Sooke News Mirror, March 14, 2012

Download Sooke News Mirror, March 14, 2012

Post on 06-Mar-2016

219 views

Category:

Documents

6 download

DESCRIPTION

March 14, 2012 edition of the Sooke News Mirror

TRANSCRIPT

BLUE PLATE SPECIAL Kelly and Mike Kraft perform at the Legion on Mar. 31 for a dinner concert.Page B12012 TRIATHLON Sooke Subaru Triathlon committee aims high. Page 21 Your community, your Classi eds B8 75Wednesday, MARCH 14, 2012Editorial Page 8 Entertainment Page B1Sports/stats Page 21Agreement#401105411407x2.5 SOOKESOOKE NEWS 2010 WINNERM I R R O RSharron HoSooke News MirrorThe developers of Mariners Village donated $120,000 to the BC Cancer Founda-tion of Vancouver Island on March 10 at the complexs open house. I had a close, close friend pass away from cancer in the last year, said Mike Bar-rie, former NHL player and partner and developer of the waterfront property. Barrie said he was com-pelled to make a difference after the loss of a friend, and educational tour at the Vancouver Island BC Cancer Foundation. When I went and saw what they were doing I said, How can I help and how can I be involved. The donation was from a portion of sales of 370 housing units at Mariners Village. But the goodwill does not stop there. Barrie said more monetary sup-port may come with contin-ued success of his housing development. With our success, theres no question of us doing more, without committing beyond our means. Its close to our heart. The donation will be used to fund cancer research strictly on Vancouver Island. According to Dr. Brad Nel-son, director of research laboratories, the money will be put towards funding new projects to generate more knowledge on the disease. Funds like this allow us to start new projects, new ideas, hire say a post-doc-torate fellow to come to the lab and start something entirely new, Nelson said. He said a post-doctorate fellow would lay the ground work for research that could be supplemented by external grants. Nelson said the initial donation could be leveraged for up to 10 times the amount. Laura Walsh, of the BC Cancer Foundation, said the contribution was one of a kind. In my 10 years on the Island, this is truly exciting. Theres never been a new developer who has stepped forward the way Mike has. During the ribbon cutting ceremony, District of Sooke councillor and acting mayor Kerrie Reay, commended Barrie and his associates for conducting business locally, adding the develop-ment has heralded a better reputation for Sooke. This development shows that Sooke is a competent and viable place to do busi-ness, Reay said.The condo and town home development was constructed using mainly local materials and labour -- employing 140 workers. According to Bar-rie, all the wood used was from trees in Sooke that were milled locally. Two weeks ago council approved phase two of the development called Mer-chants Landing, which will supply roughly 270 con-struction positions, and an additional 350-500 jobs when completed. Mariners Village donates to cancer researchSharron Ho photoBig money(Right to left) LoriAngelini, development officer with BC CancerFoundation, developer Mike Barrie, and Dr. Brad Nelson, director of research laboratories,hold up the $120,000 donation cheque. Left, interested people mill about in anticipation of touring the development.642-6480 Oliver Katz Personal Real Estate Corp. www.oliverkatz.com we look after you POPULAR SUNRIVER CREEKSIDE The perfect family home that offers 4BRs & 3 baths on 2 levels desirable open concept main w/hardwood incl LR w/19ft ceiling & gas FP adj. dining, front office BRs up MBR w/deluxe ensuite. STONE RIDGE ESTATES 6BR W/2BR SUITE Value thats hard to beat here in this 3100SF home w/legal tenanted 2BR in-law($950/mth.) upscale granite kitchen open LR/DR, priv yard matching garden shed-Shows beautifully! FUNKY 4BR 3 BATH VIEW HOME 1 ACRE Terrific OCEANVIEWS on offer on a very private 1 acre parcel in sunny Saseenos incredibly wide open main w/wall of windows & cosy woodburn-ing FP, ent. Size deck w/hot-tub & stellar views! A2 www.sookenewsmirror.com WEDNESDAY, MARCH 14, 2012 - SOOKE NEWS MIRRORPRODUCEPRODUCE5-A-Day for Optimum HealthPRODUCEAD PRICES IN EFFECT MAR 14 THRU MAR 20, 2012www.westernfoods.comSeniors Day Thursdays Save 10% on Most ItemsSmokedTurkeyDELIDELIHealthy Choices in ourDELI Remember Your CalciumDAIRYDAIRYDAIRYIsland FarmsMulti Pack Yogurt 12x125g ...$579Parkay Soft or 1/4sMargarine 1.28-1.36kg ..................$349KraftShredded Cheese 380g .........$599Island Gold Large WhiteVeggie Fed Eggs 12s .................$299ASOOKE6660 Sooke RoadOpen 7 Days a Week7:30 am to 10:00 pmWe reserve the right to limit quantitiesSEATreats Treats From theFrom theSEAAD PRICES IN EFFECT MAR 14 THRU MAR 20 2012AYour Community Food StoreYour Community Food StoreAngus Beef Boneless Blade PotRoast7.69kg .............$349/lbFreshLean GroundBeef7.25kg .............$329/lbFletchers Boneless ClassicSmokedHam800g...............$799/eaFresh, Great Tasting Meat BUTCHERS BLOCKBUTCHERS BLOCKBUTCHERS BLOCKPreviously FrozenTigerPrawnsAll Varieties, 475mlAngus BonelessLean StewingBeef8.80kg ..............$399/lbFresh BonelessPork Sirloin 5.49kg ...............$249Fletchers Classic SlicedSmoked Bacon500g.....................$449/ea+ depOld El Paso Taco or Burrito Kits 300-510g ..2/700Best Gourmet Coffee 907g .......................... $749General Mills Gluten Free Chex Cereal 365-395g $399Kraft Flanker Dinners 200g ...........................2/300China Lily Soya Sauce 483ml ............................ $229Mr Noodle Kimchi Noodles 86g ....................89Pepperidge Farms Cheddar Gold sh 200g .2/500Heinz Upside Down Prepared Mustard 375ml $139Shake N Bake Coating Mix 113-192g ...................$199 Jell-O Jelly Powers 85g ...................................69Texana Long Grain White or Brown Rice 2kg . $449Christies Red Oval Stoned Wheat Thins 600g $349Realemon Juice 945ml .................................. $219Oroweat Oatnut or 12 Grain Bread 680g $299McGavins Winnipeg Rye Bread 500g .......2/400Olafson Sun Dried Tomato Burrito 8s .. $279Alpo Dry Dog Food 7.2kg ..........................$1299Mainstay Dry Cat Food 8kg .......................... $999WC Cat Litter 10kg ........................................ $699Bounce Fabric Softener Sheets 70-80s ....... $429Cascade Dishwasher Detergent 1.7kg ..... $349Charmin Double Roll Bathroom Tissue 8s $549Bounty Prints Paper Towels ................$259+ dep+ dep. Angus Beef Boneless Blade Simmering SteaksLocally Owned & Operated Since 1974Locally Owned & Operated Since 1974CheeseCurds Provolone $169Quality and ConvenienceFROZEN FOODSFROZEN FOODSFROZEN FOODSFletchers SlicedBologna 375g................................$349Fletchers SlicedCooked Ham375g ...............................$399$309$179/eaFor Your Healthy Lifestyle 59 Island BakeryOrganicBreadsNATURAL FOODSNATURAL FOODSNATURAL FOODSYama MotoTeriyaki Seaweed Snacks 20g ..2/500Paci c Vanilla onlyAlmond Beverage 946ml ...$109Raincoast TradingWild Paci c Sardines 120g 2/400Simply NaturalOrganic Ketchup 575ml .2/400Simply NaturalOrganic Mustards 330ml ...$179Food For LifeCorn Tortilla 340g ..............2/500$189 $299 6sBulkBulkFoodsFoodsBulkFoodsBanana Chips100g .......................................59Gummi Worms 100g .................69Olympic Mix 100g 89Sun owerSeeds 100g ....................59 BAKERYBAKERYBAKERY8.80kg..........................................Per 100g+ depLibby Corn,Peas or Mixed Vegetables 1kg 2/400PillsburyIndividual Pizzas 385g ............$299SwansonTV Dinner 280-383g ...................$349Island Farms Frozen Yogurt,Sherbet or Ice Milk 1.65L ..