spleen tyrosine kinase mediated autophagy is required for ...introduction primary tumor metastasis...

Molecular Cell Biology

Spleen Tyrosine Kinase–Mediated Autophagy IsRequired for Epithelial–Mesenchymal Plasticityand Metastasis in Breast CancerAparna Shinde1,2, Shana D. Hardy1,2, Dongwook Kim1,2, Saeed Salehin Akhand1,2,Mohit Kumar Jolly3,Wen-Hung Wang1,2, Joshua C. Anderson4, Ryan B. Khodadadi5,Wells S. Brown1,2, Jason T. George6,7, Sheng Liu2,8, Jun Wan2,8, Herbert Levine6,Christopher D.Willey4,Casey J. Krusemark1,2, Robert L.Geahlen1,2, andMichael K.Wendt1,2

Abstract

The ability of breast cancer cells to transientlytransition between epithelial and mesenchymalstates contributes to their metastatic potential.Therefore, driving tumor cells into a stable mes-enchymal state, as opposed to complete tumorcell eradication, presents an opportunity to phar-macologically limit disease progression by pro-moting an asymptomatic state of dormancy.Here, we compare a reversible model of epithe-lial–mesenchymal transition (EMT) induced byTGFb to a stable mesenchymal phenotypeinduced by chronic exposure to the ErbB kinaseinhibitor lapatinib. Only cells capable of return-ing to an epithelial phenotype resulted in skeletalmetastasis. Gene expression analyses of the twomesenchymal states indicated similar transitionexpression profiles. A potently downregulatedgene in both datasets was spleen tyrosine kinase(SYK). In contrast to this similar diminution inmRNA, kinome analyses using a peptide arrayand DNA-conjugated peptide substrates showeda robust increase in SYK activity upon TGFb-induced EMT only. SYK was present in cytoplasmic RNA processing depots knownasP-bodies formedduring theonset of EMT, and SYKactivitywas required for autophagy-mediated clearance of P-bodies duringmesenchymal–epithelial transition (MET). Genetic knockout of autophagy-related 7 (ATG7) or pharmacologic inhibition ofSYK activity with fostamatinib, a clinically approved inhibitor of SYK, prevented P-body clearance and MET, inhibitingmetastatic tumor outgrowth.Overall, this study suggests assessment of SYK activity as a biomarker formetastatic disease and theuse of fostamatinib as a means to stabilize the latency of disseminated tumor cells.

Significance: These findings present inhibition of spleen tyrosine kinase as a therapeutic option to limit breast cancermetastasis by promoting systemic tumor dormancy.

Graphical Abstract: http://cancerres.aacrjournals.org/content/canres/79/8/1831/F1.large.jpg.See related commentary by Farrington and Narla, p. 1756

1Department of Medicinal Chemistry and Molecular Pharmacology, PurdueUniversity,West Lafayette, Indiana. 2Purdue Center for Cancer Research, PurdueUniversity, West Lafayette, Indiana. 3Centre for BioSystems Science and Engi-neering, Indian Institute of Science, Bangalore, India. 4Department of RadiationOncology, University of Alabama, Birmingham, Alabama. 5Department of Grad-uate Medical Education, Mayo Clinic, Rochester. Minnesota. 6Center for Theo-retical Biological Physics, Rice University, Houston, Texas. 7Medical ScienceTraining Program, Baylor College of Medicine, Houston, Texas. 8Department ofMedical and Molecular Genetics, Indiana University School of Medicine, India-napolis, Indiana.

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

Corresponding Author: Michael K. Wendt, Purdue University, 201 S. UniversitySt., Hansen Life Sciences Building, West Lafayette, IN 47907. Phone: 765-494-0860; Fax: 765-494-1414; E-mail: [email protected]

doi: 10.1158/0008-5472.CAN-18-2636

�2019 American Association for Cancer Research.

CancerResearch

www.aacrjournals.org 1831

on October 25, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst February 7, 2019; DOI: 10.1158/0008-5472.CAN-18-2636

http://crossmark.crossref.org/dialog/?doi=10.1158/0008-5472.CAN-18-2636&domain=pdf&date_stamp=2019-4-8

http://cancerres.aacrjournals.org/content/canres/79/8/1831/F1.large.jpg

http://cancerres.aacrjournals.org/

IntroductionPrimary tumor metastasis is the culmination of several

sequential processes including local and systemic invasion,dissemination, and outgrowth within a secondary organ (1).Numerous studies have linked the process of epithelial–mesenchymal transition (EMT) to local invasion and dissem-ination (2). Additional studies also link EMT to the acqui-sition of a stem-like phenotype (3). However, separate studiesindicate that tumor cells with a stable mesenchymal phenotypeare less efficient at overcoming systemic dormancy and complet-ing the last step of metastasis (4). Recently, we used a HER2transformation model of human mammary epithelial cells(HME2) to establish stable and reversible states of EMTinduced by lapatinib and TGFb, respectively (5). Using thisapproach, we were able to establish that a cytokine-induced EMTis sufficient to facilitate resistance to lapatinib. Herein, weused these model systems to address the hypothesis that epithe-lial–mesenchymal plasticity (EMP) is required for metastasis.Moreover, we identify spleen tyrosine kinase (SYK) as a criticalmolecular mediator of EMP.

SYK is part of the EMT core signature of mRNAs down-regulated in mammary epithelial cells when EMT is induced byTGFb, the expression of EMT-inducing transcription factors, orby the depletion of E-cadherin (6). There is also evidence thatSYK can directly influence phenotypic transitions in epithelialcells. For example, depleting SYK in MCF10A mammary epi-thelial cells and in pancreatic carcinoma cells promotes mor-phologic and phenotypic changes characteristic of EMT (7, 8).Finally, epithelial-derived cancer cells that bear a constitutivemesenchymal phenotype silence SYK expression via hyper-methylation of its promoter (9). These studies suggest thatSYK may serve as a tumor suppressor. However, expressionvalues can be misleading, particularly with regard to kinaseswhose level of expression may not be consistent with theactivity of the enzyme. Furthermore, even antibody-basedprotein analyses require robust expression of enzymes toobtain reliable readouts with regard to the activation state ofa kinase. To overcome these drawbacks, we utilized directenzymatic activity detection assays using a peptide substratemicroarray. We also employed a phosphorylation assay inwhich a substrate peptide is conjugated to DNA oligonucleo-tides, whereby quantitative readouts of phosphorylation areachieved via qPCR. This method presents a highly sensitive andquantitative means to determine kinase activity within a sam-ple (10, 11).

To establish the mechanisms by which SYK modulates EMT,we have previously utilized a mass spectrometry approach toestablish a list of substrate proteins (12). Among the sub-strates uniquely phosphorylated by SYK were several RNA-binding proteins. These included UPF1, LIMD1, EIF4ENIF1,CNOT2, LARP1, HNRNPK, and DDX6. All of these proteinsare known to localize in mRNA processing depots knownas P-bodies (13, 14). P-bodies are dynamic cytoplasmicfoci that contain mRNAs, miRNAs, and mRNA-binding pro-teins involved in translation repression, mRNA degradation,and miRNA-mediated silencing. We recently established thatP-bodies form during the onset of EMT and are removedduring mesenchymal–epithelial transition (MET) by the pro-cess of autophagy (15). Similar to EMT, the role of autophagyin tumorigenesis is dynamic and highly context-dependent.However, recent studies indicate that autophagy is critical

for cancer cells to overcome the stresses associated withseveral processes of metastasis, including survival duringdormancy (16, 17).

