20

JOURNAL OF BIOSCIENCE AND BIOENGINEERING

Vol. 98, No. 1, 20–27. 2004

Succession of a Microbial Community during Stable Operation

of a Semi-continuous Garbage-Decomposing System

SHIN HARUTA,1

MIE KONDO,1

KOHEI NAKAMURA,1

CHAUNJIT CHANCHITPRICHA,1

HIROSHI AIBA,1

MASAHARU ISHII,1

AND YASUO IGARASHI1

*

Graduate School of Agricultural and Life Sciences, The University of Tokyo,

1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan1

Received 22 December 2003/Accepted 12 April 2004

The microbial community in a garbage-decomposing system was analyzed using denaturing

gradient gel electrophoresis (DGGE) on the basis of 16S rDNA. The system treated 1 kg of gar-

bage everyday for two months at ambient temperature with almost constant decomposition effi-

ciency, although a transient pH increase occurred. Succession of the banding pattern of the

DGGE profile suggested that the bacterial community was not directly affected by the continuous

addition of non-sterilized garbage into the open system, but changed with the fluctuation of pH.

These resistance and resilience characteristics of the community structure may be effective to

keep the decomposition efficiency stable. The analyses of the DNA sequences from the DGGE

bands suggested the existence of uncultured or novel bacteria as well as Lactobacillus sp., Coryne-

bacterium spp., Enterococcus spp., and Staphylococcus sp. A specific PCR detection was per-

formed to evaluate the existence of Escherichia coli within the community. E. coli 16S rDNAs were

not detected from the decomposing system.

[Key words: microbial community, garbage, denaturing gradient gel electrophoresis]

The increasing amount of household garbage induces sev-

eral environmental burdens, particularly in urban areas, such

as the evolution of harmful gases from the incineration of

garbage with high moisture content, limited space for land-

fill, and the amount of energy that is required for the collec-

tion of wastes from each family for field-scale composting.

Therefore, on-site treatment is desirable to reduce the amount

of household garbage.

A garbage-decomposing system should be able to treat

approximately 1 kg of kitchen garbage produced by each

family everyday. Several types of equipment are commer-

cially available for daily decomposition. A popular system

is equipped with an air draft and stirring wings to dry and

mix garbage electrically, and some systems have a heating

module and/or a deodorizing device. Under certain condi-

tions, the temperature increases to approximately 60�C with-

out the heater and the pH increases to 8–9 to produce an

ammoniacal smell (1). In practice, however, it is difficult to

maintain the temperature (>60�C) high enough to eliminate

pathogenic bacteria such as Escherichia coli. Therefore,

these systems are generally operated at ambient temperature

(2). However, few studies have reported on the microbial

community in these systems.

Non-sterilized substrates are continuously supplied into

these systems as well as into bioreactors such as wastewater

treatment and biogas fermentation that are generally oper-

ated in a continuous mode. The microbial communities in

these processes have not been well clarified, and the bio-

processes occasionally get out of control. It is necessary to

determine how the microbial community succeeds to main-

tain the function stably during operation in order to regulate

these bioprocesses. In the present study, we analyzed the mi-

crobial community in a garbage-decomposing system dur-

ing a two-month operating period using a denaturing gradi-

ent gel electrophoresis (DGGE) method. The existence of

E. coli as an indicator organism for public health was also

evaluated using a PCR detection method.

MATERIALS AND METHODS

Garbage-decomposing system A laboratory scale reactor stir-

red garbage with stirring wings for 4 min at 30-min intervals (1).

The total volume was 30 l. The airflow rate was controlled at ap-

proximately 90 l per minute. The temperature was not controlled and

no additional bacteria were supplied. Sawdust (14 l, Biowogran;

Morishita Kikai, Wakayama) was added as a starting material to

provide an initial moisture content of approximately 50%. One kg

of the standardized garbage was added everyday. The composition

of the garbage was 36% vegetable (18% cabbage and 18% carrot),

30% fruit (16% banana and 14% apple), and 34% other organic

material (10% fried chicken, 10% dried fish, 10% boiled rice, and

4% used Japanese tea leaves). The garbage contained around 75–

78% moisture and had a pH value of 6–7.

The temperature, pH, moisture content, and weight of the mate-

rials in the reactor were monitored. The moisture content was mea-

sured with an electronic moisture balance (MOC-30S; Shimadzu,

Kyoto). The carbon-to-nitrogen (C/N, g/g) ratio was analyzed by

Japan Food Research Laboratories. The decomposition rate was

determined from the reduction in garbage weight. The total weight

* Corresponding author. e-mail: aigara@mail.ecc.u-tokyo.ac.jp

phone: +81-(0)3-5841-5142 fax: +81-(0)3-5841-5272

MICROBIAL COMMUNITY WITHIN A GARBAGE-DECOMPOSERVOL. 98, 2004 21

just before the addition of garbage was measured at intervals of

3–11 d, and the decomposition rate (D; gram weight per day) was

calculated by the following equation:

D� (NT1�K(T2�T1)�N

T2)/(T2�T1)

where NT1

and NT2

indicate the total weight (gram) on days T1 and

T2, respectively, and K is the weight of garbage supplied per day,

i.e., 1000 (g wet weight/d). In the same way, the decomposition

rate on a dry-weight basis was calculated using the dry weight of

the garbage and the decomposing materials determined from their

moisture contents. A total of 100–200 g of decomposing materials

were taken from four or more points 12–14 h after the addition of

garbage, cut into pieces of less than 5 mm in diameter, mixed to-

gether in a tube, and used as samples (1).

