STONE AGE GENOMICS

Nature, 1987

Mitochondrial DNA from 147 people, drawn from five geographic populations have been analyzed by restriction mapping. All these mtDNAs stem from one woman who is postulated to have lived about 200,000 years ago, probably in Africa. All the populations examined except the African population have multiple origins, impling that each area was colonized repeatedly.

Mitochondrial Eve hypothesis All living people could be traced back to a single

female She lived ~200,000 years ago She came from a population of about 10,000

individuals That population is the founding population for

humans Descendents spread into the rest of the Old World

and replaced any existing populations of various species of sapiens or erectus

Consistent with the out-of-Africa model / single-origin model

Mitochondrial DNA

16, 569 base pairs Located in organelle responsible for energy

metabolism Each cell has 100s of mitochondria Has 37 genes Accumulates mutations on average 10x faster than

nDNA Good for tracking relatively recent evolutionary events Comes only from mother Clonal haploid transmission No recombination of maternal and paternal genes

Surprises….

Amount of variation of mtDNA in humans is quite low (1/10 of that of chimps)

Maybe because we evolved recently? Was there a bottleneck that reduced

variation? Since we know our population

overlapped with Neanderthal, do we share mtDNA?

http://www.sciencedirect.com/science?_ob=MiamiCaptionURL&_method=retrieve&_udi=B6WSN-4T5BPWS-C&_image=B6WSN-4T5BPWS-C-5&_ba=&_user=10&_coverDate=08/08/2008&_rdoc=1&_fmt=full&_orig=article&_cdi=7051&_isHiQual=Y&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=901be8e5c8491c3bb60444f61b774307

H. sapiens vs. H. neanderthalensis Of 16,568 nucleotides 206 differed from that of Neanderthal Among 53 modern humans you will find

2 – 118 differences Neanderthal sequences is outside of the

range of variation among modern humans

http://www.sciencedirect.com/science?_ob=MiamiCaptionURL&_method=retrieve&_udi=B6WSN-4T5BPWS-C&_image=B6WSN-4T5BPWS-C-G&_ba=&_user=10&_coverDate=08/08/2008&_rdoc=1&_fmt=full&_orig=article&_cdi=7051&_isHiQual=Y&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=00bc678ec9b1bfd10dbc58af60923d4e

This is strange because…

It is quite plausible that there was interbreeding because H. sapiens and H. neanderthalensis lived in overlapping ranges as recent as 30,000 years ago.

Estimated common ancestry between the two using mtDNA shows 660,000 years ago.

Maybe only human female by Neanderthal male matings occurred (never the reverse)

We may have to sample all 400 fossils of Neanderthal to have a good sample

Preliminary nDNA studies also do not show a recent ancestor with neanderthalensis but instead show ancestries of ~700,000 years ago

http://www.africanancestry.com

…Considerable caution is warranted when assessing claims to be able to trace ancestry… mtDNA diversity is larger within Africa

than outside of Africa Poor sampling coverage (especially

central Africa) Many groups in Africa were widely

dispersed before slave trade Bantu dispersal is a recent phenomenon

The most important translocation in human history

A mutation resulting from attachment of a chromosomal fragment to a nonhomologous chromosome

The most important translocation in human history

CHROMOSOME PARTS

All Chromosomes have telomeres at their ends(like shoelace aglets!)

HeadTelomere

Centromere

TailTelomere

Telomeres have a unique DNA sequence…

ttagggttagggttagggttagggttagggttaggg…||||||||||||||||||||||||||||||||||||aatcccaatcccaatcccaatcccaatcccaatccc…

PREDICTION

If fusion occurred, then we should see DNA evidence of the head-to-head telomeres together near middle of our #2 chromosome

Chimp #12

Chimp #13 Huma

n #2

Fusion Area?

EXPECTATIONS

What will you look for? tandem repeats in fusion area Where will you look for them? middle of our chromosome #2

How can you look for them? search online DNA database

What if evidence is NOT found? fusion may not have happened

RESULTS CLARIFIED108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg 108121 ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg 108181 gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg 108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc 108301 tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg 108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta 108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca 108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc 108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac 108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac 109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa 109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct 109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg 109201 ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc 109261 cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc 109321 taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg

HEAD 13

HEAD 12

See where the head-to-head fusion occurred?

Further ConfirmationComparison of DNA in Our Chrom. #2 with...

Another Confirmation Comparison of DNA in Our Chrom. #3 with...