Overall, our results strongly support the conclusion thatEMP facilitates metastasis. We present DNA-conjugated pep-tide substrate assays as a highly sensitive, robust means toidentify aggressive breast cancers. Using this approach, weestablish that SYK activity is required for autophagy-mediatedclearance of P-bodies during MET. Finally, our data indicatethat pharmacologic inhibition of SYK could serve as a uniquetherapeutic approach to limit the metastatic progression ofbreast cancer, not through tumor cell eradication, but main-tenance of disseminated cells in an asymptomatic state ofdormancy.

Materials and MethodsCell lines and reagents

The HEK293 and 4T1 cells were obtained from the ATCCwhilethe HMLE cells were a kind gift from Sendurai Mani (MDAnderson Cancer Center, Houston, TX). The 4T1 and HMLE cellswere constructed to stably expressfirefly luciferase andHMLE cellswere transformed via overexpression ofHER2 (HME2). Construc-tion of the HME2 cells and their mesenchymal variants viatreatment with TGFb or lapatinib were described previously (5,18). Normal murine mammary gland (NMuMG) cells werepurchased from the ATCC. All cells were validated for lack ofMycoplasma contamination using the IDEXX Cell check andImpact III testing on July 24, 2018.

Immunologic assaysFor the coimmunoprecipitation assay, HEK293T cells stably

expressing GST-SYK and EGFP-DCP1A were lysed as describedabove. EGFP-DCP1A was immunoprecipitated from the solu-ble fraction using GFP-Trap agarose beads (Chromotek).Bound immune complexes were washed with lysis buffer andsubjected to immunoblotting using antibodies against GST andGFP. In separate experiments, whole-cell lysates were analyzedby immunoblot using the following antibodies; pSYK, SYK,ATG7, Zo1, Zeb1, Slug (Cell Signaling Technology), actin(Santa Cruz Biotechnologies), or b-tubulin (DSHB). Whereindicated, cells were harvested by trypsinization and stainedwith antibodies specific for CD44 and CD24 (BioLegend).Differential staining for these markers was analyzed by flowcytometry.

RNA sequence analysisParental, HER2-transformed HMLE cells (HME2-parental)

were treated every 3 days with TGFb1 (5 ng/mL) or lapatinib(1 mmol/L) for a period of 4 weeks to generate lapatinib-resistant (LAPR) and post-TGFb mesenchymal cell condi-tions (5). These cells were sorted for a CD44hi phenotype(BioLegend), and tRNA was isolated using E.Z.N.A (OmegaBio-Tek). RNA sequencing was conducted using the IlluminaHiSeq 2500 platform. These data have been deposited on theGEO database (GSE115255).

Kinomic analysesLysates, from HME2 cell conditions indicated above, were

analyzed on tyrosine chip (PTK) and serine–threonine chip (STK)arrays using 15 mg (PTK) or 2 mg (STK) of input material as per

Shinde et al.

Cancer Res; 79(8) April 15, 2019 Cancer Research1832




standard protocol. Three replicates of chip-paired samples wereused and phosphorylation data were collected over multiplecomputer-controlled kinetic pumping cycles, and exposuretimes (0, 10, 20, 50, 100, 200 ms) for each of the phosphoryla-table substrates. Slopes of exposure values were calculated, log2-transformed, and used for comparison. Raw image analysis wasconducted using Evolve2, with comparative analysis done inBioNavigator v6.2 (PamGene).

qPCR-based kinase assaysA peptide substrate–oligonucleotide conjugate was prepared,

as described previously (10). Briefly, a selective SYK peptidesubstrate derived from phage display selections (SYKtide, EDP-DYEWPSA; ref. 19) was purchased from GenScript on Rinkamide polystyrene resin, and the N-terminus was acylated with5-hexynoic acid. Peptidewas cleaved from resin by incubating in acleavage cocktail (95:2.5:2.5 TFA:H2O:TIPS) for 4 hours followedby a precipitation in cold ether. The resulting precipitate wassubsequently purified by semi-prep high-performance liquidchromatography (HPLC) at a flow rate of 5 mL/minute withH2O (0.1% TFA) and MeCN (0.1% TFA) as mobile phase. Thepeptide was characterized byMALDI/MS. m/z: [MþH]þ calcd. forC60H77N12O21

þ, 1301.53, found [MþNa]þ, 1323.35, [MþK]þ,1339.32.

The SYKtide alkyne was conjugated to a 20-mer DNA oligo(ATGGTATCAAGCTTGCCACA) containing a 50 azide modifica-tion, as described previously (11). The resulting conjugate wasprecipitated by adding 100 mL of 10 mol/L ammonium acetateand 800 mL of EtOH and being kept in �20�C overnight. Afterremoval of supernatants, the resulting conjugate was purified bysemi-prep HPLC at a flow rate of 1 mL/minute with H2O (0.75%hexafluoroisopropanol (HFIP), 0.75% triethylamine (TEA),5 mmol/L EDTA, pH 7.0), and 10:90 H2O:MeOH (0.75% HFIP,0.75%TEA, 5 mmol/L EDTA, pH 7.0) as mobile phase. Theresulting conjugate was characterized by ESI/MS. m/z: [M-5H]5�,calcd. 1600.6, found 1600.7, [M-6H]6�, calcd. 1333.7, found1333.7, [M-7H]7�, calcd. 1143.0, found 1142.8, [M-8H]8�, calcd.1000.0, found 1000.0, [M-9H]9�, calcd. 888.8, found 888.8, [M-10H]10�, calcd. 799.8, found 799.8, [M-11H]11�, calcd. 727.0,found 727.0, [M-12H]12�, calcd. 666.3, found 666.3, [M-13H]13�, calcd. 615.0, found 615.0.

MPER lysis buffer (Thermo Fisher Scientific 78501) was pre-pared with protease and phosphatase inhibitors (Protease Inhib-itor Cocktail 1, Sigma #P8340; Phosphatase Inhibitor Cocktail 2,Sigma #P5726; and Phosphatase Inhibitor Cocktail 3, Sigma#P0044) at 1:100 concentration each in our sample preparation.HME2 cell derivates (1 � 106 cells each) were harvested, treatedwith lysis buffer (500 mL) to each cell pellet, and incubated on icefor 30 minutes. Cell lysate was obtained by centrifugation for 10minutes at 4�C at 14,000 � g. The protein concentration wasquantified using BCA Protein Assay Solution (Thermo FisherScientific).

Kinase activity reactions were performed in 50 mmol/L Tris-HCl pH 7.5 and 10 mmol/L MgCl2), 1 mmol/L ATP, 2 mmol/LDTT, 1 mmol/L phagetide–DNA conjugate (20-mer DNA oligo),and 1 mg total protein from cell lysates. Reactions were per-formed at room temperature for 30 minutes, and thenenzymes were heat denatured by treatment at 65�C for 5minutes. After cooling to room temperature, encoding 55-merswere allowed to anneal for 30 minutes, as described previous-ly (11). Selective purification of DNAs bearing phosphorylated

peptides was performed using anti-photyrosine antibody(4G10, EMD Millipore) immobilized on protein G magneticbeads (protein G magnetic Sepharose, GE Healthcare). qPCRwas used to quantitate encoding 55-mers in both the presample(before pull-down by antibody) and postsample (after elutionwith 1 mmol/L phenyl phosphate from antibody-protein Gbeads).