Bacterial cell count Ten grams of a sample was homoge-

nized and dispersed in 60 ml of water by a Polytron®

homogenizer

(Kinematica, Littau/Luzern, Switzerland) operated for 10 min at

about 15,000 rpm on ice. The number of bacteria in the samples

was determined by the plate count method (tryptic soy agar [Difco

Laboratories, Detroit, MI, USA], 37�C) and by direct counting of

4�,6-diamidino-2-phenylindole (DAPI)-stained cells under a fluo-

rescence microscope (1).

In order to detect bacterial cells which did not form a colony, a

piece of agar where no colony formed was excised from the agar

plates after cultivation. The agar piece was stained with SYBR®

Green I (Molecular Probes, Eugene, OR, USA) and observed using

fluorescence microscope.

DNA extraction The decomposing materials taken from

the system were homogenized in an extraction buffer (100 mM

Tris–HCl, pH 9.0, 40 mM EDTA) with the Polytron®

homogenizer

(Kinematica) as described above. Direct DNA extraction was per-

formed by the benzyl chloride method (3). Nucleic acids were final-

ly precipitated with isopropanol and the pellets were resuspended

in TE buffer (10 mM Tris–HCl, pH 8.0, 1 mM EDTA).

The DNA was further purified using a Geneclean®

spin kit

(BIO101; Carlsbad, CA, USA) for PCR-DGGE analysis. For E. coli

detection experiments, the extracted DNA from the decomposing

materials was treated with RNase, purified by the Geneclean®

spin

kit (BIO101) followed by PEG precipitation (4). The concentration

of the purified DNA was determined spectrophotometrically.

PCR for DGGE analysis PCR was performed using

AmpliTaqGold™

according to the manufacturer’s instructions

(Perkin Elmer Japan, Applied Biosystems Division, Chiba). The

primers used for DGGE were the following: 357F-GC, 5�-CGCC

CGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGC

CTACGGGAGGCAGCAG-3� (E. coli positions, 341 to 357), and

517R, 5�-ATTACCGCGGCTGCTGG-3� (E. coli positions, 517 to

534) (5). The underlined sequence is a GC clamp. The temperature

cycle for PCR was described previously (1). The products were

examined by electrophoresis on 2% agarose gel before applying

them to DGGE.

DGGE Double gradient-DGGE was performed as described

previously (1) with the DCode™

system (Bio-Rad Laboratories,

Hercules, CA, USA). Six to 12% of the polyacrylamide gradient

was superimposed on a 15% to 50% denaturant gradient where

100% was defined as 7 M urea with 40% formamide. Gels were

stained with SYBR®

Green I (Molecular Probes). The gel image

was recorded with a Gel Print TM 2000i (Genomic Solutions, Ann

Arbor, MI, USA) under UV illumination. The gel bands were ex-

cised with a clean razor blade and DNA was recovered as de-

scribed previously (1).

Sequencing Sequencing reactions were carried out with a

BigDye™

kit (Perkin Elmer Japan, Applied Biosystems Division)

according to the manufacturer’s instructions. The sequencing prim-

ers were 517R and 357F, the latter being 357F-GC without the GC

clamp. The products were then analyzed with an ABI Model 377

DNA sequencer (Perkin Elmer). To determine the closest known

relatives, the 16S rDNA sequences obtained were compared with

those from the Ribosomal Database Project (RDP) and DDBJ

using the RDP and BLAST programs. The 16S rDNA partial se-

quences obtained in this study have been submitted to DDBJ as

follows: AB110648 to AB110655.

Fluorescence in situ hybridization (FISH) FISH was per-

formed under the conditions described previously (1) with a probe

which is specific to the domain bacteria (EUB338 5�-TGAGGATG

CCCTCCGTCG-3�) (6). The 5�-terminus of the probe was labeled

with fluorescein isothiocyanate.

