Upload File

supplementary figure 2

1
Supplementary Figure 2 D ose (m M) 0,01 0,1 1 Induction ofshortdeletions (x 10 7 ) 1 10 100

Upload: vanna-clayton

Post on 30-Dec-2015

9 views

Category:

Documents


1 download

Report

DESCRIPTION

Supplementary Figure 2. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Supplementary Figure 2

Supplementary Figure 2

Dose (mM)

0,01 0,1 1

Ind

uct

ion

of

sho

rt d

elet

ion

s (x

10

7 )

1

10

100

Supplementary Figure 1 - Welcome to the UCLA …€¦ ·  · 2016-06-151 Supplementary Figure 1 Supplementary Figure 1. ... Supplementary Figure 5 Supplementary Figure 5. ... JP10089

Supplementary Materials Supplementary Figure Legends

Supplementary figure 2

Zuo -Supplementary Figure 1 (page 1 of 2)

Supplementary Figure Legends

Supplementary Figure 3

Supplementary appendix · Supplementary Figure 1. Funnel Plot for total symptoms Supplementary Figure 2. ... positive, negative and general symptom scores are not reported we estimated

Supplementary Figure 1. - NHGRI: Research Server Figure 1. ... Supplementary Figure 2. ... 16 rs2402354TCTGGGTGCCTGAAGTTTCT GAGGGACAGCTCCATTCATC 28,442,316 T T C T C T TTTTTTTTTT TCTCTT

images.nature.com · Web viewVahid Asnafi2, Elizabeth Macintyre 2, Els Verhoeyen1,3 and Melania Tesio2 SUPPLEMENTA L DATA Supplementary figure 1 Supplementary figure 2 Supplementary

Supplementary Figures: Supplementary Figure 1 – PANCAN ...df6sxcketz7bb.cloudfront.net/manuscripts/88000/88755/jci.insight.88755.sd.pdfSupplementary Figures: Supplementary Figure

images.nature.com · Web viewSupplementary Figure 7 Supplementary Figure 3 Supplementary Figure 1 Supplementary Materials Supplementary Figures S1-S7 Supplementary Tables S1-S7 Clinical

SUPPLEMENTARY INFORMATION - Geophysicsgeophysics.wustl.edu/seminar/2010_Tauzin_NatureGeo_SOM.pdf · SUPPLEMENTARY INFORMATION doi: 10.1038/ngeo969 2 Supplementary Figure S1 Global

Supplementary figure 2

Supplementary Figure 2. Kunogi M et al

Supplementary Figure 1

Supplementary Figure 2

Supplementary Figure 5

SUPPLEMENTARY INFORMATIONmendel.stanford.edu/SidowLab/pdfs/2011ValouevEtAl_Supp.pdf · Supplementary Figure 2 Supplementary Figure 2. Schematic representation of in vitro reconstitution

Supplementary Figure 1

SUPPLEMENTARY FIGURE 2 - AACR Journals · 2015. 11. 26. · Vehicle ML264 (2 x 25 mg/kg) KL F5 # 1 A KL F5 # 2 KL F5 # 3 Supplementary Figure 2. Title: SUPPLEMENTARY FIGURE 2 Created

Supplementary Figure S26

Supplementary Figure 1. Removing one copy of Rb1 gene … · 2019-11-14 · Supplementary Figure 2 Supplementary Figure 2. The ganglion cells, bipolar cells and horizontal cells in

Supplementary Material Figure 2. Phylogenetic

media.nature.com · 1 Supplementary Materials Supplementary Table S1 Supplementary Table S2 Supplementary Table S3 Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure

Supplementary Information Supplementary Figure S1. Phenotypic … · 2013-02-05 · 2 Supplementary Figures and Legends Fig.S1 Supplementary Figure S1. Phenotypic comparison of the

Supplementary Information SUPPLEMENTARY … · SUPPLEMENTARY INFORMATION 2 | RESEARCH Supplementary Information 3 Fig. S2 Figure S2: Carbon Rearrangement Networks Used in Various

Supplementary Figure 1 - Nature · Supplementary Figure 1 ... Supplementary Figure 3. Activation of HIF-1 activity by UCHL1 overexpression. ... EMT6/EF-Luc/EV-1, 2 and

1 Supplementary Figures 2 3 Supplementary Figure 1: TRPV1 expression … · 2017-05-10 · 1 1 Supplementary Figures 2 3 Supplementary Figure 1: TRPV1 expression in the ACC of both

Supplementary Figure · 2015. 1. 14. · 2 Supplementary Figure Supplementary Figure 1. Standard and Selected Samples. Chen et al. (2015) Asian Australas. J. Anim. Sci. 28:158-165

SUPPLEMENTARY MATERIAL: SUPPLEMENTARY FIGURE 2cambridge.org:id:article:S... · SUPPLEMENTARY MATERIAL: SUPPLEMENTARY FIGURE 2 Image gallery to accompany John Robb (2015), “Prehistoric

Supplementary figure 2. Guillemin et al. Supplementary figure 2. Expression of BCL2L10 in human oocytes analyzed by immunofluorescence. Detection of BCL2L10

Supplementary Figure 1. Supplementary Figure 2 Supplementary Figure 3 A B

Supplementary Figure 1 - dm5migu4zj3pb.cloudfront.net · Supplementary Figure 1 A B 0 10 20 30 40 ... Oral glucose tolerance test (OGTT) ... Supplementary Figure 2 A) ) 0.5 0 1 1.5

Supplementary information for: Discovery and … · Supplementary Figure S2 Supplementary Figure S3 Supplementary Figure S4 Supplementary Figure S5 Supplementary Figure S6 Supplementary

Supplementary Figure S1