succeeding togethersucceedinding toge · 30,000 women participating in its network of independent...
TRANSCRIPT
![Page 1: SUCCEEDING TOGETHERSUCCEEDINDING TOGE · 30,000 women participating in its network of independent sales advisors. The concept of empowering women to own and operate their own businesses](https://reader034.vdocuments.mx/reader034/viewer/2022042222/5ec8f551a6b4bd0f446679b7/html5/thumbnails/1.jpg)
SUCCEEDING TOGETHERDING TOGESUCCEEDIN
![Page 2: SUCCEEDING TOGETHERSUCCEEDINDING TOGE · 30,000 women participating in its network of independent sales advisors. The concept of empowering women to own and operate their own businesses](https://reader034.vdocuments.mx/reader034/viewer/2022042222/5ec8f551a6b4bd0f446679b7/html5/thumbnails/2.jpg)
When our clients are successful, we are successful.
2
D. Robert Morris Chairman
Pullman & Comley, LLC
Dear Clients and Friends,
The past several years have been daunting for our businesses, our communities and
our nation. As we move into 2011, we are encouraged to see signs of growth among
our clients and we have reason to believe that the economy will continue to recover.
We would like fi rst to take this opportunity to thank our clients for their support
during this period, and we applaud their efforts to move their businesses and
personal endeavors forward. We will highlight some of those efforts in the pages
that follow.
As you will read, we worked with our clients over the past year to protect their
interests, from defending a college’s fi nancial investments, to providing counsel
on signifi cant estate tax changes, to guiding a group of nursing homes through a
fi nancial restructuring that will both allow them to be successful in the years ahead
and maintain excellent care for their residents.
At the same time, we continued to forge close partnerships with our clients, so that
we are better able to help them make the most of emerging opportunities, whether
securing fi nancing for a hospital’s construction project and equipment expenditures,
fi ling for the fi rst commercial wind project in the state, or helping companies to
broaden their reach, regionally, nationally and internationally.
Members of our fi rm also were active in contributing to the development and
implementation of public policy, including establishing national environmental
guidelines, serving on our legislature’s working group for brownfi elds matters and
serving on the transition teams for the new Connecticut state administration.
Of course, none of these accomplishments would have been possible without
the dedication of all of our attorneys and staff. We are honored to be named one
of Connecticut’s “Best Places to Work” for the third consecutive year. We have
a wonderful culture of mutual respect, strengthened by the enthusiasm and
commitment of each of our employees.
We are excited about the possibilities for 2011 as we move forward with our clients
to foster business growth and to rebuild and revitalize our communities. At Pullman
& Comley, we believe that if we all pull together, we will all succeed together.
CHAIRMAN’S MESSAGE
D. Robert Morris Chairman
![Page 3: SUCCEEDING TOGETHERSUCCEEDINDING TOGE · 30,000 women participating in its network of independent sales advisors. The concept of empowering women to own and operate their own businesses](https://reader034.vdocuments.mx/reader034/viewer/2022042222/5ec8f551a6b4bd0f446679b7/html5/thumbnails/3.jpg)
AsAsAsAsss a aa a aaann n nn n nn acacacacacacacactititititittiveveveveveveveve mmmmm mmmememememememmbebebbebebebeberrr r rrr ofofofooofofof ttt theheehehe C CC C Conononono nenenenenectctcttcc icicccutututut ee ecocococononononon mimimimmic c c cc cococoocoommmmmmmmmmmunununnu itity y siisiisincncccn e ee 19199191919191919, ,,, PuPuPuPuPuPuP llllllllllmamamamamammaman nn n n & & && CoCoCoComlmlmlmleyeyeyey t tttakakakakeseseses p p pp ppppriririririririr ddddedededede ininn t t tthehehhehehh w w w wororoo k k k k wewewew h hhavavavavavvave ee e dododdodoneneneeneenn t t t ttto ooo o ssusususus ppppppppppp ororoorttttttt t ththhthththththeeee ee ststsstsstss atatatatata e’e’e’e’’eee s ss ss effefe fofofofofoortrtrtrtrrrts s s sss totototoott ff fosososososteteteter r rr inininiinnonnononovavavavatitititionononon a aa andndndnd g gg grorororowtwtwtwtwtwth,h,h,hh,h, rrrr rreteteteetetaiaiaaiainn nn bububbububub sisisineneessssssseesseesse anananaa d d d jojojojobsbsbsbs, , anananand d dd d susususustsststaiaiaiaaa n n n vivivivibrbrbrbranananant t t totototownwnwnwnwnww s ssss annanddddd d cccicicic titititiesessessesese . FoFoFoFoFoFoFoFoorrrr r thththththththe e e ee papapapastststst 1 1115 5 5 yeyeyeyyeyey arararararars,s,s,sss w wwe ee hahahah veveveve b bbeeeeeee n n nn rerereetatataataininininnedededeeded bbb bb by y yyyy ththththe e eeCoCoCoCoCCoonnnnnnnececececcce titiitit cucucuc t t t AtAtAAtA totototornrnrnrneyeyeyy G G GGenenennenerereraalal tttoo o rererer pppprrp esese ene t tt thhthhee e DeDDeDepapaap rtrttrtmemementntntnn oof f EcEconononooonoomomomoo icicicc a a aandndnd CCComomommumumuuninin tytyty D Devevelelopopppmemeemem ntntnt (D(D(DDD(DECECECECECECD)DD)D)D)) rr rrrregeegegegeggaararaaaa dididdidingngngn i i itststs eeecoccoc nonnomimm c cc c deedeedd veveveeeloloollopmpmp ennennt t t t prpprprrp ogogogoogggrrarararr msmsms. ThThThisisis hhhhhasasasa iincncn luludeded d dodocucumementntining g loloananss anand d grgrgrgrgggrgrgrgrgrgg anananananaaanaannntstststststtsststs uu ndndddn ererree vvv vararara ioiooioiouss ssssttataatatetetete aa aandndndnd ff fedededddererralal ff funununundidinggng s sssouourcccesess aandndnddn p pprooogrgrgrg amamama ss ss ininininclclclclududududu inining g gg g thththtt e ee MaMaMaManununufafafactctcc ururining g anandd AsAsAAsAsAsAsAsAssAsAsA sisisisisisissis ststttstststststsststs ananannnnanananana cccccececeeececeececceececeececceeecceeeeececece AAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAA AAAAAAAActctttctcctctccccctcccccc , ,, ,, thththt e e UrrUrbbbabaan nn AsAssisisisiststss aanannnceccecec A AAAActct, , thththe e HoHoHoousussinini g ggg TrTrTrrusuust tt FuFFuFundndddd aandndnd ttthehehe HHOMMOMOME EEE AsAsAsA sissis ststststananancececec PPPProroroogrgrgrgrg amamam. . .InInInInnn 22222 2 2 2001010010100000000000,00,0,0, wwwwwwwwwwwwwwwww w wwwweeeeeeeeeeeeeeeeeeeee e