Detection of E. coli by PCR A pair of primers was reported

previously for specific detection of E. coli in soil (7). The primers

were modified to increase the specificity on the basis of the align-

ments of 16S rDNA sequences (Tables 1 and 2): ECF73, 5�-CA

GGAAGAAGCTTGCTTCTTTGC-3� (E. coli positions, 73 to 95)

(Table 1), and ECR476, 5�-AGCAAAGGTATTAACTTTACTCC-

3� (E. coli positions, 476 to 454) (Table 2). Although the sequences

of ECF73 and ECR476 were found in Haemophilus parasuis and

Shigella spp., respectively, the combination of these primers would

achieve the selective detection of E. coli. All seven operons for

16S rDNA of E. coli O157:H7 (accession no. BA000007) have the

same sequence with that of ECF73. On the other hand, three or five

mismatched bases against ECF73 were found in rrsC, rrsD, and

rrsG of E. coli K12 (Table 1). Not all seven copies would be am-

plified from E. coli K12. Taq DNA polymerase (Promega Corpora-

tion, Madison, WI, USA) was used with anti-Taq high (Toyobo,

Osaka) as a monoclonal antibody against Taq polymerase to

achieve a hot start. Thermal cycling parameters were optimized for

selective PCR amplification of E. coli DNA as follows; the first

denaturation, 95�C for 3 min; denaturation, 94�C for 30 s; anneal-

ing, 65�C for 30 s; extension, 72�C for 1 min; cycle number, 40;

the final extension, 72�C for 5 min. The composition of the re-

action mixture was according to the manufacturer’s instruction

(Promega Corporation) with 2 mM MgCl2

. Thermal cycling re-

action was performed with a Takara PCR Thermal Cycler MP

TP3000 (Takara Biomedicals, Shiga). The resulting DNA frag-

ment (404 bp) was detected by agarose gel electrophoresis fol-

lowed by staining with SYBR®

Green I.

The genomic DNA from the following bacteria were used for

positive or negative control to optimize the PCR conditions: E. coli

K12 IAM 1264, E. coli IAM 12119T

, Proteus vulgaris JCM 1668T

,

Shigella boydii IID no. 627 NIHJ 1130, S. dysenteriae IID no. 633

NIHJ 177249 Ewing 3, S. flexneri IID no. 642 Komagome B111

orig., S. sonnei IID no. 969 EW33, Pantoea agglomerans IAM

12659, Enterobacter sakazakii IAM 12660T

, E. aerogenes IAM

12348T

, Klebsiella planticola IAM 14202T

, and K. pneumoniae

IAM 14200T

.

RESULTS

Decomposing properties The parameters of the de-

composing process are shown in Fig. 1. The temperature in-

creased above 40�C one week after starting the operation

and then decreased to be kept around 30�C to 40�C (Fig.

1A). The carbon-to-nitrogen (C/N) ratio decreased gradu-

ally and reached approximately 10 after 3 weeks of opera-

tion (Fig. 1A). The pH value remained constant at 6–7, ex-

cept for the values (pH 8) on day 22 and 25 (Fig. 1B). Mois-

ture content decreased from 50% (day 5) to 40% (day 25)

and remained constant (Fig. 1B). Figure 1C shows the de-

composition efficiency which was defined as the decompo-

sition rate (a reduced weight per day) during each term (3–

11 d). Except for the first 5 d, 880–1200 g of garbage was

HARUTA ET AL. J. BIOSCI. BIOENG.,22

decomposed in a day throughout the period of operation.

When the decomposition efficiency was evaluated on the

basis of the dry weight, 120�30 g of garbage, on average,

was reduced every day (Fig. 1C, black area). These results

signify that stable degradation was achieved for longer than

7 weeks. During the degradation, no serious odor problems

occurred. However, a faint sour odor was observed during

the first 10 d. After around one month, a faint ammoniacal

smell appeared, followed by the sour smell again.

Bacterial cell number No yeast cells were observed

under microscopy. The total number of bacterial cells was

determined by the direct counts of DAPI staining (Fig. 2).

The number increased from day 5 to day 33 and then stabi-

lized around 3�1011

cells/g. The ratio of the cell counts, the

eubacteria/total count (DAPI), was determined by FISH

analysis, and the number of hybridized cells with the eubac-

teria specific probe (EUB338) was calculated on the basis

of total cell number (Fig. 2). The number of EUB338-hy-

bridized cells showed an increase similar to that of the total

bacterial cells until day 33, following which a definite de-

crease was observed. However, the colony forming unit

showed a change similar to that of the total bacterial cell

without a decrease on day 38.

The ratio of the cell number, plate counts/EUB338-hy-

bridized cells, was 15% to 120%. The lowest ratio was found

on day 22. For the sample from day 22, bacterial cells which

did not form (micro-)colonies were microscopically ob-

served on the agar plate after staining with SYBR®

Green I

(Molecular Probes).

DGGE banding pattern DNAs were extracted from

TABLE 1. Alignment of forward primer with the 16S rRNA gene of E. coli, Shigella, and other bacteria

