Pharmacol.Biochem. Behav. 56, 131–137.

Südhof, T.C., Lottspeich, F., Greengard, P., Mehl, E., Jahn, R., 1987. The cDNAand derived amino acid sequences for rat and human synaptophysin.Nucleic. Acids Res. 15, 9607.

Tartaglia, N., Du, J., Tyler, W.J., Neale, E., Pozzo-Miller, L., Lu, B., 2001.Protein synthesis-dependent and -independent regulation of hippocampalsynapses by brain-derived neurotrophic factor. J. Biol. Chem. 276,37585–37593.

Tran, P.V., Bymaster, F.P., McNamara, R.K., Potter, W.Z., 2003. Dualmonoamine modulation for improved treatment of major depressivedisorder. J. Clin. Psychopharmacol. 23, 78–86.

Vinet, J., Carra, S., Blom, J.M., Brunello, N., Barden, N., Tascedda, F., 2004.Chronic treatment with desipramine and fluoxetine modulate BDNF,CaMKKalpha and CaMKKbeta mRNA levels in the hippocampus oftransgenic mice expressing antisense RNA against the glucocorticoidreceptor. Neuropharmacology 47, 1062–1069.

Widmer, F., Caroni, P., 1993. Phosphorylation-site mutagenesis of the growth-associated protein GAP-43 modulates its effects on cell spreading andmorphology. J. Cell Biol. 120, 503–512.

Wiedenmann, B., Franke, W.W., 1985. Identification and localization ofsynaptophysin, an integral membrane glycoprotein of Mr 38,000 character-istic of presynaptic vesicles. Cell 41, 1017–1028.

Zhou, L., Huang, K.X., Kecojevic, A., Welsh, A.M., Koliatsos, V.E., 2006.Evidence that serotonin reuptake modulators increase the density ofserotonin innervation in the forebrain. J. Neurochem. 96, 396–406.