rerereeeereereererererererererrererererreererereeprprrrrprrprprprprpprprprprprprprprprprprprppppp esesesseseeessseseeseeseseseseeee eeenenenenneeneeneeeennenneenenenenenennenee tttetetetetettetettettttettt dd dd dddd DEDED CDCDCDDDD i i i innnnnnnn n afafafafaa foffofordrddr ababa lelee h hhououo sisiingng t traraansnsacacctitit onono s ss ththhthatatat pppprororrovivivideded d d momomomom rerer t tthahahan n $2$2$2$22 2 2 22 mimimimilllll ioioion n n n ininininnn lolololoanananans s s s anananana d dd d ovovovovverereeee $$ $ $$3 33 3 3 mimiiimimimmimimm llllllllioioioioionnn n nn iiininnn gg gggggrarararaarar tntntntntntttn s ss s totototo a a a assssssssisisisissst t ttt inininini t tt tthehehehehehe c c ccc crerererer atatatatatioioiooion n nnnn ofofofo m mmmmmororororo e e ee e thththhananananan 33333000000 uuuuninininitststsss o oof f f afafaaffofofofoordrdrdrddababableleleeee h h hhououououououo sisisissisingngngngngngng thththroororouguugu hohohoh ututt t tthehehe ssstatatataatetetetete. .. WeWeWeWeWeWe a aa a alslsslslsso oo o acacacacacacteteteteteted ddd d asasasassas c cccccouououououounsnsnsnsnsnselelelelelel i i i iin n n n n n cocococococonnnnnnnnnnnecececececectititiitititiononononn w wwwwwwitititititth h hhh hh fi fi fi fi fifinananananaan ncncncncnciaiaiaiaiaiaiaal ll l ll asasasasasasassisisisisis ststststststs ananananancececee pp p prorooviviviv dedededeed d d dd dd tototototoooo businesses bby ththe e sts atatte ee ththhhrorouggggu h h mamamanynynyyy mmm mmilillilllililililionononons sss ofofofofof d d dd ddololololollolo lalalalalalarsrsrsrsrss’ ’ ’’’ wowowowowowortrtrtrrtrth h h hhhh ofofofofofofoff gg g gg ggggrarararararaarantntntntntntnnts s s s s s ananananananana dd d d d d d tatattatatatax x xx xx x crcrcrcrcrcrcrrededededededededititititititits,s,s,s,s,s,ss, f f f f fff fununununununundididididididingngngngngngng w ww w w wwhihihihihihichchcchchchh includded incennntitiveves s s fofor r ththe e crcreaeatitionon o oor r rereetetetentntntn ioioion n n ofofof m m morororre e ththhthhanannan 1 11,3,3333300000000 C C CCononononnnenenenectctctttcticicicici utututututt j j j jjobobobobbbobs.s.s.s.s O O O OOOOOurururururur w w w wwwororororork k kkk kk wiwiwiwwiithththththhth DEDEECDCDCD aaalsl o o ininclclududeded m matattetersrs i invnvololvivingng g grarantnts s toto m mununicicipippalalititieiei s s s tototo a aasssssss isisi t t t inin t tthehehehe a aaassssssssss esesesessmsmsmsmenenenent t t t anananaannd dddd clclclccc eaeaeaean-n-upuppu o oooff f fenenvivironmnmenentatalllly-y-cocontntamamininatateded p proropepertrtiees s inin o ordrderer tto o reretuturnrn t thehem m tot pproroduductctivive e usse.e.
WeWe hhavave e alalsoso r repepreresesentnteded t thehe C Cononnenectcticicutut D Devevelelopopmementnt A Aututhohorirityty (CDCDA)A , whw ich offers low coso t fi nan nccinng gtoto bbususininesesseses,s, i in n seseveverarall loloanan t traransnsacactitionons s asas w welell l asas d dococumumenenteted d lol ana gguauararantnty transas ctc ions. In the pasast yeyeyeararar, , wewewe h h helelelpepeped d d CDDDA AA reedocuc ment iitsts invn ololvevementn in infusing capital directly or indirectly into borrowers exexexxpepepeeriririenenenencicicic ngngngng s s ssomomomome e e e fi fi fi finanananancncncciaiaaal l dididiistststrereessssss, , anannand d dd wewew h havava e e prprovoviddededd aadvd icice e ono ttheh lloaooan ororo gguaranty structural chchchchoioioioicecececess ss ththththatattat C CCCDADADADA h hasas b beeeen n coconsnnsididdererining gg toto h helelp p asassis ststs t thehesese c comompapaniess in n ththeir tuurnr ararouo nd effortst .
3
CTech IncUBator Our skills in capital formation and work for
Connecticut Innovations (CI) in its investments in
Connecticut’s early and growth stage technology-
based companies have led us to become a
proud legal sponsor of CTech IncUBator, an
entrepreneurial assistance initiative of the
University of Bridgeport and CI. CTech IncUBator
provides facilities, support and professional
services expertise to encourage the growth of
innovative start-ups and early-stage technology-
based companies in Connecticut. Our commitment
includes providing pro bono legal services and
conducting a seminar on venture capital fi nancing.
Law Firm Alliance Celebrates 10 Years
Pullman & Comley offers its clients the benefi t of international reach and local experience through its participation in The Law Firm Alliance, a global network of fi rms for referral of legal matters. The Alliance, which celebrates its 10th anniversary this year in London, brings together the expertise of more than 2,500 attorneys offering a wide range of legal and industry specialties. Member fi rms refer client matters to LFA members in other locales with the knowledge that their clients’ legal needs will be met with a consistently high level of quality and service.
DEVELOPING A SUSTAINABLE ECONOMIC FUTURE IN CONNECTICUTAs an active member of the Connecticut economic community since 1919, Pullman & Comley takes pride in the work we have done to support the state’s efforts to foster innovation and growth, retain businesses and jobs, and sustain vibrant towns and cities. For the past 15 years, we have been retained by the Connecticut Attorney General to represent the Department of Economic and Community Development (DECD) regarding its economic development programs. This has included documenting loans and grants under various state and federal funding sources and programs including the Manufacturing and Assistance Act, the Urban Assistance Act, the Housing Trust Fund and the HOME Assistance Program. In 2010, we represented DECD in affordable housing transactions that provided more than $22 million in loans and over $3 million in grants to assist in the creation of more than 300 units of affordable housing throughout the state. We also acted as counsel in connection with fi nancial assistance provided to businesses by the state through many millions of dollars’ worth of grants and tax credits, funding which included incentives for the creation or retention of more than 1,300 Connecticut jobs. Our work with DECD also included matters involving grants to municipalities to assist in the assessment and clean-up of environmentally-contaminated properties in order to return them to productive use.