Source Region from bp 67–101 of 16S rRNA gene Accession number

ECF73 primer CAGGAAGAAGCTTGCTTCTTTGC

E. coli K12

rrsA CAGGAAGAAGCTTGCTTCTTTGC AE000460

rrsB CAGGAAGAAGCTTGCTTCTTTGC AE000471

rrsC CAGGAAACAGCTTGCTGTTTCGC AE000452

rrsD CAGGAAACAGCTTGCTGTTTCGC AE000406

rrsE CAGGAAGAAGCTTGCTTCTTTGC AE000474

rrsG CAGGAAGCAGCTTGCTGCTTCGC AE000345

rrsH CAGGAAGAAGCTTGCTTCTTTGC AE000129

E. coli O157:H7 (rrsA)a

CAGGAAGAAGCTTGCTTCTTTGC AP002567

Shigella boydii CAGGAAGCAGCTTGCTGTTTCGC X96965

S. dysenteriae CAGGAAGCAGCTTGCTGCTTTGC X80680

S. flexneri CAGGAAGCAGCTTGCTGTTTCGC X96963

S. sonnei CAGGAAACAGCTTGCTGTTTCGC X80726

Haemophilus parasuis CAGGAAGAAGCTTGCTTCTTTGC AB004025

Proteus vulgaris CAGGAGAAAGCTTGCTTTCTTGC J01874

Enterobacter aerogenes CACAGAG–AGCTTGCT–CTCGGG AJ251468

E. sakazakii CAGGGAGCAGCTTGCTGCTCTGC AB004746

Pantoea agglomerans CACAGAGTAGCTTGCTTCTTTGC AF024612

Klebsiella pneumoniae CACAGAG–AGCTTGCT–CTCGGG Y17656

K. planticola CAGAAAGCAGCTTGCTGCTTCGC AB004755

Haemophilus parasuis CAGGAAGAAGCTTGCTTCTTTGC AB004037

Underlined bases are mismatches.

a

Seven sequences (rrsA, rrsB, rrsC, rrsD, rrsE, rrsG, and rrsH) in E. coli O157:H7 (accession no. BA000007) are the same in this region.

TABLE 2. Alignment of reverse primer with the 16S rRNA gene of E. coli, Shigella, and other bacteria

Source Region from bp 448–482 of 16S rRNA gene Accession number

ECR476 primer AGCAAAGGTATTAACTTTACTCC

Target sequence GGAGTAAAGTTAATACCTTTGCT

E. coli K12 (rrsC) GGAGTAAAGTTAATACCTTTGCTa

AE000452

Shigella boydii GGAGTAAAGTTAATACCTTTGCT X96965

S. dysenteriae GGAGTAAAGTTAATACCTTTGCT X80680

S. flexneri GGAGTAAAGTTAATACCTTTGCT X96963

S. sonnei GGAGTAAAGTTAATACCTTTGCT X80726

Haemophilus parasuis GGTGGTGTTTTAATAGAGCATTA AB004025

Proteus vulgaris GTGATAAAGTTAATACCTTTGTC J01874

Enterobacter aerogenes GCGTTAAGGTTAATAACCTTGGC AJ251468

E. sakazakii GTGTTGTGGTTAATAACCGCAGC AB004746

Pantoea agglomerans GCAGAAGAGTTAATACCTTTTC– AF024612

Klebsiella pneumoniae GCGATGAGGTTAATAACCTYATC Y17656

K. planticola GTGNTGTGGTTAATAACCACAGC AB004755

Haemophilus parasuis GTTGTAAAGTTCTTTCGGTGATG AB004037

Underlined bases are mismatches.

a

The same sequence was found in all E. coli reported.

MICROBIAL COMMUNITY WITHIN A GARBAGE-DECOMPOSERVOL. 98, 2004 23

the samples on days 0, 5, 7, 11, 13, 15, 18, 22, 25, 33, 38,

43, 47, and 57 to be analyzed by DGGE (Fig. 3). On the

basis of the DNA sequence from each band, the putative

bacteria closely related to known genera were estimated

(Table 3). The banding pattern on day 0 was derived from

the standardized garbage. The bands derived from the gar-

bage were not detected during the process although the gar-

bage was supplied everyday.

The initial phase of the operation was characterized by

lactic acid bacteria (band A), including Enterococcus (bands

B and E). A distinct change in the profile was observed

from day 7 to 11, as represented by the behavior of bands A,

B and C. During stable decomposition, the banding pattern

was changing throughout the process, i.e., the disappear-

ance of bands C and E, the appearance of bands D and G,

and the transient appearance of bands F and H. Among

them, the appearance of band G (Corynebacterium sp.)

seemed to correlate with the disappearance of band E (En-

terococcus sp.) on around day 22. Approximately 2 weeks

after the pH increased (day 22 to 38), a wide variety of

bands was observed. This may indicate that the fluctuation

in pH produced the higher diversity of the bacterial commu-

nity.

Seven isolates were obtained from the sample on day 22

by cultivation on agar plates (tryptic soy agar; Difco) at

37�C. The DGGE analyses of these isolates indicated that

six were the same as the bacteria corresponding to band D

and the other isolate corresponded to band E (data not

shown). However, bands C, F and G were also detected on

the same day and their corresponding bacteria have not yet

been isolated. The closest relatives of band C or F were

uncultured bacterium and a sequence with high similarity

(>98%) to band G was not found in the database (Table 3).

PCR detection of E. coli 16S rDNA Some selective

cultivation media have been used for clinical detection of

E. coli. As alerted by Sabat et al. (7), however, cultivation

approaches may involve overestimation caused by the low

selectivity of media and/or underestimation by a viable but

nonculturable (VBNC) state of E. coli. In this study, in ad-

FIG. 1. Parameters of decomposing process. (A) Changes in tem-

perature (open circles) and C/N ratio (black squares) during operation.