$499 $119680g311mlNorthern KingBasaFillets $699 $399 Garlic CheeseFocaccia $329Beef DipBuns6s425g $229Banana CreamPieBlueberry Scones6s$489 $349/ea $229Hardy BuoySmoked SalmonNuggetsLANGFORD772 Goldstream Ave.Open 7 Days a Week7:30 am to 10:00 pmWe reserve the right to limit quantitieslb/lbMarinated Veggie Salad/eaAll Pkg Sizes$259Knudsen orSanta CruzSpritzersGo GreenGo GreenuseWestern Foods Cloth BagsMinute MaidMinute MaidFruitPunch295ml+ depRaisin Bread $2198989 3L$499 CapriCanola Oil560gea$4991L796ml$179HabitantRTS Soup890mlKraft Miracle WhipSalad Dressing$399 2/500 300-320gOld Dutch RestauranteTortilla ChipsTortilla Chips640mlRaguPasta SauceSan Domenico Extra VirginOlive OilCarnationHot Chocolate700g$299RogersGranola Cereal280g, Envelopes$259945ml2/400MottsClamato Juice540ml$109UnicoChick Peas or Beans250g$599Kraft GratedParmesan CheeseStaggChili Con Carne425g$199 642ml$339 Pace Salsa orPicante Sauce350g$299ChristiesCookies341-398ml89 Royal CityVegetablesAll VarietiesPepsi Cola12x355ml2/900Per 100gThompson Seedless Green GrapesRed or Green LeafLettucePremiumRoma Tomatoes 99 69 $199 Cantaloupe....................................$249TexasRio Red Grapefruit..................................2/100MexicanZucchini Squash1.74kg .................................79 Bunched Carrots........................................$149Organic BunchBroccoliB.C. Hot House Long EnglishCucumbers................................................................................. $169 B.C. Grown OrganicAmbrosia Apple$349 89MexicanGreen OnionsB.C. X-FancyRoyal GalaApples2.18kg 79 3/100 3lb bag700g/lb4/500 /100g/ea/lbIsland FarmsLightLightCreamCream1L1L/2/500 /ea/lb/eaHot Soup Come in Every Wednesday for our Secret Super Saver Specialsin all departments1.74kg/ea16oz.454g/lbPer 100gPer 100g/ea3.73kg+ dep/100g Size 26/304.39kg/lb/lbBunchPublic will have input on proposed four-way roundaboutPirjo RaitsSooke News MirrorDiscussion on the future roundabout in the center of Sooke was discussed at the regular District of Sooke coun-cil meeting on March 12.CAO Evan Parliament gave a brief summary of the project, which has yet to be started as there are negotia-tion underway with property owners who will be impacted by the construction of the roundabout.Parliament stated that land dedication was needed from two properties across from Evergreen Centre. The roundabout would be built using funds from the gaso-line tax, an ICBC grant and Sooke taxpayers. Parliament stated that the taxpayers would be responsible for $30,000. Money to purchase land needed would come from non-parks land reserves (75 per cent) and land dedica-tion (25 per cent).Mayor Wendal Milne called the project the big elephant in the room and said it was necessary to have pub-lic input. A public infor-mation session should be held at the same time as the draft budget information session.Councillor Rick Kasper stated he didnt like the idea of the dis-trict hiring consultants from outside. He said money earmarked for consultants should go back into the project.Parliament said a full tender would go out for the construction.Discussion followed on the disruption to the town once the round-about construction starts.Businesses will be impacted, said Coun. Herb Haldane. Its going to be a night-mare.Others spoke of the beautification of the town core and creative solutions to minimize the impact of the con-struction.Coun. Kevin Pear-son said the project had good aspects but he was concerned over the cost.There is some scary elements to it, he said referring to under-ground work required.Mayor Milne said that the roundabout was consistent with the Official Community Plan and they approved the project in principle in the budget.The cost of the round-about is estimated to be between $450,000 and $600,000.1147x3SOOKE NEWS MIRROR - WEDNESDAY, MARCH 14, 2012 www.sookenewsmirror.com NEWS A31104x3Up SookeThumbs Up!BLOOD DONOR CLINICTHE NEXT BLOOD bank will be tomorrow, Thursday, March 15, from 12:30 pm - 7 p.m. at Holy Trinity Anglican Church on Murray Road.OPSRRA AGMSUNDAY, MARCH 18 from 2 4 p.m.SHIRLEY COMMUNITY HALL on West Coast Road @ Sheringham Point Road.JOHN HORGAN, MLA and JDFEA Regional Director Mike Hicks will be inATTENDANCE.PHOTO PURCHASESTHE PHOTO STORE and gallery recently on the Sooke News Mirrors website is being discontinued. IF YOU SEE a photo on the paper that you want to purchase a print of, come into the office and we can put one or more on disk for you.WAKE ME UPSOOKE HARBOUR PLAYERS are presenting their latest dinner/theatre this weekend. Opening night at Sooke Harbour House, other nights at the Legion. Tix at usual outlets.TO THE DEVELOPERS of Mariners Village for donating their first $120,000 for cancer research. Pirjo Raits photoDriftwood dinerThe Catchpole family from Manitoba spend a little time in a driftwood shelter at Whiffin Spit enjoying their lunch while on vacation in the area.New bike skills park requestedPirjo RaitsSooke News MirrorA proposal to build a bike skills park at John Phillips Memo-rial Park was met with some interest by Dis-trict of Sooke council on March 12.Lee Hindrichs from the Sooke Slow Food Cycle group presented plans to build the park at no cost to the dis-trict.The park would help all ages of cyclers to develop their cycling skills on and off the road, said Hindrichs.By centralizing a safe skills park decreases the creation of ad hoc skills areas in sensitive areas, said Hindrichs. It also makes them easier to supervise, she said.The skills park would contain such thinsg as ramps, jumps, bridges, slalom courses and the like. It would be used to host competitions and could attract cyclists from all around the area to Sooke.It brands Sooke as rhe recreational hot spot for Vancouver Island, said Hindrichs. She said it follows the guidelines for John Phillips Memorial Park use in the Official Com-munity Plan. She said this type of park would be used by mountain bikers who have higher incomes and more edu-cation and travel or relocate to enjoy their recreational lifestyle.A coalition of mem-bers from the Sooke Slow Food Cycle, Sooke Bike Club and the Juan de Fuca Cycling Coali-tion would build the necessary elements in the park with volunteer labour and donated materials. What they would need from the district would be a sur-vey report, appoint-ment of someone to work with the group and council endorse-ment.They are looking to start immediately and have a grand opening in September.Mayor Wendal Milne was encouraging but said they needed to have some type of soci-ety which would be responsible. Other issues brought forward were on liabil-ity, insurance, equal opportunity for all groups, amount of area needed.Roundabout discussed by councilHELPING PEOPLE LIVE BETTER LIVESCedar Grove Centre 250-642-2226P E O P L E S P H A R M AC YLOCALLY OWNED AND OPERATEDPharmacy service the way it is meant to be....over 20 years of service in the communities of Sooke, East Sooke, Otter Point, Jordan River, Shirley, and Port Renfrew, (and even for our customers who have moved to Victoria and still use our service). Pharmacy practice to bene t the needs of OUR community and more importantly.... with PEOPLE in mind.Talk to our pharmacy staff about how we can con dentially transfer your prescriptions to our location. PEOPLES DRUG MART....Where People Come FirstRon KumarPharmacist/OwnerFeb. 