We have also represented the Connecticut Development Authority (CDA), which offers low cost fi nancing to businesses, in several loan transactions as well as documented loan guaranty transactions. In the past year, we helped CDA redocument its involvement in infusing capital directly or indirectly into borrowers experiencing some fi nancial distress, and we have provided advice on the loan or guaranty structural choices that CDA has been considering to help assist these companies in their turnaround efforts.
![Page 4: SUCCEEDING TOGETHERSUCCEEDINDING TOGE · 30,000 women participating in its network of independent sales advisors. The concept of empowering women to own and operate their own businesses](https://reader034.vdocuments.mx/reader034/viewer/2022042222/5ec8f551a6b4bd0f446679b7/html5/thumbnails/4.jpg)
4
Reorganizing to Maintain Superior CareIn 2010, Pullman & Comley’s Bankruptcy and Creditors’ Rights practice helped the owners of Affi nity Healthcare Management, which has skilled nursing facilities in the Greater Hartford area, emerge from bankruptcy without a change in ownership.
This was the fi rst successful reorganization of a nursing home facility in Connecticut since 2005, and one of only two such reorganizations in more than 10 years. The reorganization was accomplished through the combined efforts of Affi nity and several federal and state agencies, as well as through the support of their vendors and employees. The facilities, which are renowned for their superior patient care, maintained the high level of care throughout the bankruptcy reorganization efforts.
The fi rm worked closely with the Connecticut Department of Social Services, the Connecticut Department of Revenue Services, the U.S. Department of Housing and Urban Development and the Internal Revenue Service to modify the HUD-held mortgages, which led to substantial savings in annual rent for the homes. The reorganization resulted in the forgiveness of certain tax obligations; long-term repayment plans for the balance of past due taxes; and a settlement with the Connecticut Department of Social Services that substantially reduced prepetition obligations that would have otherwise prevented the entire reorganization.
“The reorganization process has permitted us to focus on what Affi nity does best, and we are stronger than ever. Pullman & Comley’s ability to coordinate with the Connecticut Department of Social Services, HUD and the IRS played a critical role in keeping these homes open.”
Benjamin Fischman, Managing Member,
Affi nity Healthcare Management
EXPANDING THE REACH OF HEALTH CARE INNOVATIONInSite One is at the forefront of cloud-based medical archiving,
allowing health care organizations to simplify data retention,
reduce associated costs, and share images and records among
medical professionals to help with the effective diagnosis and
treatment of illnesses. In 2010, we represented Wallingford-based
InSite One in its sale to Dell, the health care industry’s leading
provider of information technology services. The acquisition will
allow Dell to move its archiving to the cloud, helping its hospital
customers reduce the cost of data storage and retention and
improve the delivery of health care. As part of Dell, InSite One
will reach more customers and have an even greater impact on
medical innovation and the improvement of patient care.
![Page 5: SUCCEEDING TOGETHERSUCCEEDINDING TOGE · 30,000 women participating in its network of independent sales advisors. The concept of empowering women to own and operate their own businesses](https://reader034.vdocuments.mx/reader034/viewer/2022042222/5ec8f551a6b4bd0f446679b7/html5/thumbnails/5.jpg)
As the regional market becomes more competitive, Pullman & Comley has played an integral role in helping many Connecticut businesses expand the reach of their services and products outside of the state.
One such client is the accounting fi rm of Blum, Shapiro and Company, P.C., which continues to add to the services it provides in accounting, tax and consulting to business and industry. While much of its growth has been internal, Blum has also been extremely active in acquiring other accounting fi rms and business consulting services in Connecticut, ranging from Westport to Shelton and New Haven. Most recently, Blum has expanded into Massachusetts with its acquisition of an accounting fi rm headquartered in the greater Boston area.
The work performed by Pullman attorneys has ranged from crafting the agreements and plans of merger and developing asset acquisition documents to revising and restructuring partner compensation arrangements, employment agreements and 409A - compliant deferred compensation plans.
We are proud that, since 2006, we have represented BlumShapiro in key transactions and partnered with them in implementing their expansion strategy to become the largest accounting, tax and business consulting fi rm in New England.
BlumShapiro:Building a Regional Powerhouse
5
The largest direct seller of fashion jewelry in the world, lia sophia® now has more than 30,000 women participating in its network of independent sales advisors. The concept of empowering women to own and operate their own businesses has driven robust growth, and international expansion was the natural next step. During 2010, we helped lia sophia launch in certain Canadian provinces, and capitalizing on that success, then counseled its team of fi nancial experts, procurement specialists, accountants and insurance providers on structuring the company’s development of a procurement, packaging and distribution center in Switzerland. On March 1, 2011, lia sophia launched in Germany, with hundreds of applications for advisors promptly fl owing in. Two days later, lia sophia launched in Quebec, with Elena Kiam, a co-owner and the creative director of lia sophia, celebrating in both French and English. We take great satisfaction in being a true strategic business advisor to this exciting company and the Kiam family, as they continue to grow and prosper.
Going Global with lia sophia®
![Page 6: SUCCEEDING TOGETHERSUCCEEDINDING TOGE · 30,000 women participating in its network of independent sales advisors. The concept of empowering women to own and operate their own businesses](https://reader034.vdocuments.mx/reader034/viewer/2022042222/5ec8f551a6b4bd0f446679b7/html5/thumbnails/6.jpg)
Eliot B. Gersten Joins Litigation Team
Pullman & Comley’s Litigation Department welcomed Eliot Gersten in August 2010. He focuses his practice on complex litigation involving both individuals and companies. The Connecticut Law Tribune selected Eliot as one of the “Dozen Who Made a Difference” in 2010 for successfully challenging the candidacy of Susan Bysiewicz for Connecticut Attorney General.
Congratulations to Andrew J. McDonald
Pullman & Comley congratulates former Stamford partner Andrew J. McDonald, who resigned from the fi rm at the end of 2010 to serve as General Counsel to Governor Dannel P. Malloy. In his new role, Andrew oversees the legal operations of the Governor’s Offi ce, as well as the in-house legal operations of the Executive Branch’s departments and agencies. Andrew, who also served as a Connecticut State Senator from 2003-2010, has been our friend and colleague for almost 20 years, and it has been an honor to have worked with him. Our loss is Connecticut’s gain.
6
Securing Results in Securities LitigationThe last several years of economic distress have seen an increasing number of legal cases related to the securities
industry and investor/broker disputes. In 2010, Pullman & Comley was involved in three signifi cant decisions to
prosecute or defend our clients’ interests in this area.
In June, we conducted a two week arbitration on behalf of one of New England’s premier liberal arts colleges.