Gene knockout studiesThe dimeric CRISPR RNA–guided Fokl nuclease and Csy4-

based multiplex gRNA expression system was used to generatethe SYK and ATG7 knockout cell lines. Two annealed target-siteoligoduplexes designed by Zifit Targeter (20) and a constantregion oligoduplex were assembled with BsmBI-digestedpSQT1313 in a single-step ligation. A total of 3 mg of theligated vector, 1 mg of pSQT1601-expressing Csy4 RNase andRNA-guided Fokl-dCas9 fusion nucleases, and 0.2 mg of pBABEPuro were transfected into luciferase-expressing HME2 and 4T1cells. pSQT1313 and pSQT1601 were gifts from Keith Joung(Harvard Medical School, Boston, MA; Addgene plasmids#53370 and #53369; ref. 21). After 48 hours, cells were treatedwith 5 mg/mL puromycin for clonal selection. Genomic DNAand cell lysates from selected colonies were analyzed by thePAGE-genotyping method (22) and immunoblot analyses toscreen for clones with SYK or ATG7 knockout. Disruption ofboth alleles was confirmed by DNA sequencing.

P-body formation and clearanceCells were treated with TGFb1 (R&D Systems; 10 ng/mL) for

the indicated times to induce P-bodies. For P-body clearanceassays, cells were washed with PBS, and then allowed torecover in fresh media for the indicated times. In some experi-ments, the SYK inhibitor R406 (Selleckchem), or the autop-hagy inhibitors N2,N4-bis(phenylmethyl)-2,4-quinazolinedia-mine (DBeQ; Sigma; 0.625–2.5 mmol/L), or chloroquine(Tocris; 10 mmol/L) were added during P-body clearance. Forthe detection of P-bodies and autophagosomes by immuno-fluorescence, cells were fixed with 10% ice cold methanol for10 minutes, permeabilized with 1% Triton X-100 in PBS, andblocked with PBS containing 10% goat serum, 0.05% Tween20, and 1 mg/mL BSA. Cells were immunostained using theindicated antibodies against DCP1A, p62, or phosphotyrosine.Bound primary antibodies were detected using AlexaFluor488–conjugated goat anti-mouse IgG and/or AlexaFluor594–conjugated goat anti-rabbit IgG secondary antibodies(Invitrogen). P-bodies were quantified using ImageJ to set athreshold mask (Otsu Thresholding Filter), which allowed onlyP-bodies (puncta) to be analyzed. The pixel range of P-bodieswas set at a range between 30 and 270 units. This range wasconsidered to have staining above background. The number ofP-bodies and nuclei were counted in an image or field contain-ing at least 25 cells to determine the number of P-bodies percell. Data are expressed as the mean � SEM from threeindependent biological replicates.

In vivo metastasisControl and ATG7-deleted 4T1 cells engineered to express

firefly luciferase were resuspended in PBS (50 mL) and ortho-topically engrafted onto the second mammary fat pad of4-week-old Balb/c mice (2.5 � 104 cells/mouse; Jackson Labs).Primary tumor growth and metastasis development were

SYK Activity Facilitates Mesenchymal–Epithelial Transition

www.aacrjournals.org Cancer Res; 79(8) April 15, 2019 1833




assessed via weekly bioluminescent imaging using theAdvanced Molecular Imager (Spectral Instruments). In sepa-rate experiments, 4T1 primary tumors were engrafted ontoBalb/c mice, and primary tumors were surgically excised whenthey reached 200 mm3. At this point, mice were split intocohorts and treated with fostamatinib (50 mg/kg; orally, oncedaily). Upon necropsy, lungs from all animals were removedand fixed in 10% formalin and dehydrated in 70% ethanolfor visualization of pulmonary metastatic nodules and his-tologic analyses. All animal studies were performed in accor-dance with the animal protocol procedures approved bythe Institutional Animal Care and Use Committee of PurdueUniversity.

EMT score quantificationEMT metric described previously was applied to calculate

EMT scores for various samples (23). A set of EMT-relevantpredictors and cross-platform normalizer transcripts wasextracted for each sample and then used to assign probabilitiesof belonging to E, hybrid E/M, or M phenotypes, as denoted bythe ordered triple Si ¼ (PE, PE/M, PM). Categorization wasassigned on the basis of maximal value of this ordered triple,and then projected onto [0, 2].

Statistical analysesTwo-way ANOVA or two-sided t tests were used where the data

met the assumptions of these tests, and the variance was similarbetween the two groups being compared. P values of less than0.05 were considered significant. No exclusion criteria were uti-lized in these studies.

ResultsEMP drives metastasis

We recently established two mesenchymal cell conditionsderived from a common, HER2-transformed, HME2 cell pre-cursor (5). In one condition, EMT was induced upon prolongedcontinuous treatment (4 weeks) with the cytokine TGFb1, andthe other was induced upon a similar length of continuoustreatment with the EGFR/HER2 kinase inhibitor, lapatinib.Importantly, while both mesenchymal states are robust, onlyTGFb-induced EMT was capable of undergoing MET uponwithdrawal of the exogenous stimuli (5). The resultant cellpopulations are illustrated in Fig. 1A via flow cytometric anal-ysis of CD44 and CD24, where treatment and withdrawal ofTGFb1 resulted in the formation of a heterogeneous populationof epithelial and mesenchymal cells (Fig. 1A). In contrast, LAPRcells derived from prolonged treatment with the kinase inhib-itor remained in a mesenchymal, CD44hi phenotype even afterprolonged withdrawal of the compound. We sought to evaluatethe impact of these reversible versus stable EMT events ontumor growth and metastasis. Therefore, we coengrafted theLAPR cells with the parental HME2 cells to create CD44hi/CD44low heterogeneous tumors, similar to the post-TGFb1population. The mixture of LAPR cells with parental HME2cells did not affect primary tumor growth, and we did notobserve any metastasis in mice bearing either of these tumors(Fig. 1B–D). In contrast, the post-TGFb1–treated cells formedlarger tumors, and we were able to image and isolate metastaseswithin the long bones of one of these tumor-bearing mice(Fig. 1B–D). Ex vivo subculture of these bone metastases(HME2-BM) led to a culture that displayed a uniform epithelial

Figure 1.

EMP is required for metastasis. A, HER2-transformed HMLE cells (HME2) were treated with TGFb1 (5 ng/mL every 3 days) or the HER2/EGFR kinase inhibitorlapatinib (1 mmol/L every 3 days) for 4 weeks. Following an additional 4 weeks of culture in the absence of these stimuli, the post-TGFb and LAPR cells wereanalyzed by flow cytometry for expression of CD44 and CD24. Untreated (Parental) cells served as a control. B and C, The cell populations shown in Awereengrafted onto the mammary fat pad of NSGmice, and primary tumor size was measured by digital calipers at the indicated time points. Primary tumorweights were measured 30 days after engraftment following surgical resection. Data in B and C are the mean� SD of three mice per group, resulting in theindicated P values. D, Forty-five days after removal of the primary tumor, long bone metastases were detected in a post-TGFb tumor–bearing mouse. Thesemetastases were subcultured to yield the HME2-bone metastatic (HME2-BM) cell line. E, The HME2-BM cells were characterized via flow cytometric analysis ofCD44 and CD24.

Shinde et al.





morphology similar to that of the HME2 parental cells but withdiminished cell surface expression of CD24 (Fig. 1D and E).Taken together, these data indicate that EMP is critical for themetastatic progression of this HER2 transformation model.