1990Living Sooke....Loving SookeSelling Sooke250.642.6361www.sookelistings.comDid You Know?I am pleased to announce that I have joined the sales team for Townsend Walk, located at 2253 Townsend Rd. Open Houses Saturday and Sunday 2-4pm or call me to view at a time that is convenient for you.www.townsendwalksooke.cawww.sookelistings.comBuying or sellingcall me!MARLENEARDEN SOOKES NEWEST TOWNHOUSE DEVELOPMENT 2253 TOWNSEND RD.STARTING @ $299,900!Beautiful 28 Townhome development featuring 9ft ceilings, 3BR, 3BA, wood oors, warm contemporary decorating and upscale nishing details throughout. Great location, only a short walk to schools and Sooke village core. Each unit has covered front and rear porches, front and rear yards and garage. THESE HOMES QUALIFY FOR BC FIRST-TIME NEW HOME BUYERS BONUS OF UP TO $10,000!TOWNSEND WALKTOWNSEND WALKA4 NEWS www.sookenewsmirror.com WEDNESDAY, MARCH 14, 2012 - SOOKE NEWS MIRRORDigital7x7CRD Spring Irri-gation3x63x6Garrison on cuts against DNDCuts to the Depart-ment of National Defence has been a growing concern for those in the Esquimalt-Juan de Fuca riding. Randall Garrison, MP spoke out today about the decision to eliminate the blue boat commuter ferry service that transports work-ers to and from CFB Esquimalt by April 30, 2012. While I recognize that the ferry service is not a core function of the Canadian Forces, this decision will add more vehicles to the already congested drive between Esquimalt and the West Shore Gar-rison said. This deci-sion comes at a time when workers have very few alternative options to get to work, he continued.With the upcoming Craigflower Bridge clo-sure, the community was already expect-ing to see more con-gested traffic. Garrison plans to meet with the Admiral to discuss timing of the ferry ser-vice closure. Can the blue boat service be extended throughout the Craigflower Bridge closure in order to keep more vehicles off the road during that busy time? Garrison asked. This could also allow more time to explore alternative operators of a similar service, he argued.The decision to shut down the ferry service is added proof that the federal government needs to act quickly to fund the repairs to the E&N railway, Garrison said. It has been eight months since rail pas-senger service on Van-couver Island came to a halt. With new jobs coming to the Esquimalt dockyard and ferry service for DND work-ers shutting down, the already busy stretch of road will reach grid-lock, Garrison argued. An operating E&N rail service would mean less commuters and freight traffic on the congested roads.Randall GarrisonMP for Esquimalt-Juan de Fuca Elimination of ferry service means more traffic on congested roadwaysPirjo Raits photoRays of sunshineAnother lovely sunset, looking out towards the Olympic Mountains.Capital Regional DistrictA properly installed and maintained irrigation system will conserve water!Efcient Irrigation WorkshopsConsidering the purchase and installation of an irrigation system or do you already own a system that you would like to upgrade?CRD Environmental Sustainability is hosting free, efcient irrigation workshops. Irrigation experts will explain system components, discuss installation and provide scheduling and maintenance tips. Optional irrigation workbooks are available to purchase for $30.Space is limited. Please pre-register by calling 250.474.9684Micro-Drip Saanich Saturday, April 14 1:30 to 4:30 p.m.Irrigation Systems: Saanich Saturday, June 23 2 to 5 p.m. Sooke Wednesday, July 18 6 to 8:30 p.m.ALL Efcient Saanich Saturday, March 24Irrigation Systems: Sidney Saturday, May 26 2 to 5 p.m.Controller Saanich Wednesday, April 4Scheduling: Saanich Wednesday, May 16 Saanich Wednesday, August 15 7 to 9 p.m.Maintenance: Saanich Saturday, August 25 2 to 5 p.m.A6 NEWS www.sookenewsmirror.com WEDNESDAY, MARCH 14, 2012 - SOOKE NEWS MIRRORRandall Garrison3x3.51363x7Can Tire4x6John Horgan7x3Pirjo Raits photoThe government dock looked very wintery on Tuesday morning, March 13.Snowy SookeWere here to help constituents with Federal government programs and services.ADDRESS: A2100 Aldersmith Place Victoria V9A 7M8HOURS: 10am4pm, MondayThursday or by appointmentPHONE: 250-405-6550 EMAIL: Randall.Garrison@parl.gc.ca FAX: 250-405-6554 FOLLOW US ON FACEBOOK!Randall Garrison, MPESQUIMALTJUAN DE FUCAwww.randallgarrison.ndp.ca2205 Otter Point Road, SookePhone: 250-642-1634 Fax: 250-642-0541email: info@sooke.cawebsite: www.sooke.caUpcoming Public MeetingsLand Use and Environment CommitteeMonday, March 19, 2012 at 7:00 pmSooke Economic Development CommissionWednesday, March 21, 2012 at 7:00 pmThis schedule is subject to change. Please call 250-642-1634 to con rm meetings. Council meeting agendas may be viewed at www.sooke.caWHATS NEW!The District of Sooke website www.sooke.ca has all for all kinds of news about your community including:Applications for Community Grant deadline April 30, 20112012 Financial Plan (Budget) public consultation2011Census links Updated information on current projects around town including land development, road works, and more!LANGFORDWest Shore Town CentreCHECK OUT THE GOLDSTREAM NEWS GAZETTE AND THE SOOKE NEWS MIRROR EACH WEDNESDAY FOR OUR WEEKLY FLYERProud sponsors of the local SPCA and Victorias Transition House Pet friendly store too!Come in during our store improvementsWere OPENWere OPEN!!> COMING SOON50% MORERETAIL SPACE70%OFFon selected merchandise throughout the store to make way for exciting new productsClearance Pricesup toJohn Horgan MLA Juan de Fuca> Dealing with transportation or residential tenancy issues? > Have a question about WorkSafe BC? > Problems with seniors care?Please contact my community ofce regarding any provincial program or matter.NEED HELP?John Horgan, MLA Juan de Fuca Community Ofce MondayFriday 10am4pm 800 Goldstream Ave, Victoria, BC T: 250-391-2801 E: john.horgan.mla@leg.bc.ca W: www.johnhorgan.comA10 LETTERS www.sookenewsmirror.com WEDNESDAY, MARCH 14, 2012 - SOOKE NEWS MIRRORComm Cal7x71053x7This and thatThe cod stocks in the east are not reviving even though the fish-ery is suspended; the exploding seal popula-tion is feeding on the struggling cod popula-tions; the green hug-gers have produced this effect by their intervention in the seal harvest.Their arguments are sound however, for how indeed could one put a precious baby seal to sleep, when we have all those noisy, ugly lambs we can butcher?Apparently the wild orcas salmon dinners are now protected even though there is no indi-cation of any starving orcas. The elusive spot-ted owl is protected, heck, they might even get around to protect-ing the economy some day, if enough economy survives to protect.The green huggers promote a green econ-omy without even starting up and being successful in a green business unless of course receiving dona-tions be considered business. The green huggers are pulling the wool over our eyes and then crying wolf; they will win because they know what mass hysteria is and how to manipulate us into it. The federal Liber-als have opened the door to their agenda at the legal end, and we are going to reap the rewards which is that we will become as pristine and serene as the old Newfoundland, while the new New-foundland makes jokes about us.To see the effects of mass hysteria, there is no need to remem-ber Y2K, one need only pay minimal attention, and we will hear the resounding refrain of global warming virtu-ally everywhere, cou-pled with the familiar greenhouse gases but never any word of Ice Age.I would point out that in 1000 AD the Vikings were farming in some places in Green-land, and it has not as yet returned to the degree to that degree of warmth, so youd better get used to it because its going to get a lot warmer, with or without our pittance of CO.Remember also the clearcut you see from space, well, all those trees they replanted it with are now sucking up CO at a rate of three feet