Our client claimed that its fi nancial broker had failed to make trades of stock gifted to the college in accordance
with their long-standing agreement. The value of several of those stocks plummeted after the market collapse,
resulting in the college’s loss of hundreds of thousands of dollars. After a nine-day hearing arbitrated by the
Financial Industry Regulatory Authority (FINRA), the FINRA panel found in favor of our client and awarded it
a nearly 100 percent return on its losses.
On the heels of that victory, we were asked to defend one of our fi nancial advisory clients in a lawsuit brought by
an individual who said she had suffered signifi cant losses when the market crashed. Her account, however, was
governed by an arbitration agreement. She challenged the agreement as being an adhesion contract, which she
allegedly signed under duress. We proved otherwise and succeeded in securing a dismissal of the case.
Finally, towards the end of the year, we represented another of our brokerage clients which had been sued by
customers claiming more than $100,000 in losses during the market downturn, allegedly because of poor asset
allocation and over concentration in corporate bonds. After a fi ve day hearing, the FINRA arbitration panel rejected
the bulk of the customers’ claims and limited its award to the out-of-pocket costs they had incurred in the matter.
![Page 7: SUCCEEDING TOGETHERSUCCEEDINDING TOGE · 30,000 women participating in its network of independent sales advisors. The concept of empowering women to own and operate their own businesses](https://reader034.vdocuments.mx/reader034/viewer/2022042222/5ec8f551a6b4bd0f446679b7/html5/thumbnails/7.jpg)
7
“Pullman & Comley consistently provided
common sense advice and creative alternatives
while navigating the complex factual, legal and
procedural terrain in which we were situated. An
indefatigable diligence and attention to detail
provided for a positive outcome for our company.”
Scott S. Cramer, Vice President, General Counsel
and Corporate Secretary, Magnetek, Inc.
Pullman & Comley’s environmental attorneys are very active in helping develop and implement policies to meet ongoing challenges. Attorney Christopher P. McCormack leads the task group revising the Phase II Environmental Site Assessment standards published by ASTM International, an independent standard-setting body, and serves as membership secretary for ASTM Committee E50 on Environmental Assessment, Risk Management and Corrective Action. Environmental Department chair Diane W. Whitney served on the transition team for Connecticut Attorney General George Jepsen; and Lee D. Hoffman served as co-chair of the Energy Policy Working Group for Governor Dannel P. Malloy, providing policy advice in the area of energy, including lowering electric rates in Connecticut and increasing energy effi ciency and renewable energy efforts. Attorney Hoffman also serves on the state legislature’s working group for brownfi elds matters.
MEETING ENVIRONMENTAL CHALLENGESPullman & Comley’s Environmental Department serves
clients that include small businesses, cutting-edge
renewable energy companies and large manufacturers.
We address issues ranging from the state Department of
Environmental Protection (DEP) and U.S. Environmental
Protection Agency permitting, defense of enforcement
actions and land use matters, to litigation in all courts,
including appeals. In 2010 we defended Magnetek, Inc.,
a publicly-traded manufacturer of digital power and
motion control systems, against claims concerning
contamination of one of its former facilities in Bridgeport,
Connecticut. Magnetek was sued separately by both the
present property owner and DEP over environmental
cleanup responsibility. We were able to help our client
resolve the DEP’s claims on terms that were both highly
favorable and tactically benefi cial in defending the
property owner’s claims. The owner initially chose to
go to trial – but after several days of evidence, agreed to
settle for a small fraction of its pretrial demand.
Other notable matters in 2010 included a victory on all
issues in a multi-site Superfund litigation matter, the
settlement of a toxic torts suit on behalf of an electronics
company in Milford, the successful defense of a
municipality in a complicated wetlands case, defense
of a Fortune 500 company in a DEP enforcement action,
and the fi ling for the permitting of the fi rst commercial
wind generation project in the state.
![Page 8: SUCCEEDING TOGETHERSUCCEEDINDING TOGE · 30,000 women participating in its network of independent sales advisors. The concept of empowering women to own and operate their own businesses](https://reader034.vdocuments.mx/reader034/viewer/2022042222/5ec8f551a6b4bd0f446679b7/html5/thumbnails/8.jpg)
8
Trusted Advisors in Estate Tax SolutionsThere have been a number of developments in the
estate tax laws over the past several years, including
the recent passage of the federal Tax Relief Act of
2010, which has important implications for estate,
gift and generation-skipping planning during 2011
and 2012. Pullman & Comley’s Trusts and Estates
attorneys stay current with federal and Connecticut
gift and estate tax law changes and the latest
cutting-edge planning techniques. We assist our
clients in maximizing the transfer of wealth for the
benefi t of their families or designated charities,
and recommend various strategies to our clients
to help them minimize the impact of transfer
taxes under federal and Connecticut law. We also
represent and provide guidance to corporate and
individual fi duciaries in their administration of
trusts and estates, including representation before
the Connecticut probate courts.
Delivering Results in Property Valuation
Connecticut law requires communities
to revalue all real estate within their
jurisdictions at least once every fi ve years.
When the City of Norwalk launched a
revaluation on its October 1, 2008 Grand List,
it valued the property occupied by Wal art-M
on Connecticut Avenue at almost $28 million.
Asked by the property owner to examine the
proposed assessment, Pullman & Comley
valuation attorneys concluded, based on
their experience and market knowledge,
that it was most likely excessive. As a fi rst
step in a tax appeal, the attorneys met with
the revaluation company. Based on that
meeting, the revaluation company reduced the
proposed value by nearly $9 million, saving
the company more than $600,000 over the
fi ve-year revaluation term. While a Superior
Court appeal followed, the owner was able to
achieve a signifi cant portion of his objective at
the local level.
Cybersecurity and Infrastructure ProtectionThere is no escaping the fact that our lives and businesses are now tracked, stored, measured and driven by electronic means. The fi rm’s Cybersecurity and Infrastructure Protection practice counsels clients on the measures they can implement to protect themselves and their businesses. We also help clients recover from electronic data loss or destruction, identity theft, unauthorized access, intellectual property and trade secrets theft or economic espionage, disruption of services and damage to their reputation that may result from a cyber attack.
Our attorneys address a myriad of related issues ranging from employee computer misuse to compliance with current and proposed laws and regulations governing the Internet and e-commerce. We help develop strategic plans, policies and resilience goals to protect critical infrastructure and resources, mitigating potential liability from both man-made events, such as cyber crime and terrorism, and other disruptive events, including natural disaster. While no one can reroute hurricanes, intercept all cyber attacks or prevent all disruptions, we educate our clients on proactive, rather than reactive, ways to address the emerging risks that are interwoven into their lives, businesses, infrastructures and communities.
