sensitivity of botrytis cinerea to succinate dehydrogenase ... · sensitivity of botrytis cinerea...
TRANSCRIPT
SENSITIVITY OF BOTRYTIS CINEREA TO SUCCINATE DEHYDROGENASE INHIBITOR (SDHI) FUNGICIDES AND TO HEAT TREATMENTS
By
ADRIAN ISRAEL ZUNIGA PINTO
A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE
UNIVERSITY OF FLORIDA
2018
© 2018 Adrian Israel Zuniga Pinto
To my parents, my brother, and my sister
4
ACKNOWLEDGMENTS
“For I know the plans I have for you, says the Lord, plans for welfare and not for
evil, to give you a future and a hope” (Jeremiah 29:11). I would like to thank God, my
lord almighty, who in each step I give in life is there giving me strength to overcome the
hardest times and to achieve the purpose he has for me in this world.
I am truly grateful for my advisor Dr. Natalia Peres, who believed in my
capabilities and offered me the opportunity to pursue my next goal in life. I sincerely
thank her and my committee members, Dr. Gary Vallad and Dr. Philip F. Harmon for
their teaching and guidance during the development of this project. I thank the
Strawberry Pathology lab members at the Gulf Coast Research and Education Center
for their help with field and lab experiments, especially Carolina Suguinoshita Rebello. A
special thanks to my cousin Kimberly Muriel and my friends Cody and Mark, whose
support through this journey made it easier. Most importantly, I thank my parents and
my family for their unconditional love and support throughout the years, without them I
would not be the person I am now. I have come a long way and still have a lot to go
through but I am proud to say this work represents the willingness, discipline, and hard
work needed to fulfill a dream.
5
TABLE OF CONTENTS page
ACKNOWLEDGMENTS .................................................................................................. 4
LIST OF TABLES ............................................................................................................ 7
LIST OF FIGURES .......................................................................................................... 8
ABSTRACT ................................................................................................................... 10
CHAPTER
1 LITERATURE REVIEW .......................................................................................... 12
Strawberry Taxonomy and Production .................................................................... 12 Strawberry Nurseries .............................................................................................. 16 Botrytis cinerea on Strawberry ................................................................................ 20
Life Cycle and Epidemiology ............................................................................ 21 Symptoms and Signs ....................................................................................... 24
Disease Control ...................................................................................................... 24 Cultural and Biological Control ......................................................................... 25
Chemical Control .............................................................................................. 27
Fungicide Resistance.............................................................................................. 28
Objectives ............................................................................................................... 32
2 BASELINE SENSITIVITY OF BOTRYTIS CINEREA ISOLATES AND PHENOTYPIC CHARACTERIZATION OF SdhB MUTATIONS TO ISOFETAMID, AND MONITORING OF SDHI SENSITIVITY ON STRAWBERRY . 37
Introduction ............................................................................................................. 37
Materials and Methods............................................................................................ 39 Fungal Isolates ................................................................................................. 39 Fungicide Sensitivity Test ................................................................................. 41
Mycelial growth inhibition assay ................................................................. 41
Calculation of EC50 values ......................................................................... 43
Conidial germination inhibition assay ......................................................... 44 Molecular Characterization of Mutations Conferring Resistance to
Isofetamid ...................................................................................................... 45 Results .................................................................................................................... 46
Fungicide Sensitivity Test ................................................................................. 46 Baseline sensitivity of B. cinerea field isolates to isofetamid ...................... 46 Characterization of SdhB mutations in B. cinerea isolates to isofetamid ... 47
Sensitivity and cross-resistance evaluation between five SDHI fungicides in B. cinerea isolates .............................................................. 48
SdhB Mutation Found on B. cinerea Isolates ................................................... 50
Discussion .............................................................................................................. 50
6
3 HEAT TREATMENT AS A POSSIBLE MEANS TO REDUCE BOTRYTIS CINEREA RESISTANT POPULATIONS ON STRAWBERRY TRANSPLANTS ..... 72
Introduction ............................................................................................................. 72 Materials and methods............................................................................................ 74
Fungal Isolates ................................................................................................. 74 Fungicide Sensitivity Test ................................................................................. 75 Heat Treatment in Vitro .................................................................................... 76
Effect of heat treatments on B. cinerea conidial survival ............................ 76
Effect of heat treatments on B. cinerea sclerotial survival .......................... 77
Heat Treatment in Vivo ..................................................................................... 78 Effect of heat treatment on strawberry transplants ..................................... 78 Detached leaf assay for colonization of B. cinerea .................................... 79
Results .................................................................................................................... 80 Phenotypic Characterization of Isolates ........................................................... 80
Heat Treatment in Vitro .................................................................................... 81 Effect of heat treatments on B. cinerea conidial survival ............................ 81
Effect of heat treatments on B. cinerea sclerotial survival .......................... 81
Heat Treatment in Vivo ..................................................................................... 82 Effect of heat treatment of strawberry transplants ...................................... 82 Detached leaf assay for colonization of B. cinerea .................................... 83
Discussion .............................................................................................................. 84
4 CONCLUSIONS ..................................................................................................... 99
LIST OF REFERENCES ............................................................................................. 101
BIOGRAPHICAL SKETCH .......................................................................................... 114
7
LIST OF TABLES
Table page 2-1 Botrytis cinerea isolate used for isofetamid baseline sensitivity ......................... 58
2-2 Phenotypic characterization of succinate dehydrogenase subunit B (SdhB) mutations to isofetamid ....................................................................................... 59
2-3 Botrytis cinerea isolates used for the monitoring of fungicide resistance ............ 60
2-4 Determination of phenotypes based on conidial germination of Botrytis cinerea isolates to succinate dehydrogenase inhibitors (SDHI) fungicides ......... 63
2-5 Resistance frequency to five fungicides on Botrytis cinerea isolates from nurseries and Florida strawberry fields ............................................................... 66
2-6 Number of Botrytis cinerea isolates collected from different nurseries and Florida fields showing single and multi-fungicide resistance .............................. 71
3-1 Characterization of resistance phenotypes of Botrytis cinerea isolates based on conidial germination assays........................................................................... 88
3-2 Phenotypic characterization of isolates used in this study .................................. 92
3-3 Analysis of variance of Botrytis cinerea conidial survival after heat treatment .... 93
3-4 Analysis of variance of Botrytis cinerea sclerotial survival after heat treatment .. 94
3-5 Strawberry yield in field experiment during 2016-2017 strawberry season after heat treatment of plants inoculated or not with Botrytis cinerea ................. 96
8
LIST OF FIGURES
Figure page 1-1 Production of runners from strawberry mother plant ........................................... 34
1-2 Botrytis cinerea life cycle on strawberry ............................................................. 34
1-3 Infected fruit serving as secondary inoculum source for adjacent fruit and flowers ................................................................................................................ 35
1-4 Botrytis cinerea blossom-end-rot symptoms on green strawberry and a developing lesion on stem .................................................................................. 35
1-5 Mummified strawberry fruit ................................................................................. 36
2-1 Incubation of strawberry leaves over wave-shaped chicken wire inside plastic boxes for isolation of Botrytis cinerea ................................................................. 61
2-2 Evaluation of Botrytis cinerea infection on strawberry leaves. Examination of conidiophores and conidia of B. cinerea using a stereomicroscope (14x) .......... 61
2-3 Spiral gradient dilution method setup for mycelium-covered agar strips ............. 62
2-4 Petri dish plate (15-cm diameter) containing yeast bacto acetate agar (YBA) medium divided into 30 rectangles for conidial germination assay ..................... 62
2-5 Rating of germ tube elongation on germinated Botrytis cinerea conidia ............. 63
2-6 Frequency distribution of effective concentration at which mycelial growth was inhibited by 50% (EC50) for 70 Botrytis cinerea baseline isolates to isofetamid ........................................................................................................... 64
2-7 Frequency of resistant Botrytis cinerea isolates collected during 2015-2016 strawberry season to five succinate dehydrogenase inhibitors (SDHI) fungicides ........................................................................................................... 65
2-8 Frequency of resistant Botrytis cinerea isolates collected during 2016-2017 strawberry season to five succinate dehydrogenase inhibitors SDHI fungicides ........................................................................................................... 67
2-9 Frequency levels of resistant isolates collected from nurseries and Florida fields during 2015-2016 strawberry season ........................................................ 68
2-10 Frequency levels of resistant isolates collected from nurseries and Florida fields during 2016-2017 strawberry season ........................................................ 69
9
2-11 Frequency of multi-fungicide resistance (MFR) to five succinate dehydrogenase inhibitors (SDHI) fungicides on Botrytis cinerea isolates collected during two strawberry seasons ............................................................ 70
3-1 Germinated Botrytis cinerea conidia and the corresponding rating for germ tube elongation ................................................................................................... 88
3-2 Isotemp Digital-Control Water Baths (Model 210) used to heat treat Botrytis cinerea conidia and sclerotia .............................................................................. 89
3-3 Styrofoam floating racks used for heat treatment experiments of Botrytis cinerea conidia and sclerotia .............................................................................. 89
3-4 Survival evaluation of Botrytis cinerea conidial germination under the microscope (100x) after heat treatments ............................................................ 90
3-5 Survival evaluation of Botrytis cinerea sclerotial germination after heat treatments........................................................................................................... 90
3-6 Adapted steam chamber used for the heat treatments of strawberry transplants .......................................................................................................... 91
3-7 Incubation of strawberry leaves for the evaluation of heat treatment effect on Botrytis cinerea ................................................................................................... 91
3-8 Evaluation of Botrytis cinerea infection on strawberry leaves ............................. 92
3-9 Percentage of Botrytis cinerea conidial germination from isolates 05-26, 10-37, 12-201, and 15-350 after heat treatment ...................................................... 93
3-10 Percentage of Botrytis cinerea sclerotia germination of isolates with different resistance phenotypes in response to heat treatment ........................................ 95
3-11 Botrytis fruit rot (BFR) incidence in field experiment during the 2016-2017 strawberry season after heat treatment of non-inoculated and inoculated transplants .......................................................................................................... 96
3-12 Plant mortality (%) in a field experiment during 2016-2017 strawberry season after heat treatment of non-inoculated and inoculated transplants ..................... 97
3-13 Percentage of Botrytis cinerea colonization on strawberry plants....................... 97
3-14 Incidence of Botrytis cinerea on leaves collected from non-inoculated plants after heat treatment ............................................................................................ 98
3-15 Incidence of Botrytis cinerea on leaves collected from inoculated plants after heat treatment .................................................................................................... 98
10
Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science
SENSITIVITY OF BOTRYTIS CINEREA TO SUCCINATE DEHYDROGENASE
INHIBITOR (SDHI) FUNGICIDES AND TO HEAT TREATMENTS
By
Adrian Israel Zuniga Pinto
May 2018
Chair: Natalia A. Peres Major: Plant Pathology
Succinate dehydrogenase inhibitors (SDHIs) are the fungicides most commonly
used to control Botrytis fruit rot on commercial strawberry in Florida. The medium-to-
high risk for selection of resistance in the causal agent Botrytis cinerea is an important
threat to the efficacy of this group. In this study, we characterized the sensitivity of the
newer SDHI isofetamid to B. cinerea and the SdhB mutation linked to its resistance, and
monitored resistance to five SDHI fungicides (i.e. boscalid, penthiopyrad, fluopyram,
benzovindiflupyr, and isofetamid) for two consecutive seasons. Seventy baseline
isolates with no prior exposure to isofetamid had a mean of 0.098 µg/mL at which
mycelial growth was inhibited by 50% (EC50). Molecular characterization of isofetamid
resistant isolates showed only the substitution of asparagine by isoleucine at codon 230
and proline by phenylalanine at codon 225 conferred moderate and high resistance to
isofetamid, respectively. A total of 565 B. cinerea isolates collected during 2015-2016
from nurseries and Florida fields showed resistance frequencies of 95, 33, 21, 25, and
0% to boscalid, penthiopyrad, fluopyram, benzovindiflupyr, and isofetamid, respectively.