Reversible and irreversible EMTs have similar transitionintensities

We next sought to characterize unique differences in geneexpression between reversible and irreversible EMT eventsinduced by TGFb and kinase inhibition, respectively. Following4 weeks of treatment with TGFb1 or lapatinib, CD44hi cellswere sorted by FACS and analyzed by RNA sequencing. Both ofthese cell populations were compared with nonstimulated,parental HME2 cells. Numerous established markers of EMTsuch CDH1, Vimentin, Twist, and FGFR1 were similarly mod-ulated by both TGFb1 and lapatinib treatment (Fig. 2A). Only alimited set of genes were uniquely regulated between TGFb andlapatinib-induced EMT events (Fig. 2B). Pathway analysis ofthese gene sets did not offer obvious mechanistic explanationfor these reversible versus nonreversible EMT events (Fig. 2B;Supplementary Table S1). To investigate the notion that EMTbecomes irreversible based on the intensity of an EMT, we

utilized our recently developed inferential model of quantify-ing the extent of EMT in a given sample (23). This metric usescanonical epithelial and mesenchymal markers to compute the"EMT score" on a scale of 0 (fully epithelial) to 2 (fullymesenchymal). These analyses indicated that both TGFb1 andlapatinib induced similar EMT intensities (Fig. 2C). Theseanalyses suggest that the reversible nature of EMT is determinedvia the nature of the inducing stimuli as opposed to theintensity of the transition.

SYK activity is increased upon TGFb-induced EMTTo further characterize posttranscriptional differences that may

be regulating EMP, we conducted an analysis of kinase activityusing a peptide-substrate microarray on the PamStation-12 plat-form. This platform is capable of quantifying the differentialphosphorylation of 142 serine/threonine containing peptidesand 140 different tyrosine-containing peptides upon incubationwith cell lysates. This analysis detected a moderate decrease inphosphorylation of a peptide containing the autophosphoryla-tion sites found within the activation loop of SYK, containingtyrosine 525and526 (Supplementary Table S2; ref. 24).However,consistent with previous studies, we observed SYK mRNA

Figure 2.

Reversible and irreversible EMTshave similar transition intensities.A, Heatmap representation of thedifferentially expressed genesdetermined by RNA-sequenceanalyses of parental HME2 cells(Par) as compared with HME2 cellstreated with TGFb1 (5 ng/mL every3 days for 4 weeks) and thoseselected for resistance to lapatinib(LAPR; 1 mmol/L every 3 days for 4weeks). B, Principal componentanalyses of the duplicate geneexpression analyses described in A.C, EMT score analysis of differentialgene expression for the indicatedcell populations.






expression to be drastically downregulated upon treatment withTGFb (6). Moreover, use of the KM plotter analysis tool indicatedthat diminished SYKmRNA expression is strongly associatedwithdecreased breast cancer patient survival (Fig. 3A; ref. 25). There-fore, we normalized the peptide phosphorylation values to SYKmRNA expression reads from our RNA sequence analyses. Use ofthis approach clearly demonstrated that, while SYK expressionwas downregulated by TGFb-induced EMT, the activity of theremaining pool was dramatically increased (Fig. 3B). Consistentwith our RNA sequence analyses, immunoblotting of whole-celllysates demonstrated a robust decrease in the total levels of SYK inTGFb-treated and LAPR cells (Fig. 3C). Differential phosphory-lation of Y525/526 of endogenous SYK was not detectable in anyof these samples, potentially due to the dramatic reduction intotal SYK during EMT (Fig. 3C; Supplementary Fig. S1). Therefore,to verify enhanced SYK activity following TGFb-induced EMT, weconducted a substrate phosphorylation assay using SYK Phage-TIDE, a peptide sequence (EDPDYEQPSA) identified by phagedisplay to be a highly specific and sensitive substrate for SYK ascompared with the Y525/526 containing activation loop autop-hosphorylation peptide (19, 26). This peptidewas conjugated to a

DNAoligonucleotide, allowing for highly sensitive quantificationof phosphorylated peptide via PCR following its capture using theantityrosine antibody 4G10. Using this ultrasensitive approach,we were able to clearly demonstrate enhanced SYK activity spe-cifically in HME2 cells induced to undergo EMT by TGFb ascompared with lapatinib-induced EMT (Fig. 3D). Taken together,these data clearly indicate that in contrast to diminished totalexpression levels of SYK, its kinase activity was upregulated in areversible, but not in an irreversible EMT.

SYK is present in P-bodies and facilitates their clearance duringMET

We have recently demonstrated that induction of EMT byTGFb induces the formation of cytoplasmic RNA–processingcomplexes called P-bodies, and clearance of P-bodies throughautophagy is required for reversal of EMT (15). On the basisof our previous identification of a role for SYK in promotingstress granule clearance through autophagy and our identifica-tion of multiple P-body proteins as SYK substrates, we nextsought to assess a role for SYK in P-body formation andclearance (11, 27). Expression of mCherry-labeled SYK

Figure 3.

SYK activity is specifically increased following TGFb-induced EMT. A, Kaplan–Meier analysis of recurrence-free survival based on the median expression value ofSYK. Data were obtained from the indicated patient numbers using the KM plotter online analysis tool, resulting in the indicated P value. B, Substratephosphorylation intensity determined for a peptide containing the SYK autophosphorylation (Y525/Y526) site in HME2 parental, LAPR, and TGFb-treated cells.Data are normalized to SYKmRNA expression values determined by RNA sequence analysis for these same samples. Data are mean� SD of three substratephosphorylation analyses, resulting in the indicated P value. C, Immunoblot analysis of total SYK in HME2 parental, LAPR, and TGFb-treated cells. b-Tubulinwas assessed as a loading control. D,Quantification of SYK activity in the indicated cell populations using a DNA-conjugated SYK-specific substrate peptide(SYK-PhageTIDE). Data are mean� SD of the signal for three unique 55-mer encoding constructs in a lysate sample, resulting in the indicated P values.

Shinde et al.





results in a cellular diffuse localization (Fig. 4A). However,coexpression of the P-body structural protein, DCP1A leads toformation of large P-bodies and SYK clearly concentrated intothese structures (Fig. 4A). This dramatic change in SYK local-ization occurred in 100% of cells containing P-bodies (Sup-plementary Fig. S2). Despite the relative insolubility of P-bodycomplexes, we were able to use immunoprecipitation to dem-onstrate association of EGFP-DCP1A with a GST-tagged SYK(Fig. 4B). Consistent with SYK activity within P-bodies, weobserved a dramatic increase in phosphotyrosine staining inP-bodies selectively within cells overexpressing SYK (Fig. 4C).Normal murine mammary gland (NMuMG) cells are highlyresponsive to TGFb-induced EMT, and form robust P-bodiesduring this process (15). Therefore, we treated control and SYK-overexpressing NMuMG cells with TGFb1 for 48 hours toinduce P-body formation. At this point, the TGFbwas removed,and cells were placed in fresh media for an additional 24 hoursto allow for P-body clearance. The induction of P-bodies wasnot affected by SYK overexpression, but the clearance of P-bod-ies after TGFb removal was significantly increased (Fig. 4Dand E). This SYK-mediated clearance of P-bodies was preventedby inhibition of autophagy through blockade of endosomalacidification using the antimalarial drug, chloroquine, duringthe recovery period following TGFb-induced EMT (Fig. 4F).Taken together, these data are consistent with a model in which

SYK physically concentrates into P-bodies upon TGFb-inducedEMT and functions to promote their autophagic clearanceduring MET.