per tree per year. Which means, clearcuts remove CO.Furthermore, griz-zlies eat berries and berrybushes are the first thing that grows after a forest is clearcut. So clearcuts are the optimal habitat for griz-zlies.The real question here is why is every-body so completely silenced by the green huggers? And my answer is What can you say in the middle of a riot?N.E. MacNabShirleyA little ridiculeI like and respect our B.C. teachers, who are quite well educated but they fail to show their hard won erudition-rather, they seem to behave more like meat-heads.Historically, every-one knows that no gov-ernment can withstand prolonged sustained ridicule and scorn, if properly planned and orchestrated. There must be dozens of opportunities for ridi-cule.So, where are our present day Jonathan Swifts, Alexander Popes, Voltaires and Socrates? And where are the farces, the situ-ation comedies, the devastating limericks, the lampoons and so on? The government should have been bombarded and if suf-ficiently poignant, the students and parents could have joined in the fun.Like Socrates, the teachers may have to drink the poison of a forced settlement, but unlike Socrates, they did not first rile the government to the screaming stage by a prolonged ridicule pro-gram. Had they done so, there may have been a quicker and bet-ter settlement.G.B. MillerShirleyLETTERSContd from page 9Contd on page 18With the overwhelming Support from our Customers, these amounts have been raised for the following local schools in the last 5 month periodCongratulations to everyone who has helped support the Milk Money Program that has put over $14,224$14,224 back into our schools since January 2010. Thank you!Better because we care... about our Kids!We are proud to announce our February Milk Money payout to our Community Schools.John Muir $424 Saseenos $290 Poirier $552 Journey $324EMCS $584 Sooke Elementary $511Port Renfrew $94Mon :: closedTues-Thurs :: 11:30 am to 9:30 pmFri & Sat :: 11:30 am til lateSun :: 5:00 pm to 9:30 pm6676 Sooke Road (in town center) Sooke, BC778-425-3763St. Paddys DayFood & Drink SpecialsSt. Paddys DayFood & Drink SpecialsPresenting DJane Naomi NiceJoin us for good eats& late night beatsfollow us on Facebook for upcoming events& food & drink specialsJORDANS7x7SOOKE NEWS MIRROR - WEDNESDAY, MARCH 14, 2012 www.sookenewsmirror.com NEWS A11Police, fire and ambulance all need recruitsSharron HoSooke News MirrorThe District of Sooke held the first protective services meeting on March 7 at the munici-pal city hall to intro-duce different emer-gency departments to residents. Heads from the Sooke RCMP, fire department and ambulatory ser-vices conducted pre-sentations discussing year-end results, depart-ment backgrounds and existing shortfalls. Sooke RCMPSooke compared to other municipalities is grossly under policed, said Steve Wright, RCMP staff sergeant. We dont have enough police offi-cers to go to 24 hour coverage and that is a concern to me.The district of Sooke currently has 15 police officers, 11 are paid by the district and four by the province. After 3 a.m. there are no police officers in the detachment, only offi-cers on call. What it does is our police officers are on call so theres a delay in our response. A serious delay in our response time and that could pose a danger to the commu-nity, Wright said. There is currently one police officer for every 1,000 residents in the district, which con-trasts with the 1/670 average for the rest of the province. In order to match the province, Sooke requires five more police officers. Each tax payer, pays $140/year for policing services. In Victoria its $400 per capita. Were being stretched too thin with all the demands. Were getting to the point now where the days of No call is too small is com-ing to an end. According to Wright, police are focusing on crime reduction. Pro-lific offenders are moni-tored to ensure they follow probation rules, and curfews.Prolific offenders commit 90 per cent of the crimes, so if we tar-get them well reduce our crime rate.Last year, police responded to 5,000 calls, nearly a 600 decrease from the six year average. Fire DepartmentFire Chief Steve Sorensen said the department is in need of more volunteer fire fighters. Biggest problem were facing right now is recruitment and retention of volunteer fire fighters, he said, adding a volunteer fire fighter lasts 2.8 years, but it takes roughly two years to train them. Training costs roughly $8,000, including gear. Each year it gets a little bit harder to attract volunteers.In order to cut costs, the fire department was thinking of culling the first responder pro-gram, but it was later determined it would be more cost-efficient to continue it. If your majority of your department is first responder trained, you dont have to have first aid attendants. Currently the fire completes less than half of inspections for commercial and public buildings, completing 350 out of 750 this year, not including re-inspec-tions. According to fire underwriters, the 25-year-old tank on the tanker truck is going to need to replaced soon. Calls have increased 10 per cent each year for the past 15 years, with 900 calls this year. The fire department currently operates on five paid positions and 33 volunteer fire fight-ers. Ambulatory ser -vices Bryon Longeway, BC Ambulance unit chief, said the local ambu-lances answer 2,500 calls a year, which fluctuate between 150-200 calls a month. The service area stretches from Metchosin to Jor-dan River. He said the District of Sooke currently receives assistance from Victoria advanced life support paramed-ics, who are on scene in situations that require a higher level of care. According to Longe-way, a cardiac case would take the para-medics to Royal Jubli-lee Hospital in Victoria, meaning an absence between 3-4 hours. He said that cardiac cases will usually go to RJH because paramed-ics can provide emer-gency care in the back of an ambulance, mean-ing a direct route to Cath care. Longeway said response times are monitored by a higher body, and paramedics are given 90 seconds to get to a scene. Since September, there have been no inquiries from the District of Sooke or fire services regarding response delays. There are currently 30-32 staff. Eight staff moved onto other post-ings on March 1, but 10 more were acquired. Protective services outlines their issuesSharron Ho photoStaff Sargeant Steve Wright, right and in the background Fire Chief Steve Sorensen talk about the issues facing the districts protective services.SQ.FT.882 Langford Parkway, Victoria BC 250.478.2989JORDANS WAREHOUSE OUTLETSMONDAY TO SATURDAY 9-5:30 SUNDAY 11-5:00AREA RUGSSAVE UP TO 70% OFFON A HUGE SELECTION OF HAND & MACHINE MADE RUGSTRUCK LOAD SALETRUCK LOAD SALEGREAT INSTOCK DEALS ON HARDWOOD, LAMINATE, VINYL, CARPET AND AREA RUGS!$199SQ.FT.FROMCASE LOT SALESLAMINATES & HARDWOODS 12mm LAMINATEOUR TOP SELLERIncludes FREE foam!GREAT HARDWOOD DEALSLUXURY VINYL PLANKPERFECT FOR DIY PROJECTS 6 wood nish styles$299SQ.FT.FROM$299SQ.FT.FROMSQ.FT.SUPER IN STOCK CARPETAT BLOWOUT DEALSLUXURIOUS NYLONCARPETROOM SIZEROLL ENDSJUST ARRIVED IN SHEET VINYL A HUGE SELECTION TO CHOOSE FROM99FROM$189SQ.FT.FROM$99FROM89FROM $199SQ.FT.TOSQ.FT.50FROMFebruary flew byas the chamber office was busywith two big events. The Sooke RegionChamber of Commerce Awards took placeMarch 1 at the Best Western Premier Pres-tige Hotel. More than 100 business and com-munity members came out to support the nom-inees, finalists and win-ners. A great night was had by all. March 4, the Wom-ens Wellness Show was hosted by the cham-ber at Sooke Harbour House it was a greatevent! A fashion show, over 30 exhibitorsand 100 tickets were sold. The chamber waspleased with the turn out of both events andlook forward to hosting these again in 2013.New members:Nine new members joined the Sooke Region Chamber of Commerce in February: Welcome TOPS, Academy Dental, Creative Chaos Con-sulting, 120 West Con-sulting, Cheryl Vavra - Notaries in Sooke,Westshore Denture Clinic, Modern Mort-gage Group, The Lazy Gecko, Sooke Commu-nity Development Asso-ciation. Joining us in January: Tim Ayres Real Estate, Sunshine Jewls, Megson FitzPatrick Insurance - Steve Noreen, Bernice Van Vleip - Reiki Master, Sooke Lions Club, Gold-stream BikesDirectory:Our 2012 Member Directory is being cre-ated - opportunity for advertising is available - please call the chamber office 250-642-6112. We will have two editions this year allowing for new members to be added. Our April Mixer will be held at Tugwell Creek Honey Farm and Meadery - Wednesday, April 25, 5:30 p.m.Breakfast Club:Join us for our Break-fast Club Meetings held the third Tuesday of the month at the Sooke Harbour House 7 to 9 a.m. All are wel-come, chamber mem-bers $10/non-members $15. Guest speaker for March - Rod Holt: Sell-ing Sooke, what we have to offer.Opportunity to fea-ture your business - spotlight your prod-ucts. Call the chamber office for registration and information 250-642-6112.We have some great things planned for the spring and summer months - look ahead - well be announcing them soon!Kari Osselton, ManagerA12 BUSINESS www.sookenewsmirror.com WEDNESDAY, MARCH 14, 2012 - SOOKE NEWS MIRRORFido6x12Rexall2x2CHAMBER CHATTER Pirjo Raits photoSpringaheadSnowdrops are one of the first flowers blooming at this time of year and they herald the longer days and spring.Discover the tab-free wayTwo Unbeatable Offersfor $20Unlimited Evening & Weekend Calling Plan100 Anytime Local MinutesUnlimited evenings & weekends starting at 7pm Circle Calling50 Outgoing text messagesUnlimited incoming text messagesUnlimited Text Plan50 Anytime Local MinutesCircle CallingUnlimited Outgoing text messagesUnlimited incoming text messagesNo System Access Fee The Activation Fee is on us **Savings of $351st Month is Free with a Fido agreementNo System Access Fee The Activation Fee is on us **Savings of $351st Month is Free with a Fido agreementOffers and pricing subject to change without notice. Applies to all Plans: Additional airtime, long distance, roaming, data, add-ons, provincial 9-1-1 fees (if applicable) and taxes are extra and billed monthly. Available for a limited time with new activation on a 2- or 3-year Fido Agreement. Applies only to monthly service fee of plan. 1. Local airtime minutes only. Each additional minute costs 35. 2. Local calls only, excluding calls made through Call Forwarding, Video Calling or similar services. 3. Messages received from another mobile phone are free. There is a charge for premium text messages (alerts, messages YLSH[LK[VJVU[LU[JVU[LZ[ZHUKWYVTV[PVUZ*VTWH[PISLWOVULYLX\PYLK"UV[HSSU\TILYZJHUILPKLU[PLK5V(J[P]H[PVUMLL!3PTP[LK[PTLVMMLY=HSPKVUUL^HJ[P]H[PVUZ^ P[OHVY`LHY-PKV(NYLLTLU[(JYLKP[MVY[OLLU[PYLHTV\U[VM[OL(J[P]H[PVU-LL^ PSSHWWLHYVU` V\YYZ[PU]VPJL>P[OUL^HJ[P]H[PVUVUHTVU[OS`WSHU^ P[OV\[H-PKV(NYLLTLU[HVUL[PTLHJ[P]H[PVUMLLVMWLYSPULHWWSPLZ+L]PJL:H]PUNZ9LJV]LY`-LLHWWSPJHISL[V[LYTJVTTP[TLU[J\Z[VTLYZVUS`MVYHU`UL^[LYTLU[LYLKPU[VVUVYHM[LY1HU\HY`(+L]PJL:H]PUNZ9LJV]LY`-LL+:9-HWWSPLZ[VHSSZ\IZJYPILYZ^OVOH]LILLUNYHU[LKHU,JVUVTPJ0UK\JLTLU[HZKLULKILSV^\WVULU[LYPUNHJVTTP[[LK[LYTZLY]PJLHNYLLTLU[-PKV(NYLLTLU[PMMVYHU`YLHZVU` V\YZLY]PJLVY` V\YUL^[LYTPZ[LYTPUH[LKWYPVY[V[OLLUKVM` V\Y-PKV(NYLLTLU[;OL+:9-PZ[OLHTV\U[VM[OLLJVUVTPJPUK\JLTLU[^OPJOTH`[HRL[OLMVYTVMHKPZJV\U[YLIH[LVYV[OLYILUL[NYHU[LKVU[OLWYPJLVM` V\Y,X\PWTLU[HZZ[H[LKPU` V\YZLY]PJLagreement(Economic Inducement), less the amount obtained by multiplying such Economic Inducement by a fraction representing the number of months elapsed in your Fido Agreement as compared to the [V[HSU\TILYVMTVU[OZVM`V\Y-PKV(NYLLTLU[WS\ZHWWSPJHISL[H_LZ0UV[OLY^VYKZ+:9-$,JVUVTPJ0UK\JLTLU[B,JVUVTPJ0UK\JLTLU[TVU[OZLSHWZLKPU`V\Y-PKV(NYLLTLU[;V[HSTVU[OZPU` V\Y-PKV(NYLLTLU[DHWWSPJHISL[H_LZ(U(KKP[PVUHS+L]PJL:H]PUNZ9LJV]LY`-LL(+:9-HSZVHWWSPLZPMMVYHU`YLHZVU` V\YKH[HVW[PVUVY` V\YKH[HVW[PVUZJVTTP[TLU[[LYT+H[H;LYTPZ[LYTPUH[LKWYPVY[V[OLLUKVM`V\Y+H[H;LYT;OL(+:9-PZ[OLHKKP[PVUHS,JVUVTPJ0UK\JLTLU[`V\YLJLP]LKMVYZ\IZJYPIPUN[V`V\YKH[HVW[PVUSLZZ[OLHTV\U[VI[HPULKI`T\S[PWS`PUNZ\JO,JVUVTPJ0UK\JLTLU[I`HMYHJ[PVUYLWYLZLU[PUN[OLU\TILYVMTVU[OZLSHWZLKPU`V\Y+H[H;LYTHZJVTWHYLK[V[OL[V[HSU\TILYVMTVU[OZVM`V\Y+H[H;LYTWS\ZHWWSPJHISL[H_LZHUKHWWSPLZPUHKKP[PVU[V[OL+:9-MVY[LYTPUH[PVUVM` V\YZLY]PJLHNYLLTLU[0M` V\Z\IZJYPIL[VHWSHUJVTIPUPUNIV[O]VPJLHUKKH[HZLY]PJLZIV[O[OL+:9-HUK[OL(+:9-HWWS `\W[V[OL[V[HS,JVUVTPJ0UK\JLTLU[:LY]PJL+LHJ[P]H[PVU-LL(applicable to term commitment customers only for any new term entered into on or after January 22, 2012) Early Cancellation Fee (applicable to any term entered into prior to January 22, 2012) An Early *HUJLSSH[PVU-LLHUKVY+H[H,HYS`*HUJLSSH[PVU-LL^ PSSILJHSJ\SH[LKHUKJOHYNLKHZZL[V\[PU[OLZLY]PJLHNYLLTLU[` V\YLJLP]LK\WVULU[LYPUN[OH[[LYT-VYPUMVYTH[PVUVUWYV]PUJPHS MLLZ]PZP[KVJH :\IQLJ[[V[OL-PKV;LYTZHUK*VUKP[PVUZHUK(JJLW[HISLH`604-850-7721 :V\[O-YHZLY>H`604-854-4142:V\[O-YHZLY>H`604-853-1344BURNABY1154-4700 Kingsway604-437-4375MET3-4700 Kingsway604-437-43731329-4500 Kingsway604-430-9000CHILLIWACK3\JRHJ\JR>H`604-858-2400 DELTAUnit 109, 9385 120th Street604-585-3436Unit 7139 7031 120th Street604-507-5566KELOWNA4030-2271 Harvey Avenue250-762-5577MAPLE RIDGEK3-11900 Haney Place604-467-4818NEW WESTMINSTERK3-610 6th Street604-525-3436368-800 Carnarvon StreetNORTH VANCOUVER( 4HYPUL+YP]L604-904-9975PORT COQUITLAM(3V\NOLLK>H`604-942-4000RICHMOND5V9VHK604-244-84445V9VHK604-207-93665V9VHK604-270-2000 /HaLSIYPKNL>H`604-233-7788100-5V9VHK604-304-4202SURREY2659-10153 King George Hwy604-951-3338104-7500 Scott Rd 120th St604-507-40005V/^`604-576-93009-3268 King George Blvd604-368-40001-8388 128th Street604-507-1234505-7488 King George Blvd604-507-556612845-96 Ave778-395-6060VANCOUVER665 Robson Street604-669-39881191 Robson Street604-669-99772>[O(]LU\L604-873-5599+H]PL:[YLL[604-689-3988102-2800 E. 1st Avenue604-216-67883189 Main Street604-708-9366 >)YVHK^H`604-568-9009.LVYNPH6338 Fraser Street604-676-09168269 Granville Street604-263-3688131-4255 Arbutus Street604-732-5880 =PJ[VYPH+YP]L604-569-28007HJPJ)S]K778-321-5000127-370 E. Broadway604-872-3436190-7180 Kerr Street604-433-4991 >)YVHK^H`604-739-3436215 Keefer Street604-681-7033VICTORIA12A-1644 Hillside Ave250-598-3344WEST VANCOUVERFC10-2002 Park Royal S.604-922-7777Rexall Home Health Care3098 Nanaimo Street 250-384-7196Ostomy SpecialistDonna Tait E.T. NurseIn store, March 19thCall for an appointmentSOOKE NEWS MIRROR - WEDNESDAY, MARCH 14, 2012 www.sookenewsmirror.com A13NOW OPEN UNTIL 10 PM EVERY DAY!NOW OPEN UNTIL 10 PM EVERY DAY!eaeaea/100g/lb eaK_`jDfek_j=\Xkli\[>`m\XnXpK_`jDfek_j=\Xkli\[>`m\XnXpPflDXp9\Fe\F]K_\K_i\\ClZbpN`ee\ijF]8ALD9F:?F:FC8KThe Sooke Region is one step closer to our claim as the Volunteer Capital of Canada. With financial support from the Victoria Founda-tion, the Sooke Region Volunteer Centre Com-mittee (SRVC) has hired a part-time volunteer coordinator.After reviewing sev-eral applications, the SRVC Hiring Commit-tee selected Johanne Thompson as our new volunteer coordinator. Thompson is a Sooke resident and volun-teer with several years experience in leader-ship and volunteer coordination. She is eager to meet the chal-lenges ahead. Thomp-son will have her work cut out for her to meet the needs of our busy community and fulfill the grant requirements. The volunteer