The respective resistance frequencies for 2016-2017 were 91, 95, 44, 27, and 1.3%. In
a separate study, we evaluated the efficacy of a heat treatment as a possible means to
11
reduce B. cinerea-resistant populations on strawberry transplants. Conidia and sclerotia
of four isolates with different resistance phenotypes were exposed to 44, 48, 52 and
56˚C for 1, 5, 10, 30, 60, 120 and 240 min. Germination of these propagules was
inhibited or reduced with a heat treatment of 44˚C for 4 h. Based on these results,
strawberry transplants were exposed to 44˚C for 2 and 4 h with and without a 37˚C for 1
h pre-heat treatment in field experiments. The incidence of B. cinerea was significantly
reduced at 44˚C for 4 h with or without pre-heat on non-inoculated and inoculated
plants. Our results showed isofetamid was efficacious against B. cinerea while
resistance frequencies increased for older SDHIs tested. We suggest that heat
treatment could be used as an alternative method for nurseries to manage resistant
populations of the B. cinerea on strawberry transplants.
12
CHAPTER 1 LITERATURE REVIEW
Strawberry Taxonomy and Production
Strawberry, genus Fragaria, belongs to the family Rosaceae and subfamily
Rosoideae (Hummer and Janick 2009). Approximately 24 species, wild and cultivated,
have been classified within the genus Fragaria, distributed around different climate
regions in North and South America, Europe, and Asia (DiMeglio et al. 2014; Staudt
1989). First reports of growing strawberries go back to the 1300s when France started
transplanting to their gardens Fragaria vesca, the wild species distributed worldwide
and commonly known as the wood strawberry (Hummer et al. 2011). F. vesca was
important for the study of the genus Fragaria and because of its characteristics, short
generation time, self-compatibility, broad temperature growing range, and vegetative
propagation advantages, it was used to test the gene function for plants within the
family Rosaceae (Shulaev et al. 2010). Despite the extensive cultivation history of F.
vesca, it was the accidental hybridization between Fragaria chiloensis, the beach
strawberry native from North and South America, and Fragaria virginiana, the Virginia
strawberry native from North America, that gave origin to Fragaria x ananassa Duch
(Hancock and Luby 1993; Hummer et al. 2011).
Fragaria x ananassa Duch originated in Europe after F. chiloensis was planted
next to F. virginiana in the mid-1700s to then become the popular cultivated strawberry
commercially grown in over 60 countries (DiMeglio et al. 2014; Finn et al. 1998).
Worldwide production of this popular strawberry species, also known as the dessert
strawberry, occurs predominately in the northern hemisphere with approximately 98%
but has great potential for expansion to the southern hemisphere (Hancock et al. 2008).
13
The average production of strawberry increased from 750 thousand tons in 1961 to 8.1
million tons produced in 2014, according to the latest report of FAOSTAT (2017). In
2014, approximately 48.9% of the total production took place in Asia with China being
the country with the largest production, 3.1 million tons (FAOSTAT 2017). After China,
the other major strawberry-producing countries are United States, Mexico, Turkey,
Spain, Egypt, Republic of Korea, Poland, Russian Federation, and Germany (FAOSTAT
2017).
Strawberry is grown in a wide range of environmental conditions across the world
with two major production systems, matted rows and hills. The matted-row system is
used mainly in places with short summers and cold winters in continental Europe and
North America (Hancock et al. 2008). This system consists of the establishment of
transplants during spring to grow runners, which yield the majority of fruit during the
summer and in this system, plants are used for several seasons (Fernandez et al.
2001). The main advantages of the matted-row production system are adaptability to
low temperatures, low input, and inexpensive establishment period (Black et al. 2002).
In contrast, hills or also called annual plasticulture production system uses only the
plant crown to produce fruit since all runners are removed (Hancock et al. 2008). In this
system, transplants are established in the fall and they produce fruit until the end of
spring, and the plants are killed or removed after each season (Fernandez et al. 2001).
The plasticulture system is used in Europe; Italy and Spain, and some states in the U.S.
such as California and Florida, places known for having warm winters with mild to hot
summers (Hancock et al. 2008). The major advantages of plasticulture are early yields,
14
efficient weed control, larger fruit, and it facilitates harvest due to the use of raised beds
(Black et al. 2002).
Cultivation of Fragaria x ananassa Duch in the United States started in the mid-
1800s, and since then, various cultivars used throughout the country have been
developed in different breeding programs (Hummer et al. 2011). In the past decade, the
U.S. had an increase in strawberry production from 1.1 million tons produced in 2007
(FAOSTAT 2017) to approximately 1.7 million tons of annual production during 2017
according to the USDA (2017a). California leads national production with approximately
90% of the strawberry harvested in the U.S. (Geisseler and Horwath 2014).
Florida is the second strawberry producer in the country and first in the southeast
region. In 2016, Florida was responsible for approximately 7% of the total strawberries
produced in the U.S. with 4,330 harvested hectares producing 122 thousand tons
valued in almost 450 million dollars (USDA 2017a).
The production system used in Florida is annual plasticulture and, as mentioned
above, this method uses new transplants each season. In the state, the majority of the
strawberry production takes place in Hillsborough County in Central Florida, specifically
the Plant City area. The main cultivars currently used for commercial production are
‘Florida Radiance’, ‘WinterstarTM’ (‘FL 05-107’), and ‘Sweet Sensation®’ (‘Florida127’).
Other minor cultivars used in the state are ‘Sweet Charlie’, ‘Strawberry Festival’, and
‘Florida Elyana’ (Whitaker et al. 2017).
Strawberry production in Florida starts with the preparation of the soil; the state is
known for having sandy soils as the dominant soil type used for production (Simonne
and Hochmuth 2005). Soil preparation involves the use of chemical products to
15
fumigate the soil before planting to control diseases caused by soilborne pathogens and
nematodes, and for weed control (Dittmar et al. 2017). Planting dates in Florida range
from September 15 to October 25 marking the beginning of the season, which ends in
April (Peres et al. 2006). Strawberry plants are transplanted into compacted raised beds
with dimensions of approximately 28-in. wide on 4-ft. centers covered with black
polyethylene plastic mulch. Two staggered rows of plants are spaced 15-in. apart in
each bed (Zuniga et al. 2017). After planting, daytime overhead irrigation for 10 to 14
days is very important for plant establishment (Zotarelli et al. 2017). Throughout the rest
of the season, drip irrigation is used to deliver water and fertilizers underneath the
plastic mulch (Grant et al. 2012; Zuniga et al. 2017). Florida is considered a sub-tropical
region (Li et al. 2010) and for that reason, freezing temperatures below 32˚F are not
very frequent. Frost protection during the season is managed with overhead irrigation
using sprinklers that deliver an approximate rate of 6.35 mm of water per hour (Zotarelli
et al. 2017).
The main type of transplants used for strawberry production in Florida consist of
bare-root, green-top plants that tolerate the high temperatures during the planting
months. The major disadvantage is the required amount of water the transplants need
during the establishment period, where as much as one-third of the season’s total
irrigation water or 508 mm may be used (Hochmuth et al. 2006b). Other types of
transplants such as containerized or plug transplants do not require as much water for
establishment. They are produced from runner tips with developed roots and are grown
in greenhouses but cost almost double compared to bare-root, green-top plants
(Hochmuth et al. 2006a). Plug transplants are available for Florida growers but because
16
of their price, they are mainly used to replace missing or dead bare-root green-top
transplants that did not survive the establishment period (Hochmuth et al. 2006b).
Considering that 16,000 to 22,000 plants are used per 0.4 hectares in Florida, the
establishment period represents an important cost of production in strawberry fields
(Whitaker et al. 2017). Once the growing stage is complete, the first ripe fruit are ready
for early harvest during December to January or 20 to 40 days after pollination.
However, the majority of the yield is produced during February and March (Li et al.
2010; Zotarelli et al. 2017). In 2016, Florida strawberry yield was 25,736.03 kg per
hectare according to USDA (2017a). The production costs in a strawberry field are
approximately 87,500 dollars per hectare but such investment is recovered with the high
market price of 205 dollars for each 50 kg of strawberry produced (Santos et al. 2012;
USDA 2017a).
Strawberry Nurseries
Strawberry transplants for fruit production are usually developed in nurseries.
Some of them depend on stock plants produced in California, which then are distributed
within the U.S. and overseas (Sjulin 2008). Until the 2000s, California nurseries were
responsible for the production of approximately 1 billion daughter plants per year with
60 million dollars in annual value (Larson and Shaw 2000) and some of these plants are
transported to the southeastern U.S. In Florida, strawberry growers obtain their
transplants mainly from southern Canada and some regions in the U.S. including
California and North Carolina (Torres-Quezada et al. 2015). Each year Florida
purchases approximately 140 million transplants with the majority of them originating
from Canada (Reekie et al. 2005). In the past, Florida produced its own transplants, but
that changed when it was discovered that the transplants need a chilling process to
17
initiate early flowering in the crown (Albregts et al. 1992). Therefore, the majority of the
strawberry plants used for commercial production in the U.S. are grown in Canadian
nurseries where they obtain this process (Martin and Tzanetakis 2013). Transplants
grown in Canada and used in Florida have higher concentrations of sugar in the crown
and carbohydrates in the roots, which increase the performance of the plants (Menzel
and Smith 2012).