SYK activity is required for METTo determine the necessity of SYK in the ability of cells to

undergo EMT and MET, we deleted SYK from the HME2 cellsusing a genome editing approach (Fig. 5A; ref. 15). Completeabsence of SYK led to an accumulation of P-bodies and pre-vented P-body clearance following TGFb-induced EMT (Fig. 5Band C). To focus on the role of SYK kinase activity in P-bodyclearance and execution of the MET process, we treated cellswith TGFb and allowed them to recover in the absence orpresence of the SYK inhibitor R406. Association of p62/Seques-tosome-1 with LC3 targets these proteins to autophagosomeswhere they are degraded selectively through autophagy. Similarto DCP1A, when autophagy is inhibited p62-positive inclusionbodies accumulate (28, 29). Consistent with a role of SYKactivity in autophagy-mediated clearance of P-bodies, weobserved robust accumulation of p62 and DCP1A containingvesicles when R406 was included during recovery from TGFbtreatment (Fig. 5D). Following a 4-week treatment of the HME2cells with TGFb1, a 2-week recovery period allowed levels ofEpithelial-cadherin (Ecad) to return (Fig. 5E). When R406 wasadded during the recovery phase, however, return of Ecad was

Figure 4.

SYK enhances the clearance of TGFb-induced P-bodies. A, HEK293 cells were transiently transfected with SYK-mCherry (SYK-mC) and EGFP as acontrol or EGFP-DCP1A to induce P-body formation. Localization of SYK into P-bodies was examined by fluorescence microscopy. B, HEK293 cellsexpressing GST-SYK were transiently transfected to express EGFP-DCP1A, which was immunoprecipitated from cell lysates using GFP-Trap agarosebeads. Proteins in immune complexes (Anti-GFP) and the cell lysate were detected using antibodies against GST (GST-SYK) and EGFP (EGFP-DCP1A). C, Control and SYK-mCherry (SYK-mC)–expressing HEK293 cells were transiently transfected with EGFP-DCP1A to induce P-bodies. Aftertransfection, the cells were stained using antibodies against phosphotyrosine (P-Tyr), and cells were examined by fluorescence confocal microscopyto visualize colocalization of SYK, DCP1A, and P-Tyr. D, Control NMuMG cells and those stably expressing SYK-mC were left untreated (Control) ortreated with TGFb1 for 48 hours. Where indicated, cells were allowed to recover in the absence of TGFb (Recovery) for an additional 24 hours. Cellswere fixed and stained for DCP1A (green). E, Quantification of the average number of P-bodies per cell � SEM (n > 150 cells/treatment) for triplicateexperiments, resulting in the indicated P value. F, NMuMG cells stably expressing SYK-mC were treated with TGFb1 and allowed to recover as in D.Where indicated, the autophagy inhibitor chloroquine was added during the recovery period, and cells were fixed and stained for DCP1A (green).P-bodies were quantified as above, resulting in the indicated P value.






attenuated (Fig. 5E). Consistent with our previous report (14),addition of the autophagy inhibitor DBeQ similarly preventedcells from undergoing MET subsequent to TGFb1 treatment andwithdrawal (Supplementary Fig. S3). The onset of TGFb1-induced EMT can easily be visualized via bright-field micros-copy with all cells displaying a mesenchymal morphology(Fig. 5F). This was also quantified by a CD44hi flow cytometricphenotype (Fig. 5G). This approach clearly indicated that R406prevents the ability of cells to undergo MET following TGFb1-induced EMT (Fig. 5E–G). These results suggest that SYK

activity facilitates autophagy-mediated P-body clearance duringMET.

Inhibition of autophagy stabilizes a mesenchymal phenotypeand inhibits metastasis

Using an in vivo reporter system, we have previously establishedthat highly metastatic 4T1 cells are very dynamic and undergoEMT and MET during initiation of growth in 3D culture andduring in vivo tumor formation and metastasis (30, 31). Toestablish thenecessity of autophagy-mediatedMET formetastasis,

Figure 5.

Inhibition of the SYK activity prevents MET. A, Genetic knockout of SYK (SYK KO) in the HME2 cells was verified by immunoblot. Tubulin (TUB)served as a loading control. B, These cells were stimulated with TGFb1 for 17 days. Where indicated, cells were allowed to recover in the absence ofTGFb (Recovery) for an additional 96 hours. Cells were fixed and stained for DCP1A (green). C, Quantification of the average number of P-bodies percell. Data are the mean manual analyses of P-bodies � SEM of at least 10 cells, resulting in the indicated P values. D, HMLE cells were treated withTGFb for 96 hours to induce P-body formation. Cells were allowed to recover for 48 hours in the absence (Cntrl) or presence of the SYK inhibitorR406 (2.5 mmol/L). Cells were fixed and stained with antibodies against DCP1A (green) and the autophagy marker p62 (red). Nuclei werecounterstained with DAPI (blue). E, HME2 cells were treated with TGFb1 (5 ng/mL every 3 days for 4 weeks) and subsequently allowed to recoverfor an additional 2 weeks in the absence or presence of the R406 (1.0 mmol/L). These cells as well as untreated HME2 cells (Cntrl) were analyzed forthe expression of the Ecad. Expression of actin served as a loading control. F, HME2 cells were left untreated (Control) or treated and allowed torecover from TGFb1 stimulation as described in E. The epithelial and mesenchymal morphologies under these conditions were visualized by phasecontrast microscopy. The yellow outline denotes the return of morphologically epithelial cells following treatment and recovery from TGFb1.G, HME2 cells were treated as in B and analyzed by flow cytometry for cell surface expression of CD24 and CD44.

Shinde et al.





we again utilized a genomic editing approach to delete theautophagymediator, ATG7 (Fig. 6A). Consistent with the dynam-ic EMP phenotype of the 4T1 cells and the requirement ofautophagy for MET, deletion of ATG7 led to stabilization of amesenchymal phenotype that included the accumulation ofP-bodies (Fig. 6A and B; Supplementary Fig. S4). Correspond-ingly, deletion of ATG7 prevented efficient growth within acompliant 3D culture environment (Fig. 6C). Deletion of ATG7had a minimal effect on primary tumor growth within themammary fat pad (Fig. 6D). Histologically, ATG7-deleted tumors

displayed a similar mesenchymal morphology, characteristic of4T1 primary tumors, and cell proliferation was not affected(Fig. 6E). In contrast, deletion of ATG7 led to a completeinhibition of pulmonary metastasis as measured by longitudi-nal bioluminescence and endpoint enumeration of metastaticnodules (Fig. 6F–H). Taken together, these data strongly sug-gest that highly metastatic cells consistently transition betweenepithelial and mesenchymal phenotypes, and autophagy isrequired for the efficient execution of MET and metastaticprogression.

Figure 6.

Autophagy is required for MET andmetastasis.A, Genetic knockout of ATG7 (ATG7KO) in the 4T1 cells was verified by immunoblot. These same cell lysates werealso analyzed for the EMTmarkers, Zo1, Zeb1, and Slug. Expression of actin served as a loading control. B, Control (WT) and ATG7KO 4T1 cells were stained withphalloidin to visualize differential organization of the actin cytoskeleton and DCP1A to visualize P-bodies. These cells were counterstained with DAPI to visualizethe nucleus. C, Control (WT) and ATG7KO 4T1 cells were grown under single cell 3D culture conditions. Longitudinal cellular outgrowth was quantified bybioluminescence at the indicated time points. Data are normalized to the plated values and are the mean� SD of three independent analyses, resulting in theindicated P value. D, Control (WT) and ATG7KO 4T1 cells were engrafted onto the mammary fat pad and primary tumor growth was quantified bybioluminescence at the indicated time points. Data are normalized to the injected values. E, IHC for Ki67 expression in control (WT) and ATG7KO primary tumors.F, Bioluminescent images and the corresponding gross anatomic views of lungs from control 4T1 (WT) tumor–bearing mice and those bearing ATG7KO tumors.Arrows, metastatic nodules. G,Quantification of bioluminescent radiance from the pulmonary region of WT and ATG7KO tumor–bearing mice at the indicatedtime points. H, Upon necropsy the numbers of pulmonary metastatic nodules were quantified for both control (WT) and ATG7KO 4T1 tumor–bearing mice. ForD, G, and H, data are the mean� SE of 5 mice, resulting in the indicated P values.