(B) Changes in moisture content (open circles) and pH (black squares)

during operation. (C) Decomposition rate (a reduced weight per day)

during the following terms; day 0 to 5, day 5 to 10, day 10 to 15,

day 15 to 18, day 18 to 25, day 25 to 33, day 33 to 38, day 38 to 43,

day 43 to 47, and day 47 to 58. Black area represents the amount of re-

duced dry weight in the total reduced weight.

FIG. 2. Bacterial cell numbers were determined by direct counts

(cells/g wet sample, open circles) and plate counts (CFU/g wet sample,

black squares). The number of hybridized cells with the eubacteria

specific probe is indicated by the open triangles.

FIG. 3. DGGE profile of PCR-amplified 16S rDNA fragments

from the bacterial community during the decomposing process. Bands

A–H are discussed in the text. The arrow indicates the direction of

electrophoresis and percentage shows the gradient of DNA denatur-

ants.

HARUTA ET AL. J. BIOSCI. BIOENG.,24

dition, another problem was found on a selective medium,

Eosin-methylene blue agar (Levine) (Nihon Seiyaku, Tokyo),

which is widely applied to cultivate and detect E. coli. The

colony of E. coli on this agar shows a metallic sheen. How-

ever, the metallic sheen derived from the E. coli colony was

not observed when E. coli was mixed with the materials in

the garbage-decomposing system.

Therefore, a PCR detection method for E. coli was ap-

plied on the basis of 16S rDNA. Specific PCR primers were

designed and the PCR conditions were determined. Under

the conditions described in the Materials and Methods sec-

tion, the DNAs from E. coli strains (IAM 12119T

and K12)

were distinguished from those from other bacteria tested in

this study except for S. boydii (Fig. 4A). Different results

were obtained for S. boydii and S. flexneri, although the 16S

rDNA sequences in the PCR-primer regions of S. boydii

were the same as those of S. flexneri. Unknown operon(s) of

16S rDNA in S. boydii should have been amplified with the

primers, ECF73 and ECR476. The amplified product could

be visualized on an agarose gel when 20 pg of E. coli IAM

12119T

or E. coli K12 genomic DNA was applied in a 40 �l

reaction solution (Fig. 4B). The sensitivity was comparable

to that reported for the PCR detection of E. coli by Sabat et

al. (7).

The latter stage of the operation was evaluated for the

existence of E. coli. DNA was extracted from the sample

taken 35 d after the start of operation and applied to detect

E. coli DNA by the PCR method. No amplification was ob-

served when 10, 15 or 20 ng of the DNA was added into a

40 �l reaction solution (Fig. 5). No inhibitory effect of the

DNA solution from the sample on the polymerase was con-

TABLE 3. Identities of DGGE bands in Fig. 3

Band (bp) Closest relative (accession no.) % similarity

A (161) Lactobacillus fermentum (AF477498) 100

Lactobacillus sp. (AF157037) 100

Weissella kimchii (AF515221) 100

W. cibaria (AJ295989) 100

W. confusa (AF510730) 100

Uncultured bacterium clone OUT-77 (AF371481) 100

Uncultured bacterium pPD5 (AF252318) 100

B (160) Enterococcus faecalis (AF515223) 100

C (141) Uncultured bacterium TA9 (AF252314) 99.3

Uncultured bacterium TA3 (AF252309) 99.3

Uncultured bacterium TA8 (AF252313) 97.1

Corynebacterium kroppenstedtii (Y10077) 95.7

Corynebacterium variabile (AJ222816) 95.7

D (160) Uncultured Staphylococcus sp. (AF467406) 98.0

Staphylococcus sciuri (Z26901) 98.0

Staphylococcus sp. (AF384199) 98.0

S. xylosus (AF372580) 98.0

Uncultured bacterium OC92-1 (AB028120) 98.0

E (161) Enterococcus gallinarum (AF277567) 100

E. saccharolyticus (U30931) 100

E. casseliflavus (AF039899) 100

Uncultured bacterium SP4-3 (AB028116) 100

F (161) Uncultured feedlot manure bacterium (AF317380) 98.1

Globicatella sulfidofaciens (AJ297627) 97.5

G (140) Corynebacterium amycolatum (X84244) 97.1

Corynebacterium sp. (Z33615) 97.1

Uncultured Corynebacterium (AF115939) 97.1

H (160) Glacial ice bacterium (AF479371) 96.9

Bacillus aminovorans (X62178) 96.3

FIG. 4. PCR detection of the genomic DNA of E. coli. Agarose

gel separation of PCR mixture. (A) Specificity of the designed primer

pair (ECF73 and ECR476) in the optimized PCR. Lanes: 0, no tem-

plate; 1, E. coli K12 (IAM 1264); 2, E. coli IAM 12119T

; 3, Proteus

vulgaris; 4, Shigella boydii; 5, S. dysenteriae; 6, S. flexneri; 7, S. sonnei;

8, Pantoea agglomerans; 9, Enterobacter sakazakii; 10, E. aerogenes;

11, Klebsiella planticola; 12, K. pneumoniae. (B) Sensitivity of the op-

timized PCR method. Lanes: 0, no template; 1 to 7, 2000 pg, 200 pg,

100 pg, 20 pg, 2 pg, 0.2 pg, and 0.002 pg of E. coli IAM12119T

ge-

nomic DNA; 8 to 14, 0.002 pg, 0.2 pg, 2 pg, 20 pg, 100 pg, 200 pg,

2000 pg of E. coli K12 genomic DNA; M, 100-bp DNA ladder.