The production of strawberry transplants depends on the location of the nursery.
Low-elevation nursery planting and harvesting seasons are from the middle of May and
from December to January, respectively (Strand 2008). These transplants are known as
frigos because of the freezing process at -2˚C during the 6 months before being used
for fruit production in commercial fields (Pertuzé et al. 2006). In high-elevation
nurseries, these seasons take place at the beginning of April and late September to the
middle of November. After being harvested, transplants are properly trimmed and
packaged for delivery to the respective fields using refrigerated trucks for transportation
(Strand 2008).
The two location types of nurseries use vegetative propagation to conserve
specific genetic traits of a developed cultivar. This is a multiyear process where a
portion of plants resulting from vegetative propagation serve as planting stock for the
following cycle (Larson and Shaw 2000; Strand 2008). Nursery production of transplants
starts with virus-free or meristem plants that represent the foundation plants. These are
also considered strawberry mother plants, and they produce horizontal stems from
axillary buds in the crown. Stems are commonly known as runners and they can
produce more than 100 daughter plants (Figure 1-1). Virus-free plants are obtained
18
through the heat treatment process of mother plants with runners at 35˚ to 37˚C for 21
to 28 days. Then, with the use of tissue culture technique, the meristems are removed
from daughter plants and transferred to nutrient medium. The meristems are small
pieces of buds with up to two leaf primordia and they are used because of their cell
division activity and absence of pathogen infection. The meristem plants are first grown
in mist chamber conditions to harden the tissue, and once this process is completed,
they are transferred to sterile soil and grown inside screen houses for multiplication.
Approximately 100 to 1500 daughter plants can be produced from each meristem
(Strand 2008). This will represent the first generation of daughter plants and usually
three additional generations of runners are produced in the nursery fields before
reaching the desired plant size for commercial fruit production (Gordon et al. 2002). In
the case of California nurseries, three or more additional field propagation cycles can
occur. Two or more cycles take place in low-elevation nurseries (<150 m) to induce
runner production, which is possible due to the weather conditions of this region, and
one last cycle occurs in high-elevation nurseries (>1000 m) where weather conditions
reduce runners production and increase plant vigor (Larson and Shaw 2000). Plant
vigor is important for strawberry transplants, because rapid root production greatly
impacts productivity as reported by Kirschbaum et al. (1998).
The Foundation Plant Services within the Strawberry Program at the University of
California is the only strawberry plant testing program in the U.S. that certifies virus-free
transplants for nursery propagation. They also test for a limited number of other
pathogens but only for mother plants to be used in the nurseries (Strand 2008). The
strawberry transplants imported into the U.S. go through an evaluation process by the
19
USDA Animal and Plant Health Inspection Service (APHIS) and Plant Protection and
Quarantine (PPQ), which evaluate the transplants for disease based on symptoms
(USDA 2017b).
The delivery of healthy strawberry plans to Florida growers is crucial for a
productive season. Transplants produced in nurseries have the risk of pathogen
infection due to the open field production system, making nursery transplants a direct
and primary pathogen transmission route to commercial fields (Mass 1998; Turechek
and Peres 2009). Even though nurseries have pest management programs focused on
viruses and nematodes, root, crown, and some foliar diseases, and pests including
mites and weeds (Strand 2008), this does not seem to be sufficient for the production of
pathogen-free transplants. Part of these programs often included pre-plant soil
fumigation to reduce the risk of infection by contact with soil-borne pathogens
(Carpenter et al. 2000; Larson and Shaw 2000). However, other factors like soil
persistence, alternative hosts, spore dispersal, and latent infection can play an
important role in pathogen infection and disease progress in strawberry plants
(Hokanson et al. 2004; Leandro et al. 2001).
One possible strategy to avoid pathogen infection in transplants is to reduce their
exposure to pests and pathogens through restricted production in greenhouses in a
controlled environment. This strategy would require large infrastructure space to contain
the enormous number of mother plants and significant hand labor for the processing of
daughter plants, resulting in a large investment and maintenance costs (Hokanson et al.
2004). Another possible strategy is the use of heat treatment or hot water on transplants
to reduce disease or pathogen infection during the early season. Heat treatment has
20
proven to minimize systemic bacterial infection in apples, cherries, and grapes, and is
also used to produce disease-free planting material in the sugarcane industry (Ferreira
and Comstock 1989; Turechek and Peres 2009). Currently, some nurseries are using
hot water to eliminate mite infestation in strawberry plants but the effects on pathogen
infection, disease development, and plant production need further investigation.
Previous studies have shown that heat treatment of strawberry plants could delay plant
growth, which makes this strategy unattractive for fruit field production but feasible for
nursery plant production (Turechek and Peres 2009).
Botrytis cinerea on Strawberry
The genus Botrytis was described by Pier Antonio Micheli in 1729, and its
species classified by other authors in subsequent years. The genus shares
characteristics with Sclerotinia and is composed of approximately 38 species, 28 of
them well described (Dewey and Grant-Downton 2016; Walker 2016). Botrytis species
can cause significant losses in economically important crops including nursery plant
production, fruit and vegetables, field and floral crops, and even in some post-harvest
agricultural products (Elad et al. 2007). These species can attack 596 genera of plant
hosts that can be monocotyledonous or dicotyledonous. Although the majority of
species have a narrow host range, some exceptions such as Botrytis cinerea can infect
586 genera and over 1400 plant species (Elad et al. 2016b; Elad et al. 2016a; Frías et
al. 2016) among them, pteridophytes, macroalgae, gymnosperms, monocots, dicots and
even a bryophyte (nonvascular plants), under laboratory conditions (Dewey and Grant-
Downton 2016).
Botrytis cinerea Pers. (teleomorph is Botryotinia fuckeliana (de Bary) Whetzel),
was first described in 1974 and is considered the most important among all the Botrytis
21
species and the second most important fungal plant pathogen based on its scientific
and economic impact (Beever and Weeds 2007; Frías et al. 2016; Rosslenbroich and
Stuebler 2000). B. cinerea is also considered one of the most significant pathogens in
the U.S. and worldwide production of strawberry causing one of the major diseases of
the crop: gray mold or Botrytis fruit rot (BFR) (Grabke et al. 2014; Hu et al. 2016). This
necrotrophic fungus belongs to the phylum Ascomycota, subphylum Pezizomycotina,
class Leotiomycetes, and is classified as part of the family Sclerotiniaceae with a
saprophytic life cycle (De Miccolis Angelini et al. 2016; Williamson et al. 2007). The
fungus produces macroconidia or commonly known as conidia, the asexual
reproductive structures that represent the main propagules that are ovoid shaped and
measure 10 x 8.5 µm. They are multinucleate, unicellular, hyaline, hydrophobic,
aseptate, and their survival is determined by the environmental conditions. Conidia are
produced on conidiophores of approximately 30 µm diameter and 5 mm high that are
produced on septate hyphae. The mycelia also form hard bulbs known as sclerotia, the
principal survival structures of the pathogen with a darkish color measuring 2-4 x 1–3
mm (Holz et al. 2007; Oliveira 2014; Tenberge 2007). Although very rare in nature and
possible under laboratory conditions, B. cinerea can produce apothecia as a sexual
reproductive structure that produces binucleate, unicellular, and ovoid to ellipsoid shape
ascospores (7 x 5.5 µm). The sexual structure germinates from the sclerotia and has a
brownish color with a bowl shape measuring 4-5 mm long (Beever and Weeds 2007;
Oliveira 2014).
Life Cycle and Epidemiology
The sclerotia on debris and the late winter or early spring conidia are the infective
propagules of B. cinerea (Elmer and Michailides 2007). The inner mycelium of the
22
sclerotia is surrounded by β-glucans and melanized rind that avoids desiccation,
allowing its survival and myceliogenic germination during wet weather in spring. The
germination results in mycelial growth that produces branching conidiophores producing
conidia at the branch tips (Figure 1-2) (Dewey and Grant-Downton 2016; Williamson et
al. 2007). Conidia are considered the primary source of inoculum and their production is
strictly determined by conditions such as light wavelength, an optimum temperature of
18˚C with lower production above 30˚C, and the presence of dead and wet plant tissue
(Carisse 2016). The release of conidia is controlled by air, rain, and hygroscopic
mechanism. It can occur during early hours in the morning due to the crumpling reaction
of the conidiophores in response to the decline in humidity and increase in temperature,
and around mid-day when the wind reaches high speeds. The transportation of the
released conidia is mainly by wind, having greater dispersal with wind speeds up to 2.8
km/h. Water can also transport conidia but is considered a secondary dispersal method
(Carisse 2016; Williamson et al. 2007).
The air-borne conidia infect parts of the plants like leaves, stems, and fruit but
flowers are the principal infection sites due to their high susceptibility to B. cinerea. The
reason for this is the inability of the pathogen to penetrate plant tissue with the use of
appressoria. Although this structure can be produced, it does not form appressorium
walls as in other pathogens, therefore, it needs natural openings or wounds. The
pathogen germinates in the flowers especially when relativity humidity is at 93% or
above and obtains nutrients from the stigmatic fluid located in the wet stigma. Mycelia
grows into the styles penetrating tissues to reach the ovules, the location where the
fungus remain in a quiescent infection for about 4 weeks until the fruit starts developing.
23
B. cinerea initiates infection in presence of favorable weather conditions to produce
conidia, the secondary inoculum, which completes the asexual reproduction cycle
(Elmer and Michailides 2007; Williamson et al. 2007).
In Florida, the conducive weather conditions for Botrytis fruit rot development on
strawberry are temperatures of 20˚C with leaf wetness of 6 consecutive hours or more
(Amiri et al. 2013; Bulger et al. 1987). The primary source of inoculum and infection has
been shown to be strawberry nursery transplants. A possible explanation is the ability of
the pathogen to infect the highly susceptible new leaves at the bud stage and remain
quiescent until exposure to the conducive disease conditions in Florida fields (Oliveira et
al. 2017; Sutton and Peng 1993). Once the pathogen is able to cause disease on green
and ripe fruit, it produces conidia for secondary infection contaminating healthy fruit by
wind dispersal or direct contact with infected tissue or propagules (Figure 1-3) (Grabke
et al. 2014).