![Page 9: SUCCEEDING TOGETHERSUCCEEDINDING TOGE · 30,000 women participating in its network of independent sales advisors. The concept of empowering women to own and operate their own businesses](https://reader034.vdocuments.mx/reader034/viewer/2022042222/5ec8f551a6b4bd0f446679b7/html5/thumbnails/9.jpg)
9
“Pullman & Comley’s advice was invaluable throughout the entire transaction. Their professionalism
and commitment in representing us led to a great outcome for the company and its shareholders.
It was especially gratifying that the lead attorney was the same person who had incorporated MAA
more than 19 years earlier, when we were just two anesthesiologists.”
Dr. Jeff rey Wagner, Founder, Milford Anesthesia Associates
“It was reassuring to me to be able to rely on the
attorneys at Pullman & Comley at every step of this
diffi cult fi nancing transaction. Their timely and helpful
advice on the many unexpected twists and turns of the
deal was critical to making the fi nancing a success.”
Patrick C. Minicus, Vice President for Finance and CFO, Norwalk Hospital
GUIDING A MEDICAL PRACTICE THROUGH A SUCCESSFUL TRANSITIONIn December 2010, a team of our corporate and health care attorneys represented Milford Anesthesia
Associates (MAA) and its 24 physician-owners in the sale of the medical practice to an affi liate of
publicly-held Emergency Medical Services Corporation (EMSC). MAA, with more than 100 medical
professionals, provides outsourced anesthesia services to nine hospitals and 18 ambulatory surgery centers
in Connecticut and Massachusetts. The transaction was among the largest of its kind in New England
during 2010 and is expected to contribute approximately $40 million to EMSC’s annual net revenue.
Funding Growth at Norwalk HospitalIn December 2010, Pullman & Comley’s Public Finance
attorneys, with assistance from our Health Care and
Environmental Departments, represented Norwalk
Hospital in connection with fi nancing the reconstruction
of its parking garage and purchasing various capital
equipment items. The fi nancing was accomplished
through the issuance of $46,840,000 of tax-exempt
State of Connecticut Health and Educational Facilities
Authority (CHEFA) Revenue Bonds, the proceeds of
which were loaned to the hospital for its garage and
other projects. The bonds were sold directly to three
institutional investors, including an affi liate of General
Electric, through CHEFA’s private placement program.
As counsel to the hospital, we assisted in all aspects of
the transaction, including securing favorable fi nancing
terms for the hospital through the negotiation of the
investor term sheets. In addition, we helped structure a
novel escrow arrangement with CHEFA for the parking
garage construction proceeds that allowed the hospital to
close the bond issue while various zoning appeals on the
parking garage were still pending, locking in relatively
low interest rates on the bonds before the dramatic rate
spike at the end of the year.
Randall C. Mathieson
Rand Mathieson joined Pullman & Comley in 2010. His practice includes corporate and securities law, health care, franchising, mergers and acquisitions, joint ventures, commercial fi nancing, private equity, venture capital and regulatory compliance.
![Page 10: SUCCEEDING TOGETHERSUCCEEDINDING TOGE · 30,000 women participating in its network of independent sales advisors. The concept of empowering women to own and operate their own businesses](https://reader034.vdocuments.mx/reader034/viewer/2022042222/5ec8f551a6b4bd0f446679b7/html5/thumbnails/10.jpg)
®
10
WWWWhWhWhWWWWhWhWWWWWW enennenn MMMMMMMMarararararararararkk kk kkkkk TiTiTiTTiTiTiTTTiiilllllllllllllllllllllllininininininininininininngeggggegegeggegegegeg rrrrrrr aaaanananananananaanaaanannnnnddddddddddddddd d ddd d DDaDDaDDaDaDaaDaDaaDaDaDaDaDaDaDaDDDDaDaaDaDaavvivivivivvvviviivvivivvivivivivvivivividdddddddddddd dd dd DDuDDDuDDuDuDuDuDuDDuDDuuuDuDuDuuuDuu hhchchchcchchchchchhchhchchchchchhhhccchememememmememememememememmeeemememememmmememeee inininninininninininniniin llllolooollolllol sttstststt ttttt t thehhheheheheheirriririr bbb b bbbbbelelellleleelelovovovovovovovovvovvedededededededddddedededdeedd d dddddd d dd dd d dogogoogggogogoogooggogsssss ssssss
RRRiRiRiRiRiiiiiRRiRRRRiiiiiededededededededdededdeeedeedddedeleelelelelelelleeeleleelee aa a aa aa aa aaaa andndndndndnddndndnddddnddn CC CC CC CCCC CCC CCCCCododoododododododododdooddddodoooddoooooo yyyy yy y y yyy y yyyyyyy totototototototootottotooott c cc cc ccc cc cccananaaaaaaaanannnnnnaanaannnnaaannnaaaaanannananccccccceceeeceeeeececeeeeeceeeeec r,r,r,rr,r tttt tttttthehheheehehehehehehh y y yyyyy wawawawaw ntntnttedededddeddd ttt ttoo o o oo prprprprprprrprp ovovovovovovvovovovvvvididididddididde e ee sususususuususuusussussusuuus ppppppppppppppppppppppppppppporororororororoorrororororoo tt t t t ttttt totototototototootototottototototoooooootto oooo o o o oo oththththhthththhthththhthhhhthhhthererererererererrerrerererreers ss s ssss s s s ss ssss whwhwhwhwhwhwhwhwhwhwhwhhwhwhwhhhwhwwhwhosososososososssssosssosoooooosoo eeeeeeeeee eeeee eee e eee pepepepepepeppepepeppeeeetttstsstststtt wwwwwwerereerrre