MICROBIAL COMMUNITY WITHIN A GARBAGE-DECOMPOSERVOL. 98, 2004 25

firmed by the amplification of E. coli K12 DNA with the

sample DNA solution (data not shown). The detection limit

of E. coli DNA in a 40 �l reaction (20 pg) implies that E.

coli cells would be less than 0.1% of the total number of

cells, approximately <108

cells/g of wet sample.

DISCUSSION

The microorganisms involved in composting processes

such as windrow, static pile, and in-vessel systems have been

studied (8–15). A few molecular ecological studies were re-

ported for in-house garbage treatment systems (1, 2, 16–19).

We have previously analyzed the microbial community de-

grading kitchen garbage under alkaline and high tempera-

ture conditions (Bacillus-dominant community) (1), and also

reported on the decomposition process under acidic condi-

tions (lactobacilli-dominant community with yeast) (18). In

order to compare with these operations, in this study, the

garbage-decomposing system was operated under neutral

pH conditions. The operation was distinct from the alkaline

operation or the acidic operation with regard to airflow rate

or moisture content. The acidic operation was achieved by

the relatively micro aerobic conditions caused by non-addi-

tion of sawdust and by the high moisture content (18). The

airflow rates were different between the operation in this

study (90 l/min) and the operation under alkaline and high

temperature conditions (30 l/min). The decomposition effi-

ciency was comparable to that of the alkaline operation (1).

For the alkaline operation, retaining the high temperature is

difficult and the fluctuation in pH occurs frequently because

the supply of garbage varies with the daily meal. In contrast,

the neutral pH operation was easily achieved by the in-

house treatment system, and 1 kg of garbage was success-

fully treated everyday for longer than 7 weeks. The system

had the further advantage of odorless operation compared

with the ammoniacal or sour smell from the alkaline or

acidic operation, respectively. However, the growth of patho-

genic bacteria should be considered for a decomposer oper-

ated at neutral pH and ambient temperature. In this study,

the existence of E. coli was examined in the decomposing

materials taken after prolonged operation. Conventional

cultivation methods did not yield reliable results for the gar-

bage-decomposing materials. The PCR detection method

was successfully applied with high selectivity. No amplifi-

cation of E. coli DNA was detected in the decomposer,

although the sensitivity was not sufficient to satisfy a public

health regulation as defined for the natural environment

(<103

cfu/g). In order to assure the safety of public health,

the pathogenicity of Staphylococcus sp. or other species de-

tected in this study as well as the improvement in the sensi-

tivity of the E. coli detection should be clarified.

Five to 30% of the total cell population could be cultured

on agar plates (tryptic soy agar, Difco) (Fig. 2). These val-

ues were higher than the values reported for soil and marine

microbial communities. Narihiro et al. also reported the high

culturability of bacteria in garbage-decomposing systems (2).

The bacteria corresponding to the DGGE bands, i.e., bands

D and E, were found in seven isolated bacteria from the

sample on day 22 when 15% of EUB338-hybridized cells

were culturable. The cultivation conditions may simulate,

with regard to nutrient and/or aeration, the environment in

the decomposer. However, DGGE was still a useful tool be-

cause some bacteria which have not been cultivated yet

could be detected by the DGGE bands, such as C, F, and G.

The succession of the community during the process was

easily assessed by the banding pattern without cultivation,

although biases due to DNA extraction and/or PCR amplifi-

cation should be considered.

The most interesting finding of the PCR-DGGE analysis

was that the composition of the bacterial community was

changing during the operation (Fig. 3), although the decom-

position efficiency was stable during the operation, except

for the first week. The transient increase in the pH would

trigger the succession of the banding pattern from day 22 to

38. These flexible changes in the microbial community may

be important for maintaining stable function as Fernandez et

al. suggested (20). The microbial community would have

potential diversity derived from minor populations, although

the DGGE bands represented only a few predominant spe-

cies. It is also noteworthy that the higher diversity and the

highest number of cells were detected during the succes-

sion. On the other hand, the microbial community seemed

to exclude the invasion of bacteria from garbage supplied

daily as well as previous observations (1, 19). Both flexibil-

ity (resilience) and resistance would be characteristics of a

complex microbial community.

The intensity of bands A (Lactobacillus fermentum) and

B (E. faecalis) decreased with a slight increase in pH, and

then Corynebacterium sp. (band C) and Staphylococcus sp.