Sclerotial survival of B. cinerea has been reported to be between 5 to 9 months
(Carisse 2016) but previous studies reveal poor survival during the high summer
temperatures in Florida (Oliveira et al. 2017). This could be one reason that sexual
reproduction of the pathogen is uncommon in nature, although is possible. When
present, apothecia geminate from the sclerotium, this process is called carpogenic
germination and is the result of the spermatization. The apothecia produce asci and
each ascus contains eight binucleate ascospores that are considered to have little
importance as primary inoculum. The sexual stage of B. cinerea (Botryotinia fuckeliana)
is rarely observed in strawberry fields but it has been reported in the eastern region of
Canada (Carisse 2016; Williamson et al. 2007).
24
Symptoms and Signs
Botrytis fruit rot infection usually starts in senescent strawberry flowers; its
natural openings make this a susceptible organ (Williamson et al. 2007). Once the
environmental conditions are conducive, the pathogen initiates disease development
causing soft rots, the main symptom on developing fruit. The lesions start as small, hard
necrotic spots with a tan color that can rapidly expand and are usually formed from the
calyx into the fruit (Figure 1-4) (Mertely et al. 2018). This is known as blossom-end-rot
and is due to the initial latent infection in the flowers. The rotting process occurs
simultaneously with the collapse of parenchyma tissue and water soaking, then conidia
are produced in masses giving a gray mold appearance, typical signs of B. cinerea.
Similar symptoms can also be observed on stem and flower parts like petals; infection
starts with very small pockmarks that develop into rotting lesions (Droby and Lichter
2007; Williamson et al. 2007). During conditions of high humidity, prolonged periods of
wet weather such as intense dews or rainy days, the rotting lesions can be entirely
covered with conidial masses and in the case of fruit, the results can be mummified
strawberries (Figure 1-5) (Peres 2015a). Colonization of healthy fruit can also occur by
secondary inoculum, but the rate of conidial production, regardless of the origin of
infection, is determined by maturity of the fruit, temperature, and moisture. If conditions
are favorable, intensive production of conidia can take place causing disease epidemics
in annual strawberry (Carisse 2016).
Disease Control
Botrytis fruit rot causes important yield losses on strawberry fields worldwide. In
Florida, the incidence of this disease was previously reported to be 29 and 51% on fruit
harvested from plots treated with fungicides and untreated areas, respectively (Cordova
25
et al. 2015). An integrated disease management program is important in annual winter
production systems as concluded by Legard et al. (2002), therefore, the combination of
non-chemical and chemical control are essential for effective BFR control in Florida
strawberry production.
Cultural and Biological Control
Limiting leaf wetness on the plant surface and reducing the humidity are cultural
control options (Elad et al. 2016a). One factor directly associated with wetness is the
canopy density; creating an open canopy improves the airflow and sunlight interception
allowing rain or irrigation droplets to dry faster (Williamson et al. 2007). One strategy to
reduce wetness is the use of a drip instead of overhead irrigation system to reduce
water dispersal. Another strategy is to reduce plant density by increasing spacing
between plants, but this might have negative effects on yield (Shtienberg 2007).
Pathogen infection can still occur at low RH levels, especially on wounded plant tissue
because of the moisture the plants produce. The soil is another source of moisture
affecting the stems that are in direct contact, thus the use of polyethylene plastic mulch
with small planting holes is a cultural strategy that reduce moisture and avoid pathogen
infection on lower stems or leaves (Elad 2016).
Other strategy used for BFR control is the removal of infected fruit from the
plants to eliminate secondary inoculum. The removal of senescent flowers also reduces
disease incidence; however, these are limited controls and require intensive labor
(Droby and Lichter 2007). Strawberry cultivars also play an important role in the disease
control. Although completely resistant strawberry cultivars to BFR are not commercially
available, cultivars differ in susceptibility with ‘Florida Radiance’ and ‘WinterstarTM (FL
05-107)’ being more tolerant in comparison to ‘Camino Real’ (Whitaker et al. 2012).
26
Also, cultivars with small clasping calyces are less susceptible to the disease due to
less moisture between the calyx and the fruit (Mertely and Peres 2009).
In addition to cultural strategies, some biological products or biopesticides have
become commercially available for disease suppression (Elad et al. 2016a). These
alternative control methods have many modes of action including induction of plant
resistance and microbial compounds, limitation of nutrients, modification of properties of
the plant surface, interference with pathogenicity, and decrease of inoculum production
(Nicot et al. 2016).
Biological control involves the use of microorganisms or natural substances that
affect the development of B. cinerea directly or indirectly (De Meyer et al. 1998). The
microbial groups used for biocontrol of B. cinerea on strawberry are bacteria,
actinomycetes, yeast, and fungi such as Bacillus subtilis, Streptomyces lydicus,
Candida oleophila, and Clonostachys rosea (Gliocladium roseum), respectively. They
are usually applied during the bloom period by spraying or direct delivery to the flowers
by bees (Droby and Lichter 2007; Nicot et al. 2016; Williamson et al. 2007). Natural
substances can indirectly affect the pathogen; one example is extract of knotweed,
Reynountria sachalinensis, which is commercialized as Regalia® and known to induce
resistance in strawberry plants (Nicot et al. 2016). Although biological products are
tested before registration, their efficacy tends to be higher on experimental areas of
small scale compared to commercial applications in large fields due to their inconsistent
performance under variable environmental conditions, product quality, and pathogen
population (Nicot et al. 2016).
27
Chemical Control
Cultural and biological control can reduce disease incidence but their
implementation alone is not sufficient, therefore the use of chemicals still represents the
most reliable and effective control for BFR on strawberry (Hu et al. 2016). The
chemicals used in the fields are mostly synthetic fungicides with either a single site-
activity targeting one specific and important function in a cell or multisite activity
interrupting more than one cellular function (Fillinger and Walker 2016). Single-site
fungicides are classified within five groups according to their targeted function: 1)
fungicides that affect respiration by interrupting the energy supply and germination i.e.
pyridine carboxamides, pyridinyl-ethyl-benzamides, and strobilurins; 2) fungicides
interrupting cytoskeleton formation by causing disruption of cell division and secretion of
protein i.e. thiophanates, benzimidazoles, and N-phenylcarbamates; 3) fungicides
affecting ergosterol in the membranes by interrupting its biosynthesis i.e.
hydroxyanilides; 4) fungicides affecting amino acids by interrupting the biosynthesis of
methionine; and 5) fungicides affecting osmoregulation whose specific site is still
unknown i.e. dicarboximides and phenylpyrroles. Multisite fungicides are classified
within chloronitriles, phthalimides, sulfamides, and dithiocarbamates chemical families
(Fillinger and Walker 2016; Leroux 2007; Williamson et al. 2007).
The Botrytis fruit rot management program in commercial strawberry fields in
Florida is mainly based on the use of fungicides. The program currently consists of
protective weekly rotation or tank-mixture application of the multisite fungicides captan
or thiram throughout the season starting after plant establishment. Single-site fungicides
registered in Florida are used during periods of peak bloom, usually in mid-November,
January, and February. The time for application of these fungicides is determined by the
28
Strawberry Advisory System (Cordova et al. 2017b; Pavan et al. 2012). This system
serves as disease management support by identifying the risk of disease epidemics
based on environmental weather conditions that are favorable for BFR, indicating the
appropriate time for fungicide application (Cordova et al. 2017b).
Fungicide Resistance
Synthetic fungicides are more commonly used as protectants to avoid pathogenic
infections on healthy plants. Because of their mobility, majority of these fungicides stay
on the plant surface where they are actively protecting the tissue but their activity can
be temporary due to the risk of being washed by rain and/or chemical breakdown,
resulting in their periodic re-application (Damicone and Smith 2009). On strawberry
fields, repeated applications of the same fungicide or fungicide classes are used to
control Botrytis fruit rot during the peak bloom (Leroch et al. 2013). The repeated use of
these chemicals can result in fungicide resistance that occurs by selection pressure of
the pathogen population with genetic variability (Daferera et al. 2003; Vincelli 2014;
Williamson et al. 2007). The reduction of fungicide sensitivity starts with a genetic
mutation altering the targeted protein. This usually occurs on one in a million or billions
of spores but is sufficient for the resistance process to start (Vincelli 2014). The
mutation can occur in single or multiple genes and since single gene mutation is more
common, single-site fungicides are at higher risk for resistance development than multi-
site fungicides that require mutations in more than one gene. The spores carrying the
gene mutation are more likely to survive the repeated fungicide applications, increasing
the frequency of resistant isolates within the population, which eventually become the
dominant isolates in the field (Damicone and Smith 2009; Vincelli 2014).
29
Botrytis cinerea is considered a high-risk pathogen for the development of
fungicide resistance because of its polycyclic life cycle, profuse sporulation, broad host
range, requires a high number of fungicide applications for effective control, and its high
genetic variability (Fernández-Ortuño et al. 2012; Veloukas et al. 2014). This variability
makes the pathogen complex with the ability to adapt to changing environmental
conditions and resistant to a vast number of registered fungicides (Amiri and Peres
2014; Kumari et al. 2014).
Fungicides are classified in several groups by their different modes of action,
targeted function, chemical group and resistance risk according to the Fungicide
Resistance Action Committee (FRAC). Only five of these groups contained fungicides
registered in Florida for Botrytis fruit rot control i.e., anilinopyrimidines (AP),
phenylpyrroles (PP), hydroxyanilides (Hyd), quinone outside inhibitors (QoI), and
succinate dehydrogenase inhibitors (SDHI) (Amiri et al. 2013; FRAC 2017; Oliveira et
al. 2017). In the 1990s, the fungicides cyprodinil, pyrimethanil, and mepanipyrim from
the AP group were introduced to the market. They are known to control the disease by
inhibiting extracellular protein secretion, germ tube elongation and consequently hyphal
growth but because of the same targeted functions, cross-resistance among these three
fungicides has already been reported (Forster and Staub 1996; Rosslenbroich and
Stuebler 2000). The resistance to more than one fungicide, multi-drug, is possible due
to molecules transported through the plasmamembrane by MFS or ABC transporter
families (Williamson et al. 2007). Cross-resistance has also been observed between
dicarboximides and fludioxonil, a fungicide from the PP group that interrupts spore
germination causing malformation and cell explosion (Rosslenbroich and Stuebler
30
2000). Since the 2000s, Florida has included the only member of Hyd group,
fenhexamid, in the disease management program. This fungicide reduces infection in
the flowers and its known to have low-to-medium fungicide resistance risk (Amiri and
Peres 2014).