Pharmacologic inhibition of SYK stabilizes a mesenchymalmorphology and inhibits metastatic outgrowth

Consistent with our ATG7 genetic data, previous studies indi-cate that inhibition of autophagy, through the use of chloroquine,effectively inhibits the pulmonary metastasis of 4T1 tumors (32).In attempts to improve the pharmacologic specificity of targetingautophagy as an antimetastatic therapy, we sought to evaluate theimpact of SYK inhibition in the 4T1 model. In vitro, treatment of4T1 cells with R406 stabilized a mesenchymal morphology, andpotently inhibited tumor cell growth in 3D culture conditions(Fig. 7A and B). We next conducted in vivo studies using the

clinically approved prodrug of R406, fostamatinib (33). To spe-cifically focus on inhibition of metastasis, we established primarymammary fat pad tumors for a period of 2 weeks, and only aftersurgical resection of these primary tumors were mice treated withfostamatinib (Fig. 7C). This approach confirmed that systemicinhibition of SYK is capable of inhibiting the pulmonary meta-static outgrowth of 4T1 cells (Fig. 7D and F). Consistent with arole of SYK in MET, micrometastases that were located in thefostamatinib-treated group failed to regain Ecad expression ascompared with similar-sized lesions in untreated animals(Fig. 7G).

Figure 7.

Inhibition of SYK stabilizes a mesenchymal phenotype and inhibits pulmonary metastatic outgrowth. A, The 4T1 cells were treated with R406 (1 mmol/L) for18 days, fixed, and stained with phalloidin (red) to visualize redistribution of the actin cytoskeleton and antibodies against DCP1A (green) to visualize P-bodyformation. Nuclei (blue) were counterstained with DAPI. B, The 4T1 cells were placed under single cell 3D culture conditions in the absence (DMSO) or presenceof R406 (1 mmol/L) and cellular outgrowth within these cultures was quantified by bioluminescence at the indicated time points. Data are the mean� SE of twoindependent assays completed in triplicate, resulting in the indicated P value. C, Schematic representation of the experimental approach. The 4T1 primary tumorswere established and surgically resected. Following this procedure, mice were treated with fostamatinib (50mg/kg; orally, once daily). D, Representative BLIimages of mice treated as described in C. E, Pulmonary radiance values for control (DMSO) and fostamatinib-treatedmice at the indicated time points. F, Uponnecropsy, macroscopic pulmonary metastasis were enumerated in lungs of control (DMSO) and fostamatinib-treated mice. Data in E and F are the mean� SE of5 mice per group, resulting in the indicated P values. G, Histologic sections of similar-sized 4T1-metastases in control (DMSO) and fostamatinib-treated groups.Sections were stained with hematoxylin and eosin (H&E) or antibodies against Ecad.

Shinde et al.





DiscussionTransient suppression of a differentiated epithelial phenotype

by breast cancer cells is strongly associated with an increasedinvasive phenotype and perpetuation of the early steps of metas-tasis (34). Mesenchymal cells also have an increased capacity topersist in the presence of chemotherapy (4, 35, 36). Our previousstudies and our data herein are consistent with the notion thatautophagy drives the MET process and efficient progression tomacroscopic tumor formation (15). Our findings are stronglysupported by recent studies indicating autophagy facilitates adormant-to-proliferative switch by tumor cells within thelungs (16). Therefore, autophagy is intimately linked to theplasticity of tumor cells to transition between epithelial andmesenchymal states, processes that are critical for dissemination,drug resistance, and metastatic outgrowth.

In addition to chemotherapy, numerous studies indicate thatwhen cells transition into a mesenchymal state, they alsobecome highly resistant to kinase inhibitors, antibody thera-pies, and even immunotherapy (37–39). Therefore, the goal ofcomplete eradication of these dormant, highly drug-resistantsubpopulations may be unattainable. Herein, we exploredapproaches to pharmacologically maintain populations ofdisseminated cells in an asymptomatic state by preventingtheir reversion back to an epithelial state. By combined geneticand kinase activity analyses, we were able to identify SYK asbeing strongly activated in mesenchymal cells that are capableof reverting back to an epithelial phenotype and giving rise tolung and long bone metastases. The role of SYK in this processis to promote the removal of P-bodies through autophagy, anevent that supports MET following initiation of metastaticoutgrowth.

Our findings also emphasize the importance of properlyinterpreting data within publicly available databases that arelargely based on mRNA and protein expression values (40–42).There are examples, such as HER2, where enhanced expressionof kinases drives their auto activation and predicts for sensi-tivity to inhibitors. The corollary, however, is not well estab-lished. Indeed, mRNA expression analyses demonstrate astrong correlation between decreased SYK expression andimproved patient survival, suggesting it functions as a tumorsuppressor (8). However, our data clearly indicate thatalthough SYK expression is dramatically inhibited with TGFb,its activity is increased on a per-molecule level and it is spatiallyconcentrated into P-bodies. The mechanisms of SYK activationand translocation to P-bodies, following TGFb-induced EMTare yet to be established and are currently under investigationin our laboratory. However, the presence of high levels ofphosphotyrosine in P-bodies and stress granules (27), suggeststhat SYK associates with ribonucleoprotein particles when it isin an activated state.

We also suggest the diagnostic utility of substrate kinaseassays to overcome the pitfalls of gene expression analyses.Our oligonucleotide–peptide conjugate approach offers anextremely sensitive method to quantify kinase activity. Theapproach herein utilized a single peptide substrate optimizedfor SYK specificity (19). However, our qPCR-based readoutpresents the opportunity to utilize oligonucleotides withunique bar codes flanked by shared priming sequences linkedto a variety of substrate-specific peptides, which is the subject ofa forthcoming manuscript. This approach will allow for quan-titative readouts of multiple kinase substrates all within a single

reaction (11). Clearly, this type of enzymatic activity–baseddiagnostic that can be conducted in a single reaction on smallamounts of tissue holds great promise for predicting person-alized cancer therapeutics.

SYK is well-established as a key signaling molecule in B-cellactivation. As such, fostamatinib was developed and hasshown clinical efficacy for the treatment of B-cell–associateddiseases such as rheumatoid arthritis and lymphoma (24, 43).Furthermore, fostamatinib was recently approved for the treat-ment of chronic immune thrombocytopenia. Our data suggestrepurposing of fostamatinib as an effective treatment for theprevention of metastatic recurrence in breast cancer. Theclinical trial parameters for this type of recurrence preventionstrategy are difficult. However, fostamatinib might be partic-ularly suited for this approach given it was developed as along-term therapeutic for treatment of a chronic diseaseand thus has a very low toxicity profile (44, 45). In additionto the tumor cell autonomous effects presented herein, sys-temic treatment with fostamatinib also prevents B-cell–medi-ated promotion of a protumorigenic microenvironment (46,47). Understanding this potential polypharmacology uponsystemic treatment with fostamatinib clearly warrants furtherinvestigation.