(band D) appeared at day 11 (Fig. 3). A similar correlation

was observed in a previous paper (18) for L. fermentum and

Staphylococcus spp. The production of bacteriocin by L.

fermentum and E. faecalis (21) may involve this succession.

In general, the enterococcal bacteriocins were only active

against gram-positive bacteria. However, it was reported that

a bacteriocin produced by E. gallinarum strain was active

not only against some gram-positive bacteria but also against

some gram-negative bacteria, such as Pseudomonas aerugi-

nosa, Salmonella typhimurium, and a strain of E. coli (22).

Enterococcus sp. corresponding to band E may be effective

at excluding some pathogenic bacteria. Certain strains of

staphylococci were reported as bacteriocin producers (23)

FIG. 5. PCR detection of E. coli DNA in the decomposing system.

Agarose gel separation of PCR mixture. Lanes: 0, no template; 1 to 3,

10 ng, 15 ng, and 20 ng of the DNA extracted from the sample on

day 35; 4 and 5, 200 pg and 20 pg of E. coli K12 genomic DNA; M,

100-bp DNA ladder.

HARUTA ET AL. J. BIOSCI. BIOENG.,26

suggesting that the bacterium corresponding to band D may

also suppress the growth of some kinds of bacteria. Their

combination possibly acted as a biological control agent

against a variety of unfavorable bacteria in the biodegrada-

tion system. Another possible role of lactic acid bacteria

would be regulation of the pH in the system.

The accumulation of sodium chloride was inevitable dur-

ing the garbage decomposing process. A high salt concen-

tration and osmotic pressure could be selective pressures for

microorganisms. Some bacteria detected by the DGGE pro-

file are known to be halo-tolerant microorganisms, such as

C. kroppenstedtii (band C) (24), C. amycolatum (band G)

(25), and S. sciuri (band D) (26). Prolonged operation would

lead to further succession of the microbial community.

Some DNA sequences of the DGGE bands (bands C–E)

detected at ambient temperature were similar with the se-

quences reported from thermophilic bio-processes, i.e., un-

cultured bacterium from hot composting processes (8); TA9

(AF252314), TA3 (AF252309), and TA8 (AF252313), and

uncultured bacterium from thermophilic wastewater treat-

ment (9); OC92-1 (AB028120) and SP4-3 (AB028116).

These bacteria would be common microorganisms in the

biodegradation of organic materials regardless of tempera-

ture.

A stable decomposition process was characterized by suc-

cession of the bacterial community. A microbial community

would exhibit self-organizing ability by changing its com-

position. Due to this property of a complex microbial com-

munity, the characterization of each bacterium in pure cul-

ture would be insufficient to explain the function of the

community. An overall understanding of the structure and

physiological properties of the microbial community will be

necessary.

ACKNOWLEDGMENTS

This research was supported by the Research for the Future Pro-

gram of the Japan Society for the Promotion of Sciences (JSPS).

We thank Dr. Toshihiko Suzuki of the National Institute of Health

of Japan for his kind preparation of genomic DNA from Shigella

spp.

REFERENCES

1. Haruta, S., Kondo, M., Nakamura, K., Aiba, H., Ueno, S.,

Ishii, M., and Igarashi, Y.: Microbial community changes

during organic solid waste treatment analyzed by double gradi-

ent-denaturing gradient gel electrophoresis and fluorescence

in situ hybridization. Appl. Microbiol. Biotechnol., 59, 224–

231 (2002).

2. Narihiro, T., Yamanaka, Y., and Hiraishi, A.: High cultura-

bility of bacteria in commercially available personal compost-

ers for fed-batch treatment of household biowaste. Microbes

Environ., 18, 94–99 (2003).

3. Zhu, H., Qu, F., and Zhu, L. H.: Isolation of genomic DNAs

from plants, fungi and bacteria using benzyl chloride. Nucleic

Acids Res., 21, 5279–5280 (1993).

4. Maniatis, T., Fritsch, E. F., and Sambrook, J. (ed.): Molec-

ular cloning, 2nd ed. Cold Spring Harbor Laboratory, Cold

Spring Harbor, New York (1982).

5. Muyzer, G., Waal, E. C. D., and Uitterlinden, A. G.: Profil-

ing of complex microbial populations by denaturing gradient

gel electrophoresis analysis of polymerase chain reaction-am-

plified genes coding for 16S rRNA. Appl. Environ. Microbiol.,

59, 695–700 (1993).

6. Amann, R. I., Binder, B. J., Olson, R. J., Chisholm, S. W.,

Devereux, R., and Stahl, D. A.: Combination of 16S rRNA-

targeted oligonucleotide probes with flow cytometry for ana-

lyzing mixed microbial populations. Appl. Envion. Microbiol.,

56, 1919–1925 (1990).

7. Sabat, G., Rose, P., Hickey, W. J., and Harkin, J. M.: Se-

lective and sensitive method for PCR amplification of Esch-

erichia coli 16S rRNA genes in soil. Appl. Environ. Micro-

biol., 66, 844–849 (2000).