Although QoI fungicides are considered important for control of other diseases in
agricultural systems, compounds such as pyraclostrobin, whose targeted function is
pathogen respiration, fail to completely control BFR and are considered to have high
levels of risk of resistance (Rupp et al. 2017; Veloukas et al. 2014). Because of the
resistance frequencies of the chemical groups previously mentioned, the use of SDHI
compounds classified in the FRAC group 7, has become an important and effective tool
for disease control especially since cross-resistance among the SDHIs and these other
fungicide groups has not been detected (Hu et al. 2016). The succinate dehydrogenase
inhibitors are the fastest group incorporating new compounds in the market with the
specific function to inhibit the pathogen mitochondrial respiration by targeting the
ubiquinone-binding pocket in the mitochondrial respiratory complex II or SDH,
compromising SDH-A (flavoprotein), SDH-B (iron-sulfur protein), and SDH-C and D (two
membrane-anchored proteins) (Hu et al. 2016; Sierotzki and Scalliet 2013).
The first SDHI was carboxin, a narrow-spectrum fungicide released in 1966,
followed by the incorporation of at least 18 more compounds. The newer generations of
SDHIs are characterized by their broad-spectrum activity including boscalid,
penthiopyrad and benzovindiflupyr, fluopyram, and isofetamid from the corresponding
chemical groups; pyridine carboxamides, pyrazole-4-carboxamides, pyridinyl-ethyl-
benzamides, and phenyl-oxo-ethyl thiophene amine (FRAC 2017; Leroux 2007).
31
Regardless of the SDHIs high efficacy, these fungicides are classified with medium-to-
high risk levels of resistance due to their mode of action being a single gene mutation
(Amiri et al. 2014; FRAC 2017). B. cinerea resistance to this group was reported to be
associated with genetic modifications in the SDH subunits B, C, and D. The most
frequent and common mutations are in the SDH-B: H272R and H272Y, the result of the
histidine replacement at codon 272 by arginine and tyrosine, respectively. A less
common mutation at the same codon is H272L, replacing histidine for leucine. Other
mutations described in the subunit B are N230I, replacement of asparagine by
isoleucine at codon 230, and P225F, P225L, and P225T where genetic modification
occurs at codon 225 with the substitution of proline by phenylalanine, leucine, and
threonine, respectively (Fernández-Ortuño et al. 2012; Veloukas et al. 2014).
The mutations mentioned above are responsible for conferring different levels of
resistance or phenotypes to SDHI fungicides on strawberry. In the case of boscalid, the
first broad-spectrum fungicide released in Florida in 2003, and penthiopyrad in 2012,
moderate to very high resistance can be observed in B. cinerea isolates with H272R/Y,
N230I, and P225F mutations. Moreover, only N230I and P225F have been reported to
confer high to very high resistance on fluopyram, one of the newly released SDHI
fungicides (Amiri et al. 2014). Levels of fungicide resistance have not been studied for
the newly-registered SDHI isofetamid, and phenotypes have not been determined for
benzovindiflupyr, a fungicide released for rust disease control but not for BFR. However,
studies by Hu et al. (2016) showed high efficacy of benzovindiflupyr for control of B.
cinerea under laboratory assays with less than 1 µg/mL EC50 values on strawberry
isolates harboring H272R/Y, and N230I mutations.
32
The evaluation of fungicide resistance levels can be achieved by the study of the
pathogen field population by laboratory assays to determine the toxicity response.
These assays measure the pathogen reaction to the fungicides that can result in growth
inhibition (Damicone and Smith 2009). Evaluations are by spore germination or mycelial
growth depending on the fungicide. Weber and Hahn (2011) previously developed a
spore germination assay using discriminatory doses that are amended with culture
medium to obtain fungicide sensitivity levels based on the percentage of germinated
spores. Mycelial growth can be evaluated with the spiral gradient dilution assay to
determine the effective fungicide concentration that inhibits the pathogen growth by
50% (EC50) (Förster et al. 2004). The evaluation of this method is similar to LD50 which
determines the 50% lethal dose of a determined pesticide required to kill mice
(Damicone and Smith 2009). Another method to evaluate fungicide resistance is the
resazurin-reduction assay, a relatively new technique use on bacteria and fungi such as
Alternaria alternata (Vega et al. 2012). This method consist on measuring cellular
activity with the use of nontoxic dye (Meletiadis et al. 2002; Pettit et al. 2005).
Objectives
Previous studies show B. cinerea resistance to boscalid in Florida strawberry
fields is approximately 80% (Amiri et al. 2012; Amiri et al. 2013), indicating the
importance of a periodic resistance evaluation of old and newly registered fungicides
from the SDHI group. In addition, Oliveira et al. (2017) reported that the primary source
of inoculum for these fields are the nursery transplants, which could contribute to the
fungicide resistance frequencies previously reported by Amiri et al. (2014). Our
hypothesis was that B. cinerea resistant frequencies has increased in Florida strawberry
fields and that the use of heat treatment of nursery transplants before planting could
33
reduce inoculum of the pathogen and its resistant isolates. Thus, the objectives of this
project were: i) to determine the baseline sensitivity of B. cinerea isolates to the newest
fungicide isofetemid from the Succinate Dehydrogenase Inhibitor (SDHI) class; ii) to
identify SDH-B mutations that confer resistance to Isofetamid; iii) to monitor fungicide
resistance frequencies of B. cinerea from nurseries and Florida strawberry fields to five
SDHI fungicides; iv) to evaluate the efficacy of heat treatment as a possible means to
manage B. cinerea resistant populations on strawberry transplants.
34
Figure 1-1. Production of runners from strawberry mother plant. (Source: Elena Garcia and Taunya Ernst, Horticulture. Missouri Organic Association, 2015).
Figure 1-2. Botrytis cinerea life cycle on strawberry (Source: Odile Carisse. Epidemiology and aerobiology of Botrytis spp. In: Botrytis – the fungus, the pathogen and its movement in agricultural systems. Springer, 2016).
35
Figure 1-3. Infected fruit serving as secondary inoculum source for adjacent fruit and flowers. February 5, 2018. Gulf Coast Research and Education Center. Courtesy of Adrian Zuniga.
Figure 1-4. Botrytis cinerea blossom-end-rot symptoms on green strawberry and a developing lesion on stem. January 25, 2017. Gulf Coast Research and Education Center. Courtesy of Adrian Zuniga
36
Figure 1-5. Mummified strawberry fruit. February 5, 2018. Gulf Coast Research and Education Center. Courtesy of Adrian Zuniga.
37
CHAPTER 2 BASELINE SENSITIVITY OF BOTRYTIS CINEREA ISOLATES AND PHENOTYPIC
CHARACTERIZATION OF SdhB MUTATIONS TO ISOFETAMID, AND MONITORING OF SDHI SENSITIVITY ON STRAWBERRY
Introduction
Botrytis cinerea Pers. the anamorph of Botryiotinia fuckeliana (de Bary) Whetzel
is a necrotrophic plant pathogen from the phylum Ascomycota and family
Sclerotiniaceae (Williamson et al. 2007). This polyphagous fungus has a wide host
range covering 586 genera and approximately 1400 plant species making it the most
important among Botrytis spp. and the second among fungi because of its importance to
science and the agricultural economy (Elad et al. 2016b; Frías et al. 2016). B. cinerea is
the causal agent of Botrytis fruit rot or gray mold, an important disease on a variety of
crops such as carrot, sweet potato, apples, broccoli, cabbage, beans, lettuce, raspberry,
grapes, blackberry, strawberry, and others (Williamson et al. 2007).
Botrytis fruit rot (BFR) represents one of the major threats affecting strawberry
(Fragaria x ananassa Duch) field production in the U.S. and other areas around the
world (Grabke et al. 2014). The U.S. is the second largest strawberry producer
worldwide with approximately 1.7 million tons of annual production with the majority of it
taking place in California followed by Florida (Geisseler and Horwath 2014; USDA
2017a).
The strawberry produced in Florida has a production value of approximately 450
million dollars as reported by USDA (2017a). The growing system used in Florida
consists of mostly open field compared to tunnel production; this enhances the risk of
BFR due to exposure of the plants to conducive environmental conditions, i.e.
temperatures around 20˚C and over 6 h of leaf wetness (Amiri et al. 2013; Bulger et al.
38
1987). Although cultural and occasionally some biological control methods are
implemented, chemical fungicides represents the main BFR control strategy in Florida.
The use of multi-site fungicides such as captan and thiram rotated or tank mixed with
single site fungicides are part of the current management program in commercial fields.
The applications of single site fungicides are advised by the Strawberry Advisory
System (Cordova et al. 2017; Pavan et al. 2012).
The fungicides labeled for strawberry BFR control available in Florida are
classified in five different groups including anilinopyrimidines (AP), phenylpyrroles (PP),
hydroxyanilides (Hyd), quinone outside inhibitors (QoI), and succinate dehydrogenase
inhibitors (SDHI) (Whitaker et al. 2017). The SDHIs have become the main tool for BFR
control in FL. This fungicide group targets pathogen respiration and the mitochondrial
respiratory complex II (SDH) (Sierotzki and Scalliet 2013). However, moderate to high
levels of resistance have been reported (Amiri et al. 2013).
Resistance to the first broad spectrum SDHI, boscalid, was reported on
strawberry isolates (Amiri et al. 2014). B. cinerea resistance to boscalid was associated
to mutations conferring substitutions of histidine at codon 272 in the SDH subunit B
(iron-sulfur protein) by arginine (H272R) or tyrosine (H272Y) (Amiri et al. 2014; Avenot
et al. 2008). Other mutations found in the same subunit are located at codon 230 and
225 replacing aspargine by isoleucine (N230I) and proline by phenylalanine (P225F)
(Fernández-Ortuño et al. 2012). Veloukas et al. (2014) reported these mutations confer
different levels of resistance on B. cinerea isolates to SDHI fungicides. In the case of
boscalid, moderate to high resistance can be conferred by H272R and H272Y
mutations.
39
New SDHIs have been released in the past several years for control of BFR such
as penthiopyrad, fluxapyroxad, fluopyram, and isofetamid from the corresponding
chemical groups pyrazole-4-carboxamides, pyridinyl-ethyl-benzamides, and phenyl-oxo-
ethyl thiophene amine (FRAC 2017). However, studies have already shown reduced
sensitivity to penthiopyrad, fluxapyroxad and fluopyram due to H272Y, N230I, and
P225F mutations resulting in high to very highly resistance on B. cinerea isolates from
strawberry (Amiri et al. 2014). Currently, there are no reported studies of resistance to
isofetamid, the newest SDHI registered for use on strawberry in Florida.
Benzovindiflupyr is another SDHI registered for the control of cereal and vegetables
diseases, and soybean rusts (Kuznetsov et al. 2017), but not yet for BFR on strawberry.