Overall, these studies have utilized a variety of genetic, prote-omic, and pharmacologic techniques to demonstrate that SYKactivity and ATG7-mediated autophagy are required for MET, thevital final step in formation of macroscopic metastases. Morebroadly, our work also highlights an exit from the traditionalpharmacologic goal of total tumor cell eradication and insteadposits the concept of forced tumor dormancy for themanagementof stage IV breast cancer.

Disclosure of Potential Conflicts of InterestC.D. Willey is a consultant/advisory board member for LifeNet Health. No

potential conflicts of interest were disclosed by the other authors.

Authors' ContributionsConception and design: A. Shinde, S.D. Hardy, W.-H. Wang, R.L. Geahlen,M.K. WendtDevelopment ofmethodology:A. Shinde, S.D.Hardy, D. Kim, S.S. Akhand,W.-H. Wang, J.C. Anderson, W.S. Brown, J. Wan, H. Levine, C.D. Willey,R.L. Geahlen, M.K. WendtAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): A. Shinde, D. Kim, S.S. Akhand, W.-H. Wang,J.C. Anderson, R.B. Khodadadi, W.S. Brown, J. Wan, C.D. Willey,R.L. Geahlen, M.K. WendtAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): A. Shinde, D. Kim, M.K. Jolly, J.C. Anderson,R.B. Khodadadi, J.T. George, S. Liu, J. Wan, H. Levine, C.D. Willey,C.J. Krusemark, R.L. Geahlen, M.K. WendtWriting, review, and/or revision of the manuscript: A. Shinde, D. Kim,J.C. Anderson, R.B. Khodadadi, W.S. Brown, J.T. George, J. Wan, H. Levine,C.D. Willey, R.L. Geahlen, M.K. WendtAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): W.-H. Wang, J.C. Anderson, J. Wan,R.L. Geahlen, M.K. WendtStudy supervision: C.J. Krusemark, R.L. Geahlen, M.K. Wendt

AcknowledgmentsWe acknowledge Carol Post for her insightful comments. We acknowledge

Yixing Sun for preparation of the SYKtide–DNA conjugate. We kindly acknowl-edge the expertise of the personnelwithin thePurdueCenter forCancer ResearchBiological Evaluation Core. We also acknowledge the use of the facilities withinthe Bindley Bioscience Center, a core facility of theNIH-funded Indiana Clinical






and Translational Sciences Institute. This research was supported in part by theAmerican Cancer Society (grant no. RSG-CSM130259 to M.K. Wendt), the NIH(R01CA207751 toM.K.Wendt andRO1AI098132 toR.L.Geahlen), andPurdueCenter for Cancer Research via an NIH NCI grant (P30CA023168). M.K. Jolly isalso supported by a training fellowship from the Gulf Coast Consortia on theComputational Cancer Biology Training Program [Cancer Prevention andResearch Institute of Texas (CPRIT) grant no. RP170593].

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received August 23, 2018; revised December 19, 2018; accepted February 4,2019; published first February 7, 2019.

References1. Steeg PS. Targeting metastasis. Nat Rev Cancer 2016;16:201–18.2. Wendt MK, Tian M, Schiemann WP. Deconstructing the mechanisms

and consequences of TGF-b-induced EMT during cancer progression.Cell Tissue Res 2012;347:85–101.

3. Mani SA, Guo W, Liao M-J, Eaton EN, Ayyanan A, Zhou AY, et al. Theepithelial-mesenchymal transition generates cells with properties of stemcells. Cell 2008;133:704–15.

4. Luo M, Brooks M, Wicha MS. Epithelial-mesenchymal plasticity of breastcancer stem cells: implications for metastasis and therapeutic resistance.Curr Pharm Des 2015;21:1301–10.

5. Brown WS, Akhand SS, Wendt MK, Brown WS, Salehin Akhand S,Wendt MK. FGFR signaling maintains a drug persistent cell populationfollowing epithelial-mesenchymal transition. Oncotarget 2016;7:83424–36.

6. Taube JH, Herschkowitz JI, Komurov K, Zhou AY, Gupta S, Yang J,et al. Core epithelial-to-mesenchymal transition interactome gene-expression signature is associated with claudin-low and metaplasticbreast cancer subtypes. Proc Natl Acad Sci U S A 2010;107:15449–54.

7. Singh A, Greninger P, Rhodes D, Koopman L, Violette S, Bardeesy N,et al. A gene expression signature associated with "K-Ras addiction"reveals regulators of EMT and tumor cell survival. Cancer Cell 2009;15:489–500.

8. Sung YM, Xu X, Sun J, Mueller D, Sentissi K, Johnson P, et al.Tumor suppressor function of Syk in human MCF10A in vitro andnormal mouse mammary epithelium in vivo. PLoS One 2009;4:e7445.

9. Yuan Y, LiuH, Sahin A,Dai JL. Reactivation of SYK expression by inhibitionof DNAmethylation suppresses breast cancer cell invasiveness. Int J Cancer2005;113:654–9.

10. Jetson RR, Krusemark CJ. Sensing enzymatic activity by exposure andselection of DNA-encoded probes. Angew Chem Int Ed 2016;55:9562–6.

11. KimD, JetsonRR, KrusemarkCJ. ADNA-assisted immunoassay for enzymeactivity via a DNA-linked, activity-based probe. Chem Commun CambEngl 2017;53:9474–7.

12. Iliuk AB, Martin VA, Alicie BM, Geahlen RL, Tao WA. In-depth analyses ofkinase-dependent tyrosine phosphoproteomes based on metal ion-func-tionalized soluble nanopolymers. Mol Cell Proteomics MCP 2010;9:2162–72.

13. Parker R, Sheth U. P bodies and the control of mRNA translation anddegradation. Mol Cell 2007;25:635–46.

14. Zheng D, Chen C-YA, Shyu A-B. Unraveling regulation and new compo-nents of human P-bodies through a protein interaction framework andexperimental validation. RNA 2011;17:1619–34.

15. Hardy SD, Shinde A, Wang W-H, Wendt MK, Geahlen RL. Regulation ofepithelial-mesenchymal transition andmetastasis by TGF-b, P-bodies, andautophagy. Oncotarget 2017;8:103302–14.

16. Vera-Ramirez L, Vodnala SK, Nini R, Hunter KW, Green JE. Autophagypromotes the survival of dormantbreast cancer cells andmetastatic tumourrecurrence. Nat Commun 2018;9:1944.

17. Mowers EE, Sharifi MN, Macleod KF. Autophagy in cancer metastasis.Oncogene 2017;36:1619–30.

18. Brown WS, Tan L, Smith A, Gray NS, Wendt MK. Covalent targeting offibroblast growth factor receptor inhibits metastatic breast cancer.Mol Cancer Ther 2016;15:2096–106.

19. Schmitz R, Baumann G, Gram H. Catalytic specificity of phosphotyrosinekinases Blk, Lyn, c-Src and Syk as assessed by phage display. J Mol Biol1996;260:664–77.

20. Sander JD,MaederML, ReyonD,VoytasDF, Joung JK,DobbsD. ZiFiT (ZincFinger Targeter): an updated zinc finger engineering tool. Nucleic Acids Res2010;38:W462–468.

21. Wyvekens N, Topkar VV, Khayter C, Joung JK, Tsai SQ. DimericCRISPR RNA-guided FokI-dCas9 nucleases directed by truncatedgRNAs for highly specific genome editing. Hum Gene Ther 2015;26:425–31.

22. Zhu X, Xu Y, Yu S, Lu L, Ding M, Cheng J, et al. An efficient genotypingmethod for genome-modified animals and human cells generated withCRISPR/Cas9 system. Sci Rep 2014;4:6420.