8. Dees, P. M. and Ghiorse, W. C.: Microbial diversity in hot

synthetic compost as revealed by PCR-amplified rRNA se-

quences from cultivated isolates and extracted DNA. FEMS

Microbiol. Ecol., 35, 207–216 (2001).

9. Kurisu, F., Satoh, H., Mino, T., and Matsuo, T.: Microbial

community analysis of thermophilic contact oxidation proc-

ess by using ribosomal RNA approaches and the quinone pro-

file method. Water Res., 36, 429–438 (2002).

10. Fergus, C. L.: Thermophilic and thermotolerant molds and

Actinomycetes of mushroom compost during peak heating.

Mycologia, 56, 267–284 (1964).

11. Palmisano, A. C., Maruscik, D. A., Ritchie, C. J., Schwab,

B. S., Harper, S. R., and Rapaport, R. A.: A novel bioreac-

tor simulating composting of municipal solid waste. J. Micro-

biol. Methods, 18, 99–112 (1993).

12. Beffa, T., Blanc, M., Lyon, P. F., Vogt, G., Marchiani, M.,

Fischer, J. L., and Aragno, M.: Isolation of Thermus strains

from hot composts (60 to 80�C). Appl. Environ. Microbiol.,

62, 1723–1727 (1996).

13. Herrmann, R. F. and Shann, J. F.: Microbial community

changes during the composting of municipal solid waste. Mi-

crob. Ecol., 33, 78–85 (1997).

14. Blanc, M., Marilley, L., Beffa, T., and Aragno, M.: Ther-

mophilic bacterial communities in hot composts as revealed

by most probable number counts and molecular (16S rDNA)

methods. FEMS Microbiol. Ecol., 28, 141–149 (1999).

15. Peters, S., Koschinsky, S., Schwieger, F., and Tebbe, C. C.:

Succession of microbial communities during hot composting

as detected by PCR-single strand-conformation polymorphism-

based genetic profiles of small-subunit rRNA genes. Appl.

Environ. Microbiol., 66, 930–936 (2000).

16. Hiraishi, A., Yamanaka, Y., and Narihiro, T.: Seasonal mi-

crobial community dynamics in a flowerpot-using personal

composting system for disposal of household biowaste. J.

Gen. Appl. Microbiol., 46, 133–146 (2000).

17. Ishii, K., Fukui, M., and Takii, S.: Microbial succession

during a composting process as evaluated by denaturing gradi-

ent gel electrophoresis analysis. J. Appl. Microbiol., 89, 768–

777 (2000).

18. Aoshima, M., Pedro, M. S., Haruta, S., Ding, L., Fukada,

T., Kigawa, A., Kodama, T., Ishii, M., and Igarashi, Y.:

Analyses of microbial community within a composter oper-

ated using household garbage with special reference to the ad-

dition of soybean oil. J. Biosci. Bioeng., 91, 456–461 (2001).

19. Hiraishi, A., Narihiro, T., and Yamanaka, Y.: Microbial

community dynamics during start-up operation of flowerpot-

using fed-batch reactors for composting of household bio-

waste. Environ. Microbiol., 5, 765–776 (2003).

20. Fernandez, A. S., Hashsham, S. A., Dollhopf, S. L., Raskin,

L., Glagoleva, O., Dazzo, F. B., Hichey, R., Criddle, C. S.,

and Tiedje, J. M.: Flexible community structure correlates

with stable community function in methanogenic bioreactor

communities perturbed by glucose. Appl. Environ. Microbiol.,

66, 4058–4067 (2000).

21. Hammels, W. P., Weiss, N., and Holzapfel, W.: The genera

Lactobacillus and Carnobacterium, p. 1533–1594. In Balows,

A., Truper, H. G., Dworkin, M., Harder, H., and Schliefer,

K. H. (ed.), The Prokaryotes, 2nd ed., vol. 2. Springer-Verlag,

MICROBIAL COMMUNITY WITHIN A GARBAGE-DECOMPOSERVOL. 98, 2004 27

New York (1992).

22. Jennes, W., Dicks, L. M. T., and Verwoerd, D. J.: Enterocin

012, a bacteriocin produced by Enterococcus gallinarum iso-

lated from the intestinal tract of ostrich. J. Appl. Microbiol.,

88, 349–357 (2000).

23. Skalka, B.: Bacteriocin typing of Staphylococci. Acta Vet.

Brno, 61, 179–187 (1992).

24. Collins, M. D., Falsen, E., Akervall, E., Sjoden, B., and

Alvarez, A.: Corynebacterium kroppenstedtii sp. nov., a novel

corynebacterium that does not contain mycolic acids. Int. J.

Syst. Bacteriol., 48, 1449–1454 (1998).

25. Collins, M. D., Burton, R. A., and Jones, D.: Corynebac-

terium amycolatum sp. nov., a new mycolic acid-less Coryne-

bacterium species from human skin. FEMS Microbiol. Lett.,

49, 349–352 (1988).

26. Kloos, W. E., Schleifer, K. H., and Smith, R. F.: Character-

ization of Staphylococcus sciuri sp. nov. and its subspecies.

Int. J. Syst. Bacteriol., 26, 22–37 (1976).