e eeeeee eee e e ththththththththhthhththththrerrererererrererereereeeataataatatattaa eneneeeneeeee ededdededeedddd b bbbb bbbbbbbyyyyy y yyyythththththththhhhhtthhhhhisisisiisisisisii d d ddd dd ddddddevevevevevevevevevevevveeeeveevee asasasasassasasasasassasssssstatatatatatataatatataaaatitititiiiitiititttiitititiiiiingngnngngngngngngngngngnggngngnggngggn d ddd d dddd dd ddisssisissisisississseaeaeaeaeaaeaaeaeaeaaaaaaaaeaeaeaeaeaeaasssssssseeseeeeesssesseeesesesseesss . ... . MMMMMaMaMaMaaaMMaaMMMaaarkrkrkrkkrkrk c c cc ccccononoonoononnonononnoono tatatatatatttaataactctctcccttcc edededdddddded uu uu u uu us s s sssss ss tototototottotottottttttttt h h hhhhhhh h elelelelleleeee p pp p ppppppppfofofofofofofoffoofoooffoormrmrmrmrmrmrmrmmmmrmmmmrmmmmrmmrr a aa a aaaaaa aaaaa aann nn nnn nnnnn ororororororororororrrgagagagagagaagaaaaagagaaggaanninininininnnniiniininininnizazazazazazazazaaazazzaaatitttittitititiititititiit ononononnnononnononononnonnononnoonnn ttttttttttt ttttttttttthhahahahhahhahahahahahhaaattt tt t t t tttt wowowowowwoowoowowowoowowoululululululuuuuu d d ddddddddd ofofofofofoffooofofofo fefefefeeeer rr opopopopopopoopoooo titittititit ononononnnnnnnnnnnons s ssssss totototooootooooooototoo ththththththththththhttthhththososososososososososossoosee e e e ee e fafafafafafafafaffaaf cecececececececececeeceeed dddddd dd dddddddddd wiwiwiwiwiwiiwiwiwiwiwwwiwiwiwwww thththththhthhththththttththtthththttth a a a aaaaaa aaaaa p pp p ppp p ppppp ppppppppppppeeeeeeeeeeteteteteteteeeeteteeeteteeeetteetee ’s’s’s’sss’s’sss’s’s’’s cc c cc c cccanaaanaaaanaanananaaanaa ceccecececcececeeec r rr rrr r didididididididddddid agagagagaggagggaagaagagaagnonononoononon sisisisisisisisiis s.s.s.s.ss.s.ss PPPPP PP PPPPPPPululululululuuuuluu lmlmlmlmmmmlmllmllllmlmlmlmlml aaanananananananananaannaaaa & & &&& &&&&&&& &&&&& CoCoCoCoCoCoooCoCoCoooCoCooommlmlmlmlmmmmlmllmlmmmlmmmmmmmmleyeyeyeyeyyyeyeyeeyeyeyeyyy a aa a a aa aaaaaaaaaatttttttttttttttttttttttttt oroorororororororororrrrorneneneneneneneneneeneneneennnneysysyyysysysysysyssysysysysyssssy hhhhhh hhh h hhhhhhhh hhhhhhhhhhhhhhanananaaaanananannannndddddldldlddldlddldledeeddedddddedede aaa aa aa aallllllll oo o offf f f ff ffff f ff ththththtthththththtt e e eee eeeee leleleleleleegagagagagagaagagag l l l l asasasassasassasssssssssspepppeepepeepepeepeepeeeepepeepepp ctctctcttccc sss s s s ss s oofoofofofofofoffoffffff ffofofofofofofofofoffofofoofooofoooooff rmrmrrmrmrmmmrmmrrmrmrmrmrmmmmminininiiininininininininiinng gg gg ggggg gg ggg ggggggggg a a aaaaaaaaa aa aaaaaaa pupuppuppupupupupupuppupupuppppuppp blblblblblblblblbblbbbbblbbbb iciciciciciciciiciciiccciciciciccic cc c ccccccccccccccccccccccchahahahahahahahahahaaaahaahh riririririiriiririrririrritytytytytyyytytytytyyy n nn nnnnnamamamamamamamamama ededededddeedddddddee f f f f ff fffororororororrrrrorrorro t t tt ttt heheheheheheeheiririrrir t t tttttttwwowwowooooow p p p peeetetetettetetete ssss:s:s:::ss:s::: TT TTTTTTTTTTTTTTT TTTThhhhhhheheheheheehehhhhehhehhhehhhe RRRiRiRiRRiRiRRiRiiRRRRRRiiRRiedeededededeedededededeedede eeleleelelelleleeleleeelelelelle a a aa a a aaaaaaa aaaandndndndndndndndndndndnddddddndnddn CCC CC CC CCC CCCododododododdodoodddddodddoooododdoddyyyy y yyyy yy yyyyyyyyy FuFuFuFuFuFuuFuFuuFuuundndndndnddndndndnndndndnddnn , ,, ,, InInInInnnnInIInc.c.c.c.c.c.c.cc O OOOO OOOOO uurururururururrururuuuuu w w w ww wwwwwororoorooorrrrroororrrrrkk k k ininninnnnnccclccludududddddddedededdededededddddddddddd ddddd ddddd dddd dddd dddddddddddrrrararararaaarararaararrrrarraarar fffftftftftfttfftttftf ininininnnnng g g g ggggaaalalalalalaallalalllaaalllaaa l l lll lllllll ll ofofofofofoffoffofofofoffooooofoof t t t t ttt ttttt theheheheheheheheheheeheheehheeehe l ll l l lllll lllegegegegegeggggeggegegggggegggaaaaaaaaalalalalalallalllalalaa d dd d docococococococococccuumumumummmmmumumumummeneneneennneenee tstststststtststssst t t t tt t tto o ooo o oo oo fofofoffofoofoff rmrmrmrmrmmmrmmrmmmmrmmmmmmm tt t ttt t tttttttttttttthheheehehheehehehhhhh o o ooooorgrgrggrgrgggggggaananananannaananannannannannnnnnnnnniiziiziziziziziziziziiiiziizizzizizizizizzzizzzizizizaaatatatatatattattaaattiiioioiooiioioioon;n;n;nnnn;n;n fififi fi fififififififififi fififififififififilililililililililiiliiingnnngngngngnggngngnngngggnggnng a a aaa a aaaaaa FF F FFF FFFFFF FFF FFFFFooooooooorooororororooroorororoooo mmmmmmmm mmmm mmmmmmmmmmmmmmm 1010101010001010111100232323232323232322332332 tt t tttto o oooo o o esesesesesesesssseeeseeseee tatattatattattaatatabbblblbblbllblbbllisisisisisisiissh h h h hhhhh hh ititititititittittts s sss s s ss ttatatatatattattataaaatat x-x-x-x-xx-x-xxx-xxx eeeeexexexexexexxxxeexexeexexexxxxxxxeeeeeemeeememememememmeeeemeemeememeeeemmmmmmmppppppptptpptpptptptptptpt s s ss ss sssstatataataattattaaatututututtuutututtus;s;s;s;s;s;s;s; drdrdrdrdrdddrdrddrddrdrafafafafafafaafafaa tititititiiiiiingngngngngngngngngggngngggngg c cccccccccccccccccccccororororororororrorororrpopopopopopopoppopoop rarararararararaaaaaateteteteteteteeeeeette p p p p p pppppololoololoolololo iiicicicicicccicici ieieieieieieiees;s;s;ss;sss;s;s;ss;s;ssss a a