23. George JT, JollyMK, Xu J, Somarelli J, LevineH. Survival outcomes in cancerpatients predicted by a partial EMT gene expression scoring metric.Cancer Res 2017;77:6415–28.

24. Hoellenriegel J, Coffey GP, Sinha U, Pandey A, Sivina M, Ferrajoli A, et al.Selective, novel spleen tyrosine kinase (Syk) inhibitors suppress chroniclymphocytic leukemia B-cell activation andmigration. Leukemia 2012;26:1576–83.

25. L�anczky A, Nagy �A, Bottai G, Munk�acsy G, Szab�o A, Santarpia L, et al.miRpower: a web-tool to validate survival-associated miRNAs utilizingexpression data from 2178 breast cancer patients. Breast Cancer Res Treat2016;160:439–46.

26. Lipchik AM, Killins RL, Geahlen RL, Parker LL. A peptide-based biosensorassay to detect intracellular Syk kinase activation and inhibition. Biochem-istry 2012;51:7515–24.

27. Krisenko MO, Higgins RL, Ghosh S, Zhou Q, Trybula JS, Wang W-H, et al.Syk is recruited to stress granules and promotes their clearance throughautophagy. J Biol Chem 2015;290:27803–15.

28. KomatsuM, Ichimura Y. Physiological significance of selective degradationof p62 by autophagy. FEBS Lett 2010;584:1374–8.

29. Ichimura Y, Komatsu M. Selective degradation of p62 by autophagy.Semin Immunopathol 2010;32:431–6.

30. Wendt MK, Taylor MA, Schiemann BJ, Sossey-Alaoui K, Schiemann WP.Fibroblast growth factor receptor splice variants are stable markers ofoncogenic transforming growth factor b1 signaling in metastatic breastcancers. Breast Cancer Res 2014;16:R24.

31. WendtMK, TaylorMA, Schiemann BJ, SchiemannWP.Down-regulation ofepithelial cadherin is required to initiate metastatic outgrowth of breastcancer. Mol Biol Cell 2011;22:2423–35.

32. Antitumor and antimetastatic activities of chloroquine diphosphate in amurine model of breast cancer - ScienceDirect [Internet]. Available from:https://www.sciencedirect.com/science/article/pii/S0753332210001174?via%3Dihub#fig0025

33. Braselmann S, Taylor V, ZhaoH,Wang S, Sylvain C, BaluomM, et al. R406,an orally available spleen tyrosine kinase inhibitor blocks Fc receptorsignaling and reduces immune complex-mediated inflammation.J Pharmacol Exp Ther 2006;319:998–1008.

34. Pastushenko I, Brisebarre A, Sifrim A, FioramontiM, Revenco T, BoumahdiS, et al. Identification of the tumour transition states occurring during EMT.Nature 2018;556:463–8.

35. Schmidt JM, Panzilius E, BartschHS, IrmlerM, Beckers J, Kari V, et al. Stem-cell-like properties and epithelial plasticity arise as stable traits aftertransient Twist1 activation. Cell Rep 2015;10:131–9.

36. Singh A, Settleman J. EMT, cancer stem cells and drug resistance: anemerging axis of evil in the war on cancer. Oncogene 2010;29:4741–51.

37. Akalay I, Janji B, Hasmim M, Noman MZ, Andr�e F, De Cremoux P, et al.Epithelial-to-mesenchymal transition and autophagy induction in breastcarcinomapromote escape fromT-cell-mediated lysis. Cancer Res 2013;73:2418–27.


Shinde et al.



https://www.sciencedirect.com/science/article/pii/S0753332210001174?via%3Dihub#fig0025

https://www.sciencedirect.com/science/article/pii/S0753332210001174?via%3Dihub#fig0025


38. Dongre A, Rashidian M, Reinhardt F, Bagnato A, Keckesova Z, Ploegh HL,et al. Epithelial-to-mesenchymal transition contributes to immunosup-pression in breast carcinomas. Cancer Res 2017;77:3982–9.

39. Burnett JP, Korkaya H, Ouzounova MD, Jiang H, Conley SJ, Newman BW,et al. Trastuzumab resistance induces EMT to transform HER2(þ) PTEN(�) to a triple negative breast cancer that requires unique treatmentoptions. Sci Rep 2015;5:15821.

40. Curtis C, Shah SP, Chin S-F, Turashvili G, Rueda OM, Dunning MJ, et al.The genomic and transcriptomic architecture of 2,000 breast tumoursreveals novel subgroups. Nature 2012;486:346–52.

41. Ciriello G, Gatza ML, Beck AH, Wilkerson MD, Rhie SK, Pastore A, et al.Comprehensive molecular portraits of invasive lobular breast cancer. Cell2015;163:506–19.

42. Gyo��rffy B, Surowiak P, Budczies J, L�anczky A. Online survival analysissoftware to assess the prognostic value of biomarkers using transcriptomicdata in non-small-cell lung cancer. PLoS One 2013;8:e82241.

43. Friedberg JW, Sharman J, Sweetenham J, Johnston PB, Vose JM, LaCasce A,et al. Inhibition of Syk with fostamatinib disodium has significant clinicalactivity in non-Hodgkin lymphoma and chronic lymphocytic leukemia.Blood 2010;115:2578–85.

44. Bussel JB, Arnold DM, Cooper N, Khalafallah AA, Boxer M, Liles D, et al.Long-term maintenance of platelet responses in adult patients with per-sistent/chronic immune thrombocytopenia treated with fostamatinib:1-year efficacy and safety results. Blood 2017;130:16.

45. McKeage K, Lyseng-Williamson KA. Fostamatinib in chronic immunethrombocytopenia: a profile of its use in the USA. Drugs Ther Perspect2018;34:451–6.

46. B cells regulate macrophage phenotype and response to chemotherapy insquamous carcinomas - ScienceDirect [Internet]. Available from: https://www.sciencedirect.com/science/article/pii/S1535610814001883

47. Gunderson AJ, Coussens LM. B cells and their mediators as targets fortherapy in solid tumors. Exp Cell Res 2013;319:1644–9.





https://www.sciencedirect.com/science/article/pii/S1535610814001883

https://www.sciencedirect.com/science/article/pii/S1535610814001883


2019;79:1831-1843. Published OnlineFirst February 7, 2019.Cancer Res Aparna Shinde, Shana D. Hardy, Dongwook Kim, et al.

Mesenchymal Plasticity and Metastasis in Breast Cancer−Epithelial Mediated Autophagy Is Required for−Spleen Tyrosine Kinase

Updated version

10.1158/0008-5472.CAN-18-2636doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2019/02/07/0008-5472.CAN-18-2636.DC1

Access the most recent supplemental material at:

Overview

Visual

http://cancerres.aacrjournals.org/content/79/8/1831/F1.large.jpgA diagrammatic summary of the major findings and biological implications:

Cited articles

http://cancerres.aacrjournals.org/content/79/8/1831.full#ref-list-1

This article cites 44 articles, 9 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/79/8/1831.full#related-urls

This article has been cited by 6 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/79/8/1831To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-18-2636

http://cancerres.aacrjournals.org/content/suppl/2019/02/07/0008-5472.CAN-18-2636.DC1

http://cancerres.aacrjournals.org/content/79/8/1831/F1.large.jpg

http://cancerres.aacrjournals.org/content/79/8/1831.full#ref-list-1

http://cancerres.aacrjournals.org/content/79/8/1831.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/79/8/1831


spleen tyrosine kinase mediated autophagy is required for ...introduction primary tumor metastasis...

Documents