SRVC committee members will also be pitching in to connect with the +160 non-profit groups in the region to further clarify and define com-munity needs.Hiring Thompson is an exciting develop-ment in a story that dates back nearly four years when approxi-mately 50 members of the region identified the need for more vol-unteer coordination and support. The SRVC commit-tee was formed in 2010 with the first step to conduct a community survey around how the community envisioned a volunteer centre. The answer was clear: Sooke needed a volun-teer centre and the best way to develop it was through small steps dependent on available financial resources. The overall preference was for a self-sustain-ing entity that wouldnt compete for the same funds as the organiza-tions it was supporting. In 2011 the SRVC com-mittee applied for a Vic-toria Foundation grant to design and develop a sustainable volunteer centre. Securing funds and bringing Thomp-son into the fold is a major achievement.Our local historian, Elida Peers, provides more history on Sookes claim as the Volunteer Capital of Canada. She recalls that in the mid-1980s the Toronto Star Weekly wrote a feature story on Sooke, holding it up as perhaps the most outstanding example of volunteerism in the coun-try. It featured the Sooke Community Association and how its tremendous volunteer effort made so much possible in the community. In 2008 one of the judges of Communitie-isw in Bloom awarded Sooke high marks for volunteerism and sug-gested we consider styl-ing ourselves as the Vol-unteer Capital of BC. Peers doesnt known whether other commu-nities in Canada had also given themselves this title, yet she felt it was a wonderful way to align Sooke with other regions that shared a similarly keen and extensive focus on vol-unteerism. At the 2009 Communities in Bloom conference Sooke was awarded the provincial trophy for community participation. Speaking only from my personal point of view, says Peers, I think it would be good to be a little light-hearted about this, and have fun with it, embracing any other Canadian community who may welcome visitors with the same title, and enjoy sharing in our good fortune. I personally wouldnt like to see us tot up points to make sure we beat another Cana-dian community, laying claim to a serious title to outdo someone else, when we are all trying to accomplish good for our community. To me this would be contrary to the whole purpose of volunteering.A14 COMMUNITY www.sookenewsmirror.com WEDNESDAY, MARCH 14, 2012 - SOOKE NEWS MIRRORTELUS6X12Sooke Region Volunteer Centre hires its first coordinatorOffer available until May 22, 2012, to new clients who have not subscribed to TELUS TV or Internet in the past 90 days. *3 year TELUS TV and Internet service agreement required. Regular bundle rate of $65/month starts on month 7. Offer available while quantities last. New TELUS TV and Internet clients receive an HP Pavilion g6 laptop. Manufacturers suggested retail price of the HP Pavilion g6 laptop is $569.99. TELUS and Hewlett-Packard Development Company, L.P. reserve the right to substitute an equivalent or better laptop without notice. A cancellation fee of $15 per month for the remainder of the 3 year term applies to early cancellation of the TELUS Internet service agreement. Blackout and other restrictions apply. Minimum system requirements apply. HDTV input equipped television is required to watch HD. Final eligibility will be determined by a TELUS representative at point of installation. TELUS, the TELUS logo, Optik TV, Optik Internet and the future is friendly are trademarks of TELUS Corporation, used under licence. HP and the HP logo are registered trademarks of Hewlett-Packard Development Company, L.P. NHL and the NHL Shield are registered trademarks and Centre Ice name and logo and The Game Lives Where You Do are trademarks of the National Hockey League. NHL and NHL team marks are the property of the NHL and its teams. NHL 2012. All Rights Reserved. Hockey Night in Canada - Official mark of Canadian Broadcasting Corporation / Marque officielle - Socit Radio-Canada. 2012 TELUS.Call 310-MYTV (6988). Go to telus.com/optiktv. Or visit an authorized dealer. Sign up for Optik TV and Internet for only$40/mo.for the first 6 months.* Plus get a free HP laptop.FREEWith more HD channels than cable,Optik TV is the superstar.Get 100+ HD channels. Optik TV.TM The best in entertainment.The all-star ofTELUS AUTHORIZED DEALERS VANCOUVER ISLANDVictoriaThe Bay CentreHillside CentreMayfair MallMillstream Village Shopping CentreTillicum CentreTuscany VillageWestshore Town Centre3300 Tennyson Ave.815 View St.Campbell RiverDiscovery Harbour Shopping Centre1437B 16th Ave.1690 Island Hwy.CourtenayCourtenay CrossingWashington Plaza MallDuncanCowichan Crossing951 Canada Ave.Mill Bay845 Deloume Rd.NanaimoCountry Club CentreNorth Nanaimo Town CentrePort Place Shopping CentreRock CityWoodgrove CentreParksville281 East Island Hwy.Port Alberni4006 Johnson Rd.Port Hardy8945 Granville St.Powell River7100 Alberni St.Sidney9810 7th St.SOOKE NEWS MIRROR - WEDNESDAY, MARCH 14, 2012 www.sookenewsmirror.com NEWS A15Koodoo7x71662x3Westshgore Centre7x3Taavi Babcock photoReaders Photo of the WeekTaavi Babcock used her creative eye toget this shot at the government dock. Readers Photo of the Week is sponsored by Ellen Bergerud. Send your good quality jpegs to: editor@sookenewsmirror.com. We will publish them as space permits.49 Spadina AvenueSuite 403, TorontoON M5V 2J1T: 416 598 4750F: 416 598 9754Aberdeen MallBrentwood Town CentreCoquitlam Centre Guildford Town CentreLougheed Town CentreMayfair Shopping CentreMetropolis at MetrotownOakridge CentreOrchard Park Shopping CentrePark Royal Shopping CentreRichmond CentreRoyal City CentreSeven Oaks Shopping Centre(1) Subject to approved credit. Android is a trademark of Google Inc. Use of this trademark is subject to Google Permissions. BlackBerry, RIM, Research In Motion and related trademarks, names and logos are the property of Research In Motion Limited and are registered and/or used in the U.S. and countries around the world. Samsung Galaxy AceBlackBerry CurveTM 3G Select smartphones from $0 on the Tab.1 This sale is loco.Offer endsMarch 29, 2012.TVB121008T2_11_Victoria_5_6Pubs.indd 1 12-03-09 9:33 AMProcess CyanProcess MagentaProcess YellowProcess BlackCamosun WestsideBookmark my Website: www.realestatesooke.comVisit my website:realestatesooke.comCall ELLEN 818-6441For a FREE, NO OBLIGATION,MARKET EVALUATION OF YOUR HOME!OPEN HOUSE SUNDAY, MARCH 18th 1-4 PM!A Truly Unique, Protected, Alcove only min. to Victoria, BEAUTIFUL CUSTOM HOME, GARDEN, PEBBLE BEACH, SEA WALL. Convert Walk Out Main Level to Large, Bright Suite for Extra Income or Family. True European Workmanship! Granite Kitchen with Bay Window, Fabulous Decks on 2 levels. Spacious Liv/Din.Rms, Marble Gas FP & Red Ash Hardwood Floors. Master has Opulent En suite of Marble, Tile & Porcelain. Lots of Space for Hobbies, Workshop, Storage, B&B /Vac.Home. Call me to show you! 100K below assessed value! $798K.{x ,"U ",Ux-/",-E-,6-WINNERS / HOMESENSEUFAIRWAY MARKETUCINEPLEXUBEST BUYUTHE BRICKUSHOPPERSUMARKSMore tracks than ever,`ii*>ii}}i>VxqnVii`i`i>`> i>>L}i>` >i}v`>i}i] iiViiV2nd Annual Sooke Halibut Festival & Derby March 24th & 25th, 2012 @ Jocks Dock Derby $60 per person TICKETS @ EAGLE-EYE AND THE CRAB SHACKMORE INFO CALL Al 250-642-3410 Elden 250-642-4410 Steve 250-686-0738A16 COMMUNITY www.sookenewsmirror.com WEDNESDAY, MARCH 14, 2012 - SOOKE NEWS MIRRORMeg Energy5x10Flyerland2x52012x42162x5Pirjo Raits photoVisible generositySooke Food Bank volunteer Carol Harding shows off just some of the many non-perishable food donations which came in after a short call out in last weeks Sooke News Mirror. Linda Nex, a volunteer with the Contact Loan Cupboard, an organization that suppliespeople with medical equipment, says they are having a hard time getting items returned. She said many times an older persons family may not realize that the equipment they were using came from the Contact Loan Cupboard. If you have a piece of medical equipment no longer needed please call 250-389-4607, leave a message and a volunteer will retreive it.Contracts SpecialistLocation: Edmonton AreaRegulatory EngineerLocation: Calgary, ABNOW HIRINGfor exciting careers in engineering, operations, construction, supply chain management and more. Contracts Lead, Phase 3A, ProjectsLocation: Calgary, ABConstruction Engineer, ProjectsLocation: Calgary, ABVisit www.megenergy.com to apply today. We asked our employeesReason #28Nothing beats being a part of a strong team.Our success has been a team effort on every level. When you are a part of the MEG team you feel valued and that your input is heard and welcomed.STARTA CAREER AT?WhyVisit our other Black Press sites STORESSTORES FLYERS DEALS COUPONS BROCHURESFLYERS DEALS COUPONS BROCHURESCATALOGUES CONTESTS PRODUCTS STORES FLYERSDEALS COUPONS BROCHURES CATALOGUES CONTESTSPROPROPPPPPPROPROPROPROPROPROPPPPPROPROPRPPPPPROPROPPPPPPPPPPPPPPPPPPPPPPPPPPROOPPPPPPPRPPPPPPPPPPPRPPPPPPPPPPP DUCDUCDUDUCDUCUCUUDUCDUCCCCCCCCUCDUCUUUUUCCCCDUCUUUDUCCCDUUUUCUUUUUCUUUUUCUUUCCUCUCUCUUUCUUUUCUUDUDUUUUCUUUUUUUCTTTSTS TS TS TS STTSTTSTTTTTTTTTS TTTTTTTTTTTTSS STOSTOSTOSTOSTOTTOTOSTOSTTTOTTTOOOOSTOSTOSTOSTTTTSTTSTSTOSTOSTOSTOSTOTTSTTSTOOTTTTTOTTSTSTOSTTTOSTTTOTOTTOSS RESRESRESRESRERESRESRESSRESRESRESRESSRESRESRESRESRESRESSSSSRESRESRESRESRESESRESRESSRESRESSS FLYFL ERSRS DEDEALSALSALSALSALSALSALSALSALSALSAAALSALSALLSLSALSALSALSALSALSALSALSSSALALSLSLSAAALSALSSSLSA CO UUPPPOPOPOPOOPPOOOOPOPOOPOOPPPOPOPPPPOPOPOPOOPPOOPPPPOP NSNSSSBROBBBBBBRBROBRORORROROBROBROBROBROBBBBBROBROBBBBBROBBBBBROBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB OBROBBBBBBBBBB CHUCHUCHCHUCHUCCCCHCCHHHCHCHUCHUHHCHUCHUCCHCHHHHCHHHHCHHHHHCCHHHHHHHCCCHHHHCCCHHHHHCHHHUHCHCHCHHCHHCCHHHCHCHHHHHHHH RRRRRRRERRESREERERESSSSSSSSSSSSSRESRRRRESR SSSR SSSRESRRRRRRRRRESSSSSSRRR SRR SSSSRR SSR SRRRR SSSR SSSSRR SSR SSSR SSRRRRRESRRR CA CACA CA CACA CA CACACACAC CACACACACACACACACA CA CA CA CA CA CAAAA CACA CACACACACA CACA CACACACAACAAACACACACACACACACA CAACACACACAACAACACACCCAACAACCCCCCC TTTTTTALAAAATTATTTTAAATATTATT OGUOGUOGUOGUGUGUGUGUGUGUGUGGGUGUUGUGUOGUGUGUGUUGUGUOGUGGUGUUUGGUGUGUUUGUUUUGUUGGUUUGUUUES ESES ES ESESESES ES ESESESESESESESESES ESEESES ES ESEEEESSEEESEEEESEEESESEESEEESEE CONCONCONCONCONCONCCONCONCONCONCONCONOONONOCONOONCONCONCONCONCONCONCONCONONCOCONCONCOCONCONCONCONCONCONCONOONONCCCOCOC NC NCONCCCO TESTETESTESTESTESTESTESTESTESTESTESTESESTESSTESESTESTESESESEESTETESTESESTESTESTESESTEST SESTESTTESETTESTEETESSEEEESEEEE TSTSTSTSTTSTTSTSTSTSTTTSTTTTSTTSTTTSTTSTSTTTSTTSTTTS PR PR PRPR PRPRPRPRPRPRPPRPR PRPRPRPRRPRPRPRPRPPRPRPRPRPRPRPRPRRPRPRP PRPRPRPRPPRPPRPRP PR PRRRRRRRRROOOODOOODUODODUODODUODUODUODUODUODUODUODUODUUODUOODUODUODUOODDUODUOODUODODUOODDODUUODUODUODUODUOODUDUODODUODODODODUDUUUODUDUDUUO UOO UCTCTCTSCTSCTSCTSCTSCTTCTCTSCTSCTSCTCTSTSCTSCTCTCCTSCTCTTTCTSCCTTTTTTCTTTCCCTTCCSTSTOSTOSSSSSSTOOTOSSTSSSSSTOSTOSSSSSTOSSSSTOSSSSSSSSTOSSSSSSSSS OSSSTSSSSSSSTSSSSSSTSSSSSSS RESRRESRESRESRESRESESRESRESESESESSRESRESEESSEESSRESREESSEESESSSSEESEREEESSSSSSSEESEEESEEESEEESEEEES FFFFFFFLYFLYFLFLYFLYFFLYFLYLYYYYLYFFFLYFLYLYYFLYLYLYFLYLLYFLYFLYFLYFLYLYFLYYYFFLYLYLYFLYFLYLFFFFFLLYLYFLLYFLYYFFLYLYYFLYLYFF YFFLYLYYFFLYL EREERERSERSERSEREREREREERERERERERERERSEREERERSSSEERERSEREREREREREEERRREEREREERRRSEREERSEEERSEEEERRERER DEDEDEDEDEDEDEDEDEDEDEDEDEDEDEEDEDEDEDEDDEDEDEEDEDEDDDDEDEDDEEDDDDEDEALSAALSALSALSALSALSSSALSALSALSSALSSSSSSSSSSSSALSSSSSSSSALSALSSSSALS COOCO CO COCOCOCOCOCOCOCOCOCOCOCOCO COCOCCCOCCOCOOCOOCCOCOCOCCCOCCOUPOUPOUPOUPOUPOUPOUU OOUPOUPOUPOOOOUPOOUUU OOOONSNSNNNS SNS SSSSNSNSSNSNNNNS S BROBROBROBROBBROBROBROBROBROROBROBROBROBROBROBROBROBROBROBROBROBROOBROBROOOBROBBROOBBBBRRRROOOCHUCHUCHUCCHUCHUCHUCHUCHUCCHUCHUCHUCHUCHUCHUCHUCHUCHUCCCCHUCHUHUCHUUUCHUUCHUCHUUCHCHUC UCHURERRERERERRERERESRESRESRESRERESRERERERERRESREEEERERREEECCCCATCATCATCATACATTATCATCCCCCATCATCCCCCCCCCCCCCCCATCCCCCCCC TCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC ALOALOALOALOOLOLOOOALOALOOALOALOLOLLOOOOOALOLOOOOALOLOLOOLOLOOOALOALOOOOOLOOOOOOOOOOOOOOLOOLOOOOOOOOGGUGUGUGUUUUUUUUUEUUUEUEEUUUUUEGUUUUEUUUUUEEEUEGUGUUUUUEUGGUUUUEUEEEUEES CS SS CS CS S CS CS CS CSSSS CSS S CS CS SSSSS CS ONONTOOOOOOOOO ESTTSTSS PRP ODUDUCTSCTSCTSSSSSSSS S SS S STST STSTSTTTSTSSTTTSTSTTTTSTSTSTTTTTTTTTTTTTTTOREOREOREOREOREEREOREOREREOREOREREREREOREOREOREOREREEEEOREOREORERREEEEREORERRERREREREEEREREEOREOREOREREREOROOREREEEOREOREREREERRERREOREOREOREOREOREOROREOROREOREOROREREEREEEEOREOREORREREREERO ESSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS FLYFLYFLYFLYFLYFLYFLYFLYFLYFLYFLYFLYLYFLYFFLYFLYFLYFLYFLYFLYYFLYFLYL ERSERSERSERSERSSEERERERERERERERSERSRERSERSERERSERERERSERERSERERDEADEDEDDDDDDDDDEADDDDDDDDDEDDDDDDDEADDDDDDDDDDDEDDDDDDDDDDDDDDDDDDDDDDDD OOOOOOOOOOOOOOOOOOOOOOOOOOOONNSNSNSBROBROBRBRRROBROOBB OBRRBBBBBROBBBBRBROROBROOBBB CCCCCCTSCCCCCCCCCCTSCCCCCCCCCCCCCCCCCCCCSTOSTSTSTSTOSTOSTSTOSTOSSSSSSSSSSSSSSSSSSSSSSSSSSSSS RESRESRRRRRRRRRRRRRRRRRRCATCATCATATATCCCATCATCATCCAT YYYERSEEEEEEEEEEEERSEEEEEERSEEEERSERSEESave time, save money.Click it, Share it, Shop ithomedepot.ca/dreambookVisit our facebook page at http://www.facebook.com/yerland.ca AAAALSLSLSLSLSSLSLSLS SSSSSS SSSSS SSSSSSSSSS S SSSSSSSSSSSSSSS COCCOCCCCOCOCOCOCOUCOCOCOUOUOUCOUOUCOCOCCOCOOOCCCCOOCCCOCOCCOOO PPPONPONPONONSS SS SS TORTORESES FLYYF ERSERERSRSRRRSRRRRRRRRRSRRRSRSRRRSRSRRRRRRRRRRSRS DEDEDEDEDEDDEDEDEDE D DDEDE DEALAALALALALSLSALSALSSLSALALLLALAALAAALSALSALSAALSSS COCOCCOCCCCCCCOOOOCCCCCOOCCCCCCCCCCCOOCOCCCCCCOOOOO COOOOOCOOUPOUPOUPOOOOUPOPOUPOUUPOPOUU OOOOOOOOOOOOOOOOOOOOOOCCCCCCCCC UUUUUUUUUUUUUUUUOOOOOOOORRRRRR UUTTTTTAAAAAAAA YYYCHUCCHUHHUCHUHUHUHHHHHUUUHUCHUUUHUHHUHUHUUUHUHHHUHUHUUUHUUCHUUHUHUUCHUHUCHUHUHUUCCCCHHHHUHUHHUUCHHUCHHHURRRRRRRESRRRRESRESSSSRRRRRESRRERESRESRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR PRPRPRPR PRPR ODDUDUODDODUODUODUDUDUDUDUDUDUDURESRESESESRESESESSSRESESEESSRESEESESESESESEESEESREESEESEEEEEESEESESEEEEEESEEES FLFLFLLYLYLYYYLY BROBROBRBRBRBROBRBBBRBRBRBBRBBBROBRBRBROBROBROBROROBROBROBROBRBBBROOCCCCCCCCHUCCCCCCCCCCCCCCCHALOALOOOOOOOLOOOALOLOALOLOOOOOLOOOOOOALOOLOGUUUUEEEUEGUUUEEUGUEEGUUESSSSSS S SSS CS C TTONTONTESTESTESTESTESTESTES SS FFFFLFLYFFFFFFLYFFFFFFFFFFFDEADEADEAAAAADEADEAALSLSSSSSSSSSLSSSSSSSSSSSLSLS SLS LLSLSLSLS COUCCOUCOUCCCOUCOUCOUCOUCCOUCOUCOUC UUUUC UUCOUCOUCCCOUUUC UUC UUPONPONPPPPPPPPPPPONPONP S BS BS BROCROCROCROCHURURURURUURURURURUURURHURRURURRRRRRHURRHURURURURURUURRRRRRUUU ESESESESESESESSEESEEEESEEEESSSESESEESESESSSSES EES ESS ES CATATCATCATCATCATCATCC ALOALOALOAALOOALOALOGUGUGUGUGUGUGUUGUUCCCONONONYNTNTNTNTEEEEEEEESESESTTTTTTSSSSYTTSSSSSAACATTTTTALALTALTTTALOGUOGUOGUOGUUUUUUESESESES E COOOONOONONONONNNONONONONONONNNONNONONNCONOONCOONOOO TETESTESSETESSTESTESSSSTESTTESSSEST STSTSTSTSTSTSTSTSSTSRSSRS COCOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOUUUUUUUUUPUPPUPUUUUPUUUPPUUUPPUUUOOOOOOOOOEEESSTSTSSTTTEEEOOOALALALALDDDDDDDDDDDDDDDDDDDDDCCACACACACACATTTTTTTTTERSERSERSERSERSERSRSRSRSSC NNNNONCACACAAACACACAAACACACACACACACAACAAAACACACACACACACAACAAAACACACAAACACACACACACACAACAAAACACACACACACACAACAAAACACACAAACACACAAACACACACACACACAACAAAACACACACACACACAACAAAACACACAAACACACAAACACACACACACACAACAAAACACACACACACACAACAAAAYERSERSRSRSSYERSERSRSRSSYYERSERSERSERSRSSRRSSYYERSERSERSERSRSSRRSSYERSERSRSRSSYYERSERSERSERSRSSRRSSYYERSERSERSERSRSSRRSSYERSERSRSRSSYERSERSRSRSSYYERSERSERSERSRSSRRSSYYERSERSERSERSRSSRRSSYERSERSRSRSSYERSERSRSRSSYYERSERSERSERSRSSRRSSYYERSERSERSERSRSSRRSSCCCCONONONONCCCCONONONONCCCCCCCCCCONONONONONCCCCCCCCCCONONONONONCCCCONONONONCCCCCCCCCCONONONONONCCCCCCCCCCONONONONONCCCCONONONONCCCCONONONONCCCCCCCCCCONONONONONCCCCCCCCCCONONONONONCCCCONONONONCCCCONONONONCCCCCCCCCCONONONONONCCCCCCCCCCONONONONONTALOSS DDDDDDDNNNNTTNTTTTEEEESESESESSSDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDNTNTTNTNTTTESESESESESSSNTNTTNTNTTTESESESESESSSNNNTTNTTTESEEEESESESESESSSSNNNTTNTTTESEEEESESESESESSSSNTNTTNTNTTTESESESESESSSNNNTTNTTTESEEEESESESESESSSSNNNTTNTTTESEEEESESESESESSSSNTNTTNTNTTTESESESESESSSNTNTTNTNTTTESESESESESSSNNNTTNTTTESEEEESESESESESSSSNNNTTNTTTESEEEESESESESESSSSNTNTTNTNTTTESESESESESSSNTNTTNTNTTTESESESESESSSNNNTTNTTTESEEEESESESESESSSSNNNTTNTTTESEEEESESESESESSSSOGUUUUDEDEDEDEDEDED LALALALALALAAAASTTTTTTSSSSSSSSSGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEAAAAEAAAAEEEEAAAAEEEEAAAAEAAAAEEEEAAAAEEEEAAAAEAAAAEAAAAEEEEAAAAEEEEAAAAEAAAAEAAAAEEEEAAAAEEEEAAAATTTSSSSSSSTTTSSSSSSSTTTTTTSSSSSSSSSSSSSSSTTTTTTSSSSSSSSSSSSSSSTTTSSSSSSSTTTTTTSSSSSSSSSSSSSSSTTTTTTSSSSSSSSSSSSSSSTTTSSSSSSSTTTSSSSSSSTTTTTTSSSSSSSSSSSSSSSTTTTTTSSSSSSSSSSSSSSSTTTSSSSSSSTTTSSSSSSSTTTTTTSSSSSSSSSSSSSSSTTTTTTSSSSSSSSSSSSSSSES LLLL LS LS LLLLSLSLSLSLSLSLSL LLLLSLSLSLSLSLSLSL LS LLLLSLSLSLSLSLSLSL LLLLSLSLSLSLSLSLSL LS LS LLLLSLSLSLSLSLSLSL LLLLSLSLSLSLSLSLSL LS LS LLLLSLSLSLSLSLSLSL LLLLSLSLSLSLSLSLSL SCOOOOCOCOCOCOCOCOCCOCOCNTESEEEUPOUPOUPOUPOUPOUPOUPOOOSSSSSSTSTSOOOONONNS NS NSNSNNS NS NSNSNNNNNNS NSNSNSNNNNNNNNS NSNSNSNNNNS NS NSNSNNNNNNS NSNSNSNNNNNNNNS NSNSNSNNNNS NS NSNSNNS NS NSNSNNNNNNS NSNSNSNNNNNNNNS NSNSNSNNNNS NS NSNSNNS NS NSNSNNNNNNS NSNSNSNNNNNNNNS NSNSNSNNNCACACACACACAATTTTTTACAAACAAACATTTTCACACACAAATTTTTTACAAACAAACATTTTYERSERSERSERSRSRSRSSYYERSSSERSRSRSSSYERSERSRSRSRSRSSYYERSSSERSRSRSSSCCCC NNONONONCCCC NNNNONONCCCC NNONONONCCCC NNNNONONDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDNNNTNTTNTTTTEEESESESEESSSSNNNNTTNTTTEEEEEEEESESEEESESESSSSSNNNTNTTNTTTEEESESESESSSNNNNTTNTTTEEEEEEEESESEEESESESSSSSGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEEEALALALAAAEEEEEEEEAAAAEAAAAAAEEEEEEEEAAAATTTTTTSSSSSSSSSSTTTTTTTTTSSSSSSSSSSSSSSSSSTTTTTSSSSSSSSSTTTTTTTTTSSSSSSSSSSSSSSSSSLS LLLLLLLLLLLS LLLLLLLLLLSSSSSSSSSSSSSSSSSSSSSSSSTEETEETTTTTETETETETETTTTEETETETETEEETTTTTTTETETETETETTTTEETETETETEEETTTEETTTTTETETETETETTTTEETETETETEEETTTTTTTETETETETETTTTEETETETETEEETTTEETEETTTTTETETETETETTTTEETETETETEEETTTTTTTETETETETETTTTEETETETETEEETTTEETEETTTTTETETETETETTTTEETETETETEEETTTTTTTETETETETETTTTEETETETETEEETTPOOOOPOOOOPOPOPOOPPPOOPOPOPOOPPPOOPOOOOPOPOPOOPPPOOPOPOPOOPPPOOPOOOOPOOOOPOPOPOOPPPOOPOPOPOOPPPOOPOOOOPOOOOPOPOPOOPPPOOPOPOPOOPPPOOCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCOCOCOCOOOOCCCCCCCOCOOOOCCCCCOCOCOOOCCCCCCCOCOOOOCTEEETTTTETETETETETETETETEETETEEEETETEETTTTETETETETETETETETEETETEEEETEPOPOPOOOOPPPOOOOOPPPOOPPOOOOOPPPOOOOOPPPOOP SSSSS SSNSNSNSNSSSSNNNNNNNNNNNNNNNNSNS NSNSNSNSNSSNS NSNNSNSSNS NSNSNSNSSNS NSNNSNSwww.melindabrake.com 250-642-6480Majestic MetchosinThis well maintained 4 bedroom home is located on a tranquil 5 acres in Metchosin. Excellent for a hobby farm or just to enjoy as your own private park setting. Call today to arrange a private viewing.$449,900Brendan Herlihy Time for a move?DEMAMIEL CREEK ESTATES CUSTOMON 2 USEABLE ACRES WITH 3 CAR GARAGEQuality built 2008 custom home situated on private2 acreage backing onto Butler Main, perfect for theoffroad enthusiast. The home has over 3000 sq ft.of living space, with 5 beds/3baths. The main oorfeatures open concept kitchen/dining area withisland/breakfast bar & hardwood oors. The lowerhas 2 more beds, huge rec room with woodstove &is easily suitable. Heat pump, hot tub, Quality waterwith reverse osmosis system. Massive 3 bay garagewith 12 ft. ceilings, A must see!MLS # 303492 $676,900www.outwestbc.com250 642-3240www.outwestbc.com2nd Annual Sooke Halibut Festival & Derby March 24th & 25th, 2012 @ Jocks Dock Derby $60 per person TICKETS @ EAGLE-EYE AND THE CRAB SHACKMORE INFO CALL Al 250-642-3410 Elden 250-642-4410 Steve 250-686-0738Though newcomers arriving in Sooke by seain the late 1800s were largely Scottish, there was also a good show-ing of Brits, possiblysecond and third sons of the British gentry.Schoolmates seeking a new life in a new world,in 1883 five bachelors put up a cabin in EastSooke on what is now Seagirt Road. Joseph and Jack Dales, Arthur Floyer and two GordonBrothers, Ted and Jack, sons of the Dean of Lin-coln Cathedral, congre-gated there. With theirEnglish accents and manners, it wasnt longbefore their home was called BuckinghamPalace. The fellows nailed animal skins onthe walls and began planting fruit trees onthe sunny hillside.When they werent called by domestic chores, however, they would head across the harbour to visit folk on the west side. After John and Tom Murrayarrived in 1886, rowing across to the wharf atthe foot of Murray Road was a favourite.West of the Mur-rays the Muirs heldthe land, with the Muir shipbuilding yard andthe Muir steam sawmill the prominent sites.Further west, at what we know today as Gor-dons Beach, the enter-prising Ted Gordonpurchased the broad hillside farm that had been cut from the wil-derness by Thomas Tugwell. Joining him as partner was Arthur Floyer, and the two partnered again later inoperating a horse stage to Victoria.In 1889 Ted Gordon journeyed back toEngland to marry his childhood sweetheart,Kitty Jalland, daugh-ter of a London physi-cian. Kitty was to play a large role in the sociallife of the Sooke and Otter Point communi-ties for half a century. Jack Gordon found hisbride close by, wooing Matilda, one of the five daughters of Michael Muir of Burnside.He and Matilda worked the farm at Burnside, and had two children, Aliceand Harry. It was after Jack Gordon had beenlost to consumption that Matilda, Alice andHarry moved into Moss Cottage (it was moved,much later, to the museum).The East Sooke cabin, meanwhile, had lost itsidentity as Buckingham Palace and been consid-erably enlarged. Held for years by a seriesof owners, in 1934 it was purchased by Rayand Grace Horgan, and turned into the resort of Seagirt pictured as it looked in 1940.Elida PeersHistorian, SookeRegion MuseumSOOKE NEWS MIRROR - WEDNESDAY, MARCH 14, 2012 www.sookenewsmirror.com COMMUNITY A17Social Aborigi-nal2x7Fabricland3x7.251442x61012x8BC Treaty2x3Buckingham Palace a.k.a SeagirtBCS LEGAL AID provider has special services aimed at helping Aboriginal people and their families. Have you been charged with a criminal toffence?Do you have child protection or family issues?tDo you have questions about the Indian tResidential Schools Settlement Agreement, wills and estates, or Aboriginal hunting and fishing rights?Do you want information about your Gladue trights and First Nations Court?Aboriginal people have unique legal rights, and help is available to understand and claim these rights. Advocates, legal representation, clinics, and advice are available to you both on and off reserve.For more information, see www.legalaid.bc.ca/aboriginal.Are You Aboriginal and in Need of Legal Aid?Legal aid in BC is provided by the Legal Services Society (LSS). LSS is committed to increasing awareness of Aboriginal legal rights and supporting the strengths of Aboriginal cultures and communities.1-866-577-2525 Store Hours: Mon.-Fri. 9:30am - 9:00 pm Sat. 9:30 am - 5:30 pm Sun. 11:00 am - 5:00 pmVICTORIANEW LOCATION: 3170 TILLICUM RD. LOWER LEVEL OUTSIDE OF TILLICUM CENTRE -