aaaaaaaaaadvdvdddddvdvdvdvddvdvddvdvvviisisisissisisssisisssisiiinininninnnnnnnnnnnggg gg ggggg gg ggg g g gg ggggggg tttttththththththththtttttthtthththtththhththhhhhhtttthheeeeee e eeee ee bbbbboboboobobboooaaaaararra d ddd d d dofofofofofofofofoffoffooofffooooffofofoofooofofooffooo ddddddddddddddd dd ddd dddiiiiririririiiririririiiriiriiireeeeeecececececcecceececeeccctotottototototottotooorsrsrsrssssrsrsrsrrss ooo ooooooooo oooon n n nn nn n nn n cococococococococcoococoorprprprprprpororrrororrorororoororatatatatatatttatatatatattate ee e eeeeeeeeeeee gogogogogogoggogogoogooovevevevevevevevevevevevveveveveeeeeernrnrnrnrnrnrnnnnnrnrnrrnrnnnrnaaaaaaananannnannnnnnannnnnnnannnnaannannnanna cccccccecececeecccecceeceec p pppp ppprrararaactctcttticicicicicesesesess;; ; ;dededededededededededededdededed vevveveveveveveveeeeev lolololololololololoololll pippppipipipipipiiipipipippipp ngngngngngnggngngnnn tt tttttthehehehehhehehehehehee p pp p ppppppppriiirririrrirrrr vavavavvavavaavavavaavavavvvvvv cyccyccycycycycyycyyccyccycycyy p p ppp pp p p pppppppp pppololololoollolloolooolooloo iciicicicicicicicicyyy y y yyyyyyy yy y y y y yy yyyy fofofffofofofofooofofofoffoofofofofofooofffoffoofooforrrrrrrrr rrr r r r tthtththththththtththtthhhhheeeeee ee FFFuFuFuuundndndndndn ’s’s’ss w ww wwebebbebbsisissiteteee; ; ;;;ananananananananaaanaaanananana d ddd d dd d dddddddd ddd rerereereeeererererrr gggigigiggigggigg stststtststssterereererere inininininninninnnnng g g gg gggg ththththtthttthhthe ee e eee eee orororoororororrorororgagagagaggagagagaaagagagagagagaagaaagg ninininininininininiinininininnininininininininizzzzzzazazazazzzzzaazzzaattitititiitititittit oooononoonn ii iin nn n CoCoCoConnnnnnnnnnnnnnnnnnececececcectititittiicucucuuuuc t t t tt ananananannnaananannd dd d dd dNeNNNNeNeNeNNNNeNeNNeNNNNNeNeNeNNNeNNNeNeNeeeeNeeeeww www wwwwwww www www YYoYYoYoYYoYYYoYoYoYY rkrkrkrkrkrkkrkkkkrrk ttt tt t tttoooo oo o o o o o sssosososososoosoososoososososossosolillilillliiilillillil iiciiicicccicicit t tt tttt t t fuffufuuufufufufufufufuffuf ndndndnnddndndnnddddss.s.s.s.ss.s.s.sss.s. TTT T T T T hhehehhheeh F FFunununund’d’dd’’s sss mimimmm sssss ioioon n n isisissisississs t t ttttttooooo oppppprprprprrprppprrrprrppprprprrpppprprrprppp oovooovovovoovovoovvvvoovo ididididdidddddddddeeeeeeeeeeee eee eeeee fifififi fi fififi nanananananananaaanaaancncnnnncncncncncncncnncciaiaiaiaiiaial l ll susususususuupppppppppppppppppppppppp oroorororororooort t t t t tottotototoo t thohohoh seseeeseess n nn neeeeeeeeeeedidididddiidid ngngngngnnngng aa a a aaasssssssssssssss isiisisistattattatancncncnce ee eeewwwwwiwwwwiwiwiwwwiwiwiwwiwwiwiwiwwwiwiwwwiwwwwwwwwwwiwiwiwwwwwww ththhhththththhhththhthtttth ttttttttt ttttttttttthhhehheheheheehehehehehehehheehe e eeeeeeeeeexpxpxpxpxpxpxpxxx enenenennennsesesees s ss asasasasasassasasassasasassosososoosossos cicicicicic atatataatatta ededededededdedd w ww ww itititi h h hhhh trtrtrrreaeaeaeaee tititititititit ngngngngngngng a aaaaaa ppppp ppetetet wwwwwitititiitth hhh hh hhcacacacacancncncccccnccccncncnncccccccccccceereererrreereer.. ItItItIt a a a aalslslslso o o o prprprprp ovovovovvvvvvididididididddididdiddesessseses aa aaaaa c c ccccccomomomomomommmmumumumumumuumumumumuninininininininininn tytytytytytytyty t t ttt thahahahahhaaaat t t t asasasaassisissis stststs ss sss wwiwiiww thththhthth eeeeeeeeememmmmmeeeemeeeeemeemmemeemmemmmmmootootototioioioioonananananal l l l susususus ppppppppppppppporororororororo t t t ttt tt asasasasaassss w wwwwwelelelelele l l l lll asasasasasasasa u uu uu u p-p-p-p-p-p-p-p-p--tototototoototototoootoo-dd-d-dd-d-d-dd-d- atatatataatate ee e onononooncoccoc lolooogigigig cc cc iininininiinnfofofoofoooormrmrmrmrmatatatattioioioioon n nnnnnn fofofofofoofofor r r rrr ananananannannnyoyoyoyoyoyoyoyonenenenenene w wwwwwwwhohohohohohohoosesesesesesessese p p p pp pppeteteteteteetetetetetet h hhhh h hhhhaasasasasasasasa cc c c cccanananananancececcececcecececerr.rr.rr.r.r. T T T TT Thihihiihhhih ss s ss mimimimimm sssssss ioioon nn isisississ s sss sssssupupuupupuupuupuu popoppopopopopopp rtrtrttrtrtrtrtededededededeeee bbbb bbbbbyyyy yyyyyyyy y ththththtthththeeee eee e RCRCRCRCRCRRCRCRRCFFFFFF F FiFiFiFiFiFFiFiinanannanannancncnccnccncnciaiaiaaiaaiaiaiaallllllll AAiAAiAAAiAiAAiAiiiAiAiAiAAiddddddddddddddd d FFuFuFuFuFuFuFuuFuuFuFuuuuuFuFFuuuuuuuuuFuFuFuuuuuFuFFuuuuuuuuuuundddndndndndddndddndnnndnnndnnd ananaanananaanddd dddd hththththththththththththththhrorororororoorororoooorooorouguguguguguugugugugugugugugh hh hhhhhhhhhh sesesesesesesessssesssseeservrvrvrvrvrvrvvrvrvvvvicciciciciciciccccci eseseseseseeeeseseseseseees pppppppppp p ppp p pppprorooorororooororororororororor ivivivviviivivvivvivvivivividedededededededededededededededddddddddddd dd d ononononnonononononononononoo tttt ttttttt ttthehehhehehehhhe R RRR RRCFCFCCC wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwebebebeebeebebebeebebebebebeebebeeeeebeeeeeeeebeeebebebebebebbebebbebsisisisisiisisiiiisiteteteteteteteeteteeteetetetetetetettteteeteteeee,, , ,wwwwwwwwwwww.w.w.w.wwww riiriiirirrriiededededddede elelelelelle cococcocoocooooodddydydyydyddyddy.o.o.o.oo.ooorgrgrgrgrgrgrgrg........
Growing Possibilities for Charitable Services
In a diffi cult economy, many nonprofi ts are seeking
effective new ways to provide charitable services.
We recently assisted a new organization, Growing
Possibilities, Inc., in obtaining its tax-exempt status to
pursue a creative program that provides transitional
vocational employment training to individuals on the
autism spectrum. Its initial program, “Roses for Autism,”
offers training opportunities on a rose farm in Guilford
that involve cultivating, growing and packaging beautiful
Connecticut-grown roses and marketing and selling them
to the public and to organizations. Growing Possibilities’
goal is to use this model program in other settings to
promote and support the employment of individuals with
disabilities. For more information, visit the organization’s
website at www.rosesforautism.com.
Caring for Pets with Cancer
When Mark Tillinger and David Duchemin lost their beloved dogs
Riedel and Cody to cancer, they wanted to provide support to others whose pets were threatened by this devastating disease. Mark contacted us to help form an organization that would offer options to those faced with a pet’s cancer diagnosis. Pullman & Comley attorneys handled all of the legal aspects of forming a public charity named for their two pets: The Riedel and Cody Fund, Inc. Our work included drafting all of the legal documents to form the organization; fi ling a Form 1023 to establish its tax-exempt status; drafting corporate policies; advising the board of directors on corporate governance practices; developing the privacy policy for the Fund’s website; and registering the organization in Connecticut and New York to solicit funds. The Fund’s mission is to provide fi nancial support to those needing assistance with the expenses associated with treating a pet with cancer. It also provides a community that assists with emotional support as well as up-to-date oncologic information for anyone whose pet has cancer. This mission is supported by the RCF Financial Aid Fund and through services provided on the RCF website, www.riedelcody.org.
![Page 11: SUCCEEDING TOGETHERSUCCEEDINDING TOGE · 30,000 women participating in its network of independent sales advisors. The concept of empowering women to own and operate their own businesses](https://reader034.vdocuments.mx/reader034/viewer/2022042222/5ec8f551a6b4bd0f446679b7/html5/thumbnails/11.jpg)
Raising Awareness for Community Service Pullman & Comley Chairman Rob Morris is joined by Carolyn Hoffman and Jon Mitchell of Freshplace and Connecticut Governor Dannel P. Malloy at the fi rm’s 2011 Winter Party, which raised awareness for Freshplace and the CRT Energy Assistance Program.
Animosity Bowl XXXVII
This year’s bowl marked a turning point in the annual match up between partners and associates: youth triumphed over experience, as the associates outscored the partners, 24-13, for the fi rst time in any partner’s memory (i.e., the last few years).
11
New Associates
Pullman & Comley welcomed new associates Jared M. Alfi n, Assaf Z. Ben-Atar, Alison M. Perry, John H. Van Lenten and Yeshake Yilma in 2010.
In 2011, Pullman & Comley was proud to
be named one of the Best Places to Work in
Connecticut for the third consecutive year
by the Hartford Business Journal and Best
Companies Group.
The Pullman & Comley Women’s Leadership Initiative
The Women’s Leadership Initiative at
Pullman & Comley is committed to advancing
women’s careers through providing seminars,
networking events and awareness-raising
programs for women in the fi rm’s local
communities. The group hosted its Annual
Networking Tea, which brings together
business women and community leaders
from throughout Connecticut, in May 2010.
The featured guest was the Fairfi eld County
Community Foundation (FCCF) and its Fund
for Women and Girls.
Pictured, from left to right: Megan Youngling Carannante, attorney with Pullman & Comley; Susan Ross, President and CEO of FCCF; Linda Franciscovich, Vice President of Development and Philanthropic Services, FCCF; Suzanne Brown Peters, Director, FCCF’s The Fund for Women and Girls; Diane Whitney, partner at Pullman & Comley and chair of the fi rm’s Women’s Leadership Initiative; and Tiff any Kouri Spinella, attorney with Pullman & Comley.
![Page 12: SUCCEEDING TOGETHERSUCCEEDINDING TOGE · 30,000 women participating in its network of independent sales advisors. The concept of empowering women to own and operate their own businesses](https://reader034.vdocuments.mx/reader034/viewer/2022042222/5ec8f551a6b4bd0f446679b7/html5/thumbnails/12.jpg)
Bankruptcy, Creditors’ Rights and Financial Restructuring
Bankruptcy and Creditors’ Rights
Financial Restructuring
Corporate and Business
Automotive Dealers
Banking
Commercial Finance
Emerging Business and Venture Capital
Employee Benefi ts
Mergers and Acquisitions
Private Equity
Securities and Antitrust
Tax
Technology and Intellectual Property
Energy, Utilities and Telecommunications
Alternative Energy
Energy Procurement and Use
Power Development
Telecommunications
Water
Environmental and Land Use
Environmental Law and Litigation
Green Development
Land Use
Health Care
Hospitals and Health Care Institutions
Physicians and Other Health Care Practitioners
Individual Clients
Family Law
Probate Litigation
Trusts and Estates
Labor and Employment
Immigration
Labor and Employment Counseling,Training and Litigation
Union Issues
Litigation
Appellate
Business Disputes
Construction
Cybersecurity and Infrastructure Protection
Insurance
Intellectual Property Litigation
Professional Liability
Real Estate Litigation
Securities and Antitrust Litigation
White Collar Defense and Corporate Investigations
Municipal Law and Community Associations
Condominiums, Residential Associations and Community Organizations
Town Governments, Departments and Authorities
Nonprofi t Organizations
Property Valuation
Public Finance
Governmental Financing
Public/Private Development Financing
Underwriter, Credit Enhancer and Trustee Representation
Real Estate
Real Estate Acquisitions and Sales
Real Estate Finance
Real Estate Leasing
Residential, Commercial and Community Development Projects
Bridgeport
850 Main Street
P.O. Box 7006
Bridgeport, CT
06601-7006
t 203.330.2000
f 203.576.8888
Hartford
90 State House Square
Hartford, CT
06103-3702
t 860.424.4300
f 860.424.4370
Stamford
Four Stamford Plaza
107 Elm Street
4th Floor
Stamford, CT
06902-3834
t 203.324.5000
f 203.363.8659
Waterbury
500 Chase Parkway
4th Floor
Waterbury, CT
06708-3346
t 203.573.9700
f 203.573.9707
White Plains
50 Main Street
White Plains, NY
10606-1900
t 914.682.6895
f 914.682.6894
www.pullcom.com
PRACTICES