The low EC50 values (<1 µg/mL) of B. cinerea isolates from strawberry reported by Hu
et al. (2016) indicate possible high in vitro activity of benzovindiflupyr against the
pathogen.
Our hypothesis was that B. cinerea resistance to SDHI fungicides have
increased, lowering the efficacy of this chemical group for BFR control. Thus, the
objectives of this study were to: i) determine the baseline sensitivity of B. cinerea
isolates collected from Florida strawberry fields to isofetemid; ii) identify the mutation(s)
within the SdhB subunit conferring resistance to isofetamid; iii) monitor the frequency of
fungicide resistance among strawberry B. cinerea isolates from nurseries and Florida
fields to boscalid, penthiopyrad, fluopyram, benzovindiflupyr, and isofetamid.
Materials and Methods
Fungal Isolates
The baseline sensitivity was established for isofetamid by assessing 70 B.
cinerea isolates (Table 2-1). Selected isolates were collected prior to isofetamid
40
registration for strawberry in 2015 and preserved as conidial suspensions at -80˚C. To
revive the isolates, a small portion of the suspension was transferred to 6-cm diameter
petri dishes containing a modified HA medium (10g malt extract, 4g glucose, 4g yeast
extract, 15g agar), specialized for B. cinerea used by Leroch et al. (2013).
Thirteen isolates of B. cinerea previously characterized for boscalid sensitivity
and their associated mutation in the subunit B of the SDH (Amiri et al. 2014) were
characterized to isofetamid sensitivity. Two isolates with moderate to high resistance to
boscalid were associated with the H272R mutation. Four isolates represented high to
very high resistance with the H272Y and N230I mutations, whereas H225F conferred
very high resistance in three isolates (Table 2-2). The remaining three isolates were
sensitive to highly sensitive to boscalid (Amiri et al. 2014). All isolates were preserved at
-80˚C in the culture collection of the strawberry pathology laboratory at the Gulf Coast
Research and Education Center (GCREC), and revived on modified HA medium for this
study.
For the monitoring of SDHI sensitivity on strawberry, 565 isolates of B. cinerea
were collected from symptomatic fruit and detached leaves from transplants during two
consecutive seasons (Table 2-3). In the 2015-2016 strawberry seasons, 141 isolates
were recovered from symptomatic fruit produced in five different commercial strawberry
fields in Hillsborough County, the area where most of the strawberry production takes
place in Florida, US. During the same season, 188 isolates were obtained from
transplants that came from twelve nurseries: five from Nova Scotia, one from Ontario
and one from Quebec in Canada, three from North Carolina and two from California in
the US. In the following seasons, 2016-2017, 166 isolates were collected from four
41
commercial fields located in the same county in Florida and 70 isolates from transplants
grown in one strawberry nursery in Nova Scotia, Canada.
Isolates recovered from symptomatic fruit were obtained by vertically cutting the
fruit in half to identify infected tissue. A small piece of infected tissue was transferred to
6-cm diameter petri dish containing HA medium.
Isolates from strawberry transplants were recovered from plants shipped from the
different nurseries to GCREC. One leaf per transplant (40 leaves) was sampled from
each nursery during 2015-2016 season and 70 leaves in 2016-2017. Leaves were
detached and saved in sealed 15 x 25 cm clear plastic bags for 24 h at -20˚C to induce
tissue death. Following the leaf assay protocol of Souza Oliveira et al. (2017), leaves
were disinfested in a 0.02% solution of sodium hypochlorite for 2 min and rinsed twice
with sterile deionized water. Then, leaves were incubated in clear plastic boxes
measuring 31.5 x 25 x 10 cm, using wave-shaped chicken wire to elevate leaves above
the 250 mL deionized water at the bottom of boxes to keep high levels of humidity (99-
100%) (Figure 2-1). After the incubation period, 7 days at 23˚C, a stereomicroscope
(14X) was used to examine leaves showing infection with B. cinerea (Figure 2-2) and
one isolate for each infected leaf was transferred to HA medium.
All 565 isolates were individually preserved as conidial suspensions in 1 mL of
20% glycerol at -80˚C and revived when needed.
Fungicide Sensitivity Test
Mycelial growth inhibition assay
Sensitivity of isolates to isofetamid was determined by calculating EC50 values
using the spiral gradient dilution (SGD) method previously developed by Förster et al.
(2004) and modified by Amiri et al. (2013). For the inoculum, agar strips were prepared
42
with modified malt extract agar (MYA; 20g malt extract, 5g yeast extract, 20g agar), and
70 to 80 mL was poured into 15-cm diameter petri dish. Extra agar was added to the
medium to facilitate manipulation of the strips in the inoculation step. A designed agar
slicer was used to produce 16 strips 9 cm long by pressing it against the MYA medium,
and with a sterile scalpel the strips were cut perpendicularly to obtain 32 strips of 4.5-cm
long by 6-mm wide each. Individual 1 mL of conidial suspensions of 106 spore/mL were
prepared from the incubated isolates (6 to 7 days on HA medium), to be spread on the
sliced agar plates with a sterile glass spreader. Plates were sealed with Parafilm and
then incubated at 23˚C for 48 h.
Using the spiral gradient endpoint (SGE) software (Spiral System, Autoplate
4000 model; Spiral Biotech), three stock concentrations were calculated that would
correspond to three potential EC50 ranges based on the molecular weight of the
fungicide. The autoplate created fungicide gradient dilutions starting from the center to
the edge of the plates, which were used to calculate EC50 values for each isolate. The
software calculated stock suspensions of 89.5, 6417.6, and 128352.4 μg/mL, to produce
concentration gradients of 0.004 to 0.697, 0.290 to 44.355, and 5.791 to >500.000
μg/mL, respectively. Stock suspensions were prepared with sterile deionized water and
stored at 4˚C.
Using the spiral plater (Spiral System, Autoplate 4000 model; Spiral Biotech,
Norwood, MA), 50 μL of each stock suspension were applied in a spiral way with an
exponential mode of 1:300 to 15-cm diameter petri dish containing 50 mL of potato
dextrose agar (PDA; Becton Dickinson, Sparks, MD). This amount of medium results in
a level layer 3.3 mm deep (Förster et al. 2004). PDA was prepared 48 h before stock
43
suspension was applied to the medium. The plates with fungicide were incubated at
23˚C for 2 to 4 h allowing the fungicide to diffuse through the agar to form the gradient.
The center of the plates were marked with a permanent marker after removing the
central agar disk with a sterile cylindrical corer of approximately 25 mm diameter.
Fungicide is not applied in this area of the plate because of the off-center start of the
spiral plater stylet (Förster et al. 2004).
A template provided with the software was placed under the plates. Once the
plate was centered, mycelium-covered agar strips were placed radially with sterile
forceps across the gradient dilution. Two strips of the same isolate were placed on
opposite sides of the plate, allowing two isolates tested per plate with three replicate
plates per range (6 strips per isolate). PDA plates without fungicide were used as
controls (Figure 2-3). All plates were incubated in plastic bags at 23˚C and mycelial
growth was measured after 48 h.
Calculation of EC50 values
After incubation of the plates, three measurements per isolate were recorded in
millimeters. The radial growth of the control, and the averages of the six-strip
measurements were used to determine the location where the mycelium growth was
inhibited by 50% on the gradient dilution. The third measurement was the distance
between the 50% inhibition point to the center of the plate as illustrated by Förster et al.
(2004). The software recognizes the last measurement as ER (ending radius) value that
corresponds to a specific EC (ending concentration) or EC50 value, which was averaged
to obtain a final EC50 value per each isolate.
For phenotypic characterization, experiments were repeated two times using
128352.4 μg/mL for isofetamid stuck solution to test isolates harboring P225F mutation
44
and experiments were repeated four times using 89.5 and 6417.6 μg/mL for sensitive
isolates and isolates harboring H272R/Y and N230I mutations. EC50 values for the
baseline sensitivity of isofetamid were obtained using the two lower stuck solution
concentrations and the assay was performed twice. Repeated experiments for
phenotypic characterization and baseline sensitivity were combined after analysis of
variance was tested using the generalized linear mixed model, and means were
separated using Fisher's protected least significant difference (LSD) test at P = 0.05
using SAS 9.4 statistical software. Data of the isolates harboring SdhB mutations to
determine their phenotype was analyzed with one way ANOVA using the generalized
linear mixed model. Isolate was considered as the fixed effect and means of the isolates
were separated using Fisher’s protected LSD test at P = 0.05.
Conidial germination inhibition assay
Isolates collected from the two strawberry seasons were analyzed for SDHI
sensitivity based on a conidial germination assay. After incubation of the isolates on HA
for 6 to 7 days, individual conidial suspensions of 106 spore/mL were prepared using a
hemacytometer. Petri dishes (15-cm diameter) containing yeast bacto acetate agar
(YBA; 10g bacto peptone, 20g sodium acetate, 10g yeast extract, 15g agar) were
divided into thirty rectangles measuring 1.5 x 2.0 cm (Figure 2-4), allowing the testing of
thirty isolates per plate. YBA media was used based on the methodology used by
Stammler and Speakman et al. (2006) to test sensitivity of B. cinerea isolates to
boscalid. Using a graduated 10-μL pipette, two 7-μL drops of conidial suspension were
placed diagonally in each space. YBA medium was amended with 1 or 5 μg/mL of
penthiopyrad (Fontelis®, DuPont, Wilmington, DE), 2 or 5 μg/mL of fluopyram (Luna®
Privilege, Bayer CropScience, Research Triangle Park, NC) and boscalid (Endura®,
45
BASF, Research Triangle Park, NC) each; doses that had been previously determined
by Amiri et al. (2013) to differentiate isolate sensitivity to each respective fungicide.
Doses for benzovindiflupyr (provided from Syngenta Crop Protection for experimental
use) and isofetamid (Kenja® 400SC, SummitAgro, NC) were 1 or 5 μg/mL, each. Non-
amended YBA medium was used as a control. All inoculated plates were incubated at
23˚C for 18 to 24 h. Evaluation of conidial germination was based on a modified method
developed by Weber and Hahn (2011) to determine fungicide resistance. Using a
microscope (100x), 100 conidia of each isolate were counted and each germ tube was
given a rating for their fungicide sensitivity (Table 2-4). Based on the combination of the
number of conidia germinated and germ tube elongation (Figure 2-5), levels of fungicide
resistance were determined for each isolate to the SDHI fungicides tested. The percent
of fungicide resistance was calculated in relation to non-amended YBA plates (control).
The assay was repeated twice and the combination of one plate per isolate/fungicide-
concentration was used.
Molecular Characterization of Mutations Conferring Resistance to Isofetamid
Three B. cinerea isolates collected in the 2016-2017 strawberry season from
different locations in Florida were single-spored and grown on HA medium at 23˚C for 5
to 7 days. Approximately 100 mg of mycelium from each isolate was collected into 2 mL
microcentrifuge tubes. The FastDNA® KitTM (MO Biomedicals) was used to extract DNA
that was stored in 0.5 mL tubes at -20˚C.
The primers BcSdhB-F1 (Sequence: AAGGTATCTGCGGCAGTTGT) and
IpBecEnd2 (Sequence: CTCATCAAGCCCCCTCATTGATATC) reported by Amiri et al.
(2014) were used in this study to amplify a fragment (850bp) of SdhB. Polymerase
chain reaction (PCR) was conducted on 25 μL volume containing 14.6 μL of molecular
46
water, 5x buffer, 1.5 mM MgCl2, 0.2 mM dNTPS, 0.2 μM each primer, 2 unit Taq
polymerase, all from Promega Corp, and 20 ng/μL DNA. A T100TM thermal cycler (Bio-
Rad) was used to perform PCR with the following parameter: initial denaturation at 95˚C
for 3 min; 34 cycles of 95˚C for 40 sec, 55˚C for 40 sec, and 72˚C for 1 min; and an
extension at 72˚C for 5 min. To separate PCR products, 2 μL were electrophoresed on
a 1% agarose gel in 1x Tris-acetate-EDTA buffer at 100 V for approximately 45 min.
After confirming the expected length, PCR products were sequenced at Genewiz in
New Jersey, U.S. The software BioEdit version 7.0.5.3 (Hall 1999) was used to
assemble sequences and Mega7 version 7.0.2.6 (Kumar et al. 2016) for translation and
alignment.
Results
Fungicide Sensitivity Test
Baseline sensitivity of B. cinerea field isolates to isofetamid
Mycelial growth inhibition of seventy B. cinerea field isolates was measured using
the spiral gradient dilution (SGD) method to obtain individual EC50 values. The isolates
were collected from different years and locations within Florida (Table 2-1). Data
between experiments were combined after analysis of variance indicated no significant
difference (P ≤ 0.05). The EC50 values of isolates exposed to isofetamid ranged from
0.007 to 0.515 µg/mL (Figure 2-6) with a mean value of 0.098 µg/mL. Regardless of the
relatively wide EC50 range, the majority of the baseline EC50 values that accounted for
51.43% of the population tested, occurred below 0.050 µg/mL and 31.43% between
0.053 and 0.150 µg/mL. EC50 values that occurred from 0.155 to 0.490 µg/mL were
represented with 15.71% of the population and only 1.43% (1 isolate) were over 0.500
47
µg/mL. The EC50 values obtained over 0.155 µg/mL were observed in isolates collected
from 2005 through 2013.
Characterization of SdhB mutations in B. cinerea isolates to isofetamid
In this study, twelve B. cinerea isolates with previously identified mutations in the
subunit B of the SDH complex were evaluated for sensitivity to isofetamid fungicide. The
EC50 values were calculated for each isolate as described above. These values were
used to classify the isolates in three different sensitivity phenotypes – sensitive (S),
moderately resistant (MR), and highly resistant (HR) with EC50 values below 5 µg/mL,
between 5 and 50 µg/mL, and greater than 500 µg/mL, respectively. These phenotypes
groups were significantly different after analysis of the means of isolates (P ≤ 0.05)
(Table 2-2). Repeated experiments were combined after determining that variance was
homogeneous (P ≤ 0.05). Boscalid sensitive isolates with no mutation 11-45, 12-221,
and 12-241 were considered sensitive to isofetamid with EC50 values of 0.18, 0.30, and
0.22 µg/mL, respectively (Table 2-2). Isolates 10-35, 11-67, 12-65, 12-332 were
characterized as sensitive according to their corresponding EC50 values, 0.19, 0.30,
0.01, and 0.26 µg/mL, which were not significantly different from isolates without
mutations. The isolates 12-450 and 12-255 harboring the mutation N230I were
significantly different with EC50 values of 1.46 and 7.15 µg/mL that characterized them
as sensitive and moderately resistant, respectively. In comparison, the EC50 values for
isolates harboring the P225F mutation were extremely high, greater than 500.00 µg/mL,
conferring high resistance in isolates 11-62, 12-355, and 12-374.
48
Sensitivity and cross-resistance evaluation between five SDHI fungicides in B. cinerea isolates
During the 2015-2016 strawberry season, boscalid resistance frequencies in
isolates collected from Florida farms was 97.9% and in isolates from nurseries was
93.6% (Figure 2-7). The frequency of resistance ranged from 87.5 to 100% in farm
locations and 60 to 100% in the nurseries (Table 2-5). Resistance frequencies of
isolates from Florida strawberry farms and nursery were similar for penthiopyrad with
33.3 and 33.5%, respectively. Similar results were obtained for fluopyram whose
corresponding frequencies for fruit farms and nurseries were 22.7 and 19.7%. Different
results were observed for benzovindiflupyr sensitivity, whose frequencies of resistance
of isolates from strawberry farms was 31.2% compared to 20.2% for isolates from
nurseries. All five locations in Florida showed resistance to penthiopyrad and
benzovindiflupyr but only four had resistance to fluopyram. For the same fungicides,
sensitivity was 100% only in nurseries with codes D, F and H (Table 2-5). Resistance to
isofetamid was not observed for either strawberry farms or nursery isolates from the
2015-2016 season. In the following season, 2016-2017, resistance frequency in Florida
isolates for boscalid was 94.6% and 85.7% for nursery isolates (Figure 2-8). Resistance
to penthiopyrad observed in isolates from farms was at 95.8% and in nursery isolates at
92.9%. Differences among isolates were observed for fluopyram and benzovindiflupyr
depending on their origin. Resistance frequency on isolates from strawberry farms to
fluopyram was 56.6% while only 14.3% was observed on nursery isolates. In the case
of benzovindiflupyr, the respective frequencies were 36.1 and 4.3%. In 2016-2017,
resistance to isofetamid was found only in 1.8% of farm isolates, i.e., three isolates.
During this season, all farm and nursery locations showed resistance to boscalid (85.7
49
to 100%), penthiopyrad (91.8 to 100%), fluopyram (14.3 to 87.8%), and benzovindiflupyr
(4.3 to 63.4%) but resistance to isofetamid was observed in only three farm locations
with codes ff (2.4%), gg (4%), and hh (1.6%) (Table 2-5).
Phenotypic evaluations for 2015-2016 season (Figure 2-9) showed a small
population of B. cinerea was sensitive (4.6%) and moderately resistant (1.8%) to
boscalid whereas the remaining 93.6% were highly resistant compared to the other
SDHIs tested. Highly resistant isolates to penthiopyrad were at 15.8% while 17.6% of
the isolates were moderately resistant and 66.6% were sensitive. Results for fluopyram
showed frequency of sensitivity with 79%, whereas only 11.3 and 9.7% were
moderately and highly resistant, respectively. Similar results were obtained for
benzovindiflupyr with frequencies of 75.1% (sensitive), 17% (moderately resistant) and
7.9% (highly resistant). All 329 isolates were sensitive to isofetamid, indicating the
fungicide inhibited B. cinerea spore germination on isolates collected during the first
evaluated season. Isolates with high level of resistance (91.5%) were observed for
boscalid in the following strawberry season, 2016-2017, with only 8.1% of sensitive
isolates (Figure 2-10). Moderately (56.8%) and highly resistant (38.1%) isolates were
observed for penthiopyrad, while sensitive isolates were at 5.1%. Isolates with sensitive
phenotype to fluopyram were represented with 55.9% of the population tested during
the 2016-2017 season, whereas highly resistant isolates were at 35.2%. Isolates
considerate sensitive, moderately and highly resistant to benzovindiflupyr were found at
73.3, 20.8, and 5.9%, respectively. Resistance to isofetamid was first observed during
the second evaluated season with only 1.3% of the population classified as moderately
resistant and the remaining 98.7% was sensitive.
50
Multi-fungicide resistance for B. cinerea isolates to the five SDHIs tested was
also observed at different rates during the two seasons (Figure 2-11). In 2015-2016,
resistance to one fungicide (boscalid) was observed in 197 isolates (Table 2-6)
representing 62.7% of the population during this season. Frequencies of isolates
resistant to two, three, and four fungicides were 7.3, 14, and 16%, respectively, and
resistance to all five fungicides was not observed. In 2016-2017, resistance to one
fungicide was 4% whereas resistance to two fungicides was 48.4%. Results were
obtained with 9 and 109 isolates resistant to boscalid and boscalid + penthiopyrad,
respectively (Table 2-6). Multi-fungicide resistance to three and four compounds was
20.9% and 25.3%, respectively. Resistance to three fungicides always occurred for
boscalid, penthiopyrad, and fluopyram or benzovindiflupyr in the two seasons (Table 2-
6). Only three isolates representing 1.3% of the isolates evaluated during 2016-2017
were resistant to all five fungicides.
SdhB Mutation Found on B. cinerea Isolates
Sequences were aligned to a B. cinerea isolate without mutations in the SdhB
region (GenBank accession KR866382.1). The translated amino acid sequence
revealed a substitution of asparagine by isoleucine at codon 230 in the three isolates
found to be moderately resistant to isofetamid collected during 2016-2017 season. No
other mutations were found on the sequenced isolates.
Discussion
The initial step to monitor for the selection of fungicide-resistant pathogen
populations is to determine a baseline sensitivity to a fungicide using isolates collected
prior to widespread use, and that could be used for future reference. To our knowledge,
this is the first baseline sensitivity study with the SDHI fungicide isofetamid in B. cinerea
51
isolates collected from strawberry. The results of this study using isolates collected
before isofetamid registration in 2015 showed a relatively wide range of EC50 values
(0.007 to 0.515 µg/mL). However, 83% of the strawberry isolates tested were at the
lower end of the baseline (≤0.15 µg/mL), similar to mycelium growth inhibition assays
reported for isofetamid baseline in grapevine B. cinerea isolates (Piqueras et al. 2014).
This suggests the high in vitro activity of isofetamid against B. cinerea. Baselines with
wide EC50 ranges have also been reported for other SDHI fungicides such as
penthiopyrad, fluopyram, and boscalid with B. cinerea isolates from table grape (Vitale
et al. 2016) and for other pathogens like Alternaria alternata (Avenot et al. 2014). The
relative wide EC50 ranges can be related to the different response among pathogen
populations to the fungicide. The number of isolates can also be a factor for a wide
sensitivity range, although Thomas et al. (2012) previously reported a baseline for
penthiopyrad in Didymella bryoniae using a similar number of isolates (n=71) compared
to our study but obtained a narrow EC50 range. Another study using the same number of
isolates (n=70) resulted in a wide EC50 range in Venturia inaequalis for the SDHI
fungicide fluopyram (Villani et al. 2016). Thus, this effect might be related mainly to the
variation of the pathogen toxicity response. This could also explain why we did not
observe an association between the year of the isolate collection and reduction of
fungicide sensitivity, considering 25% of B. cinerea isolates collected in 2005 were at
the higher concentration end of the baseline, while another 25% were at the lower end.
Similar observations were made for other years of isolate collection. In addition, the high
genetic variability of B. cinerea (Williamson et al. 2007) can also be a contributing factor
for this observation.
52
The use of SDHI fungicides rapidly increased since the release of the first
compound in 1966 (Leroux 2007), but their single site of action makes them susceptible
to selection of resistance. A previous study by Amiri et al. (2014) reported different
resistance levels to boscalid are conferred by the mutations H272R, H272Y, N230I, and
P225F in B. cinerea isolates from Florida strawberry fields. Esterio et al. (2015) and Yin
et al. (2011) found the same mutations on B. cinerea from table grape in Chile and
apples in Washington, respectively. However, the SdhB phenotypic characterization in
this study indicates that of those, only the mutations N230I and P225F confer resistance
to isofetamid. Boscalid has been used for the longest time among the SDHIs registered
on strawberry, and resistance to this compound was observed first. Even though
boscalid is not much used anymore in Florida strawberry fields, it was used in this study
for comparison to the new SDHI isofetamid. Previous findings concluded boscalid
completely failed to inhibit mycelial growth on isolates harboring P225F mutation
conferring high resistance levels based on in vitro assays showing high EC50 values
(Amiri et al. 2014), similar to results obtained for other SDHIs such as benodanil,
bizafen, fenfuram, isopyrazam, fluxapyroxad, penthiopyrad, and fluopyram (Amiri et al.
2014; Veloukas et al. 2013). The P225F mutation was found to also confer high levels
of resistance to isofetamid with EC50 values over 500 µm/mL. Our results agree with
previous findings indicating the importance of the P225F mutation as a high threat to the
FRAC group 7. However, this substitution has rarely been detected on field isolates
(Veloukas et al. 2014). The mutations H272R and H272Y confer moderate to high levels
of resistance to boscalid (Lalève et al. 2014; Veloukas et al. 2011) and are usually the
most frequently found in B. cinerea strawberry isolates as reported by Fernández-
53
Ortuño et al. (2012) and Leroux et al. (2010). The lack of fitness penalties especially for
H272R represent a possible explanation for their persistence within populations
(Veloukas et al. 2014), but these mutations failed to confer resistance to isofetamid in B.
cinerea isolates in our study. Interestingly, N230I, a mutation of lower occurrence
showed moderate resistance in only one of the evaluated isolates known to carry the
mutation. This is in contrast to Veloukas et al. (2013) who reported in vitro growth
inhibition of the pathogen with fluopyram and other SDHIs, but isofetamid was not
tested. Furthermore, Amiri et al. (2014) found in their study that N230I conferred high to
very high resistance to boscalid and fluxapyroxad, and different levels of resistance to
penthiopyrad and fluopyram from moderate to very high resistance. This supports our
results, considering this mutation was found in resistant isolates to relatively new SDHI
fungicides at the time, excluding boscalid. In accordance to our SdhB phenotypic
characterization, isolates with moderate resistance to isofetamid were confirmed to
have a substitution at codon 230 of asparagine by isoleucine (N230I). Additional
sequencing of SdhB for the 20 randomly selected isolates identified the N230I mutation
(data not shown), but these isolates did not confer resistance to isofetamid. Thus, based
on these results we hypothesize that the ability of B. cinerea to develop more than one
mutation to an independently targeted site (Veloukas et al. 2014) might be a
contributing factor for N230I mutation to confer resistance to isofetamid. Also, the
resistant populations of this pathogen might be undergo a genotypic predominance
shifting where H272R/Y is decreasing with the increase of N230I in Florida fields.
However, future investigation is needed to better understand the effect of this mutation
on fungicide sensitivity.
54
Monitoring of SDHI fungicide resistance frequencies was conducted for nurseries
and Florida farms for two consecutive strawberry seasons. Frequencies for farms and
nurseries were very similar for boscalid, penthiopyrad, and fluopyram with differences
between fungicides. Similar results were observed for the second evaluated season,
although penthiopyrad and fluopyram resistance increased between the two types of
locations and only in Florida farms, respectively. Overall, a high frequency of B. cinerea
resistance was observed to boscalid (93.9%) similar to that reported by Amiri et al.
(2013, 2014) in Florida fields (85.4 and 100%) and by Oliveira et al. (2017) for nursery
isolates (89.6%). Our results also agree with B. cinerea boscalid resistance on
strawberry in the Carolinas (Fernández-Ortuño et al. 2012) and other hosts such as
raspberry, grapevine, sweet cherry, and ornamental flowers in Germany (Rupp et al.
2017). However, results from Hu et al. (2016) showed a much lower resistance
frequency for this fungicide in a study involving 12 states, not including Florida. The
contradiction among studies could indicate the prevalence of boscalid resistance in
Florida fields despite the fact that this fungicide is no longer used. On the other hand,
this discrepancy could be explained based on the different methods used to conduct the
experiments and the use of symptomatic strawberry fruit in our study versus non-
symptomatic flowers by Hu et al. (2016) for B. cinerea isolation. The same authors also
reported very low resistance frequencies for penthiopyrad and fluopyram (<8% for both),
similar to results obtained by Oliveira et al. (2017) which contradicts the corresponding
frequencies obtained in this study: 59.1 and 30.6%. A previous report by Amiri et al.
(2014) concluded that penthiopyrad rapidly selects for resistance in B. cinerea, which
could explain our results in comparison to previous studies and the difference observed
55
within the seasons evaluated. In addition, our results for this fungicide are similar to the
resistance reported for Alternaria solani (Miles et al. 2014). Although fluopyram
resistance is relatively high compared to the studies mentioned above, its efficacy
against the pathogen is much higher in comparison to boscalid and penthiopyrad.
However, it should be noted that based on our results, resistance management to this
fungicide needs improvement to preserve its efficacy. Benzovindiflupyr, an SDHI
fungicide not yet registered for Botrytis fruit rot control on strawberry was also evaluated
for resistance to B. cinerea. Overall frequency of resistance to this fungicide was low
(25.7%) based on the conidial germination assay, indicating high activity against the
pathogen. Our results agrees with those of Hu et al. (2016) with the same effect on
mycelial growth of strawberry isolates and to both conidial and mycelial inhibition of
other pathogens such as Ventura inaequalis (Villani et al. 2016).
The latest member of the FRAC group 7 registered for use on strawberry in
Florida in 2015 was isofetamid, a thiophene-carboxamide fungicide (Xiong et al. 2015)
distributed by SummitAgro. Isofetamid showed 0% frequency of resistance during 2015-
2016 and 1.8% frequency of moderately resistant phenotype for the following season,
but only on isolates collected from Florida fields. High sensitivity (100%) of this fungicide
was also reported by Hu et al. (2018) against B. cinerea and B. fragariae isolates
resistant to fungicides of one, two, three, four, or five chemical classes. This is in
agreement with other studies showing 0% resistance on B. fragariae (Dowling et al.
2017) and B. mali (Cosseboom et al. 2018). Furthermore, isofetamid has been reported
to effectively control B. cinerea on table grape in Chile based on in vitro assays
(Piqueras et al. 2014). The high in vitro sensitivity of isofetamid against Botrytis spp
56
according to our study confirms its high field efficacy compared to other SDHI fungicides
(Cordova et al. 2015). Isofetamid is the second SDHI carrying a phenethylamide
derivative (Jeanmart et al. 2016), which might explain the effective control observed in
our and in other studies. However, our results showed development of resistance to
fluopyram, the first SDHI with the same characteristic as isofetamid.
Multi-fungicide resistant (MFR) phenotypes among the SDHI tested were also
observed in both seasons. Resistant isolates to one fungicide were found at higher
frequency (62.7%) compared to MFR2, 3, and 4. Frequencies of MFR2 increased
during the second season (48.4%) and MFR5 isolates were observed at very low
frequencies (1.3%). A previous study with B. cinerea isolates from nursery transplants
reported MFR2 occurred most commonly followed by MFR3 (Oliveira et al. 2017).
However, Amiri et al. (2013) found MFR2 was the second highest after MFR3 in B.
cinerea isolates collected from fruiting fields. In agreement with these authors, B.
cinerea resistance to more than one fungicide seems to occur at a higher rate. This
might be due to the ability of the pathogen to develop more than one mutation related to
a specific targeted site (Veloukas et al. 2014).
The results obtained in this study suggest the great importance of resistance
management of old and new SDHI fungicides, considering this group represent one of
the main tools for the efficient control of Botrytis fruit rot. These single-site fungicides
should always be alternated or tank-mixed with multi-site fungicide (Oliveira et al. 2017)
to decrease selection probability of resistant populations. Minimizing the use of
fungicides with rapid selection for resistance such as penthiopyrad and limited
applications of other single-site fungicides such as fluopyram and isofetamid to only
57
during bloom periods or following the Strawberry Advisory System (Peres 2015a), can
help conserve the efficacy of these fungicides. If benzovindiflupyr were to be registered
in Florida, the same recommendation mentioned above should be followed. Finally,
periodic evaluation of SDHI fungicides is advised to monitor resistance frequencies and
predominant genotypes of SdhB mutations in B. cinerea from strawbery fields.
58
Table 2-1. Botrytis cinerea isolate used for isofetamid baseline sensitivity
Yeara Origin Isolatesb
2001 - 01-36, 01-37
2003 Monticello 03-37
2005 Dover 05-25, 05-28, 05-29, 05-30
2008 Balm 08-96, 08-98, 08-100
2010 Balm 10-31, 10-39, 10-40
2010 Lake Wales 10-36, 10-38
2010 Dover 10-41
2011 Dover 11-07, 11-08, 11-09, 11-10
2011 Plant City 11-20, 11-106, 11-109, 11-111, 11-350
2011 - 11-45, 11-48, 11-55, 11-57
2012 Plant City 12-20, 12-50, 12-51, 12-248, 12-249, 12-345, 12-346, 12-347, 12-348
2012 Dover 12-84, 12-85, 12-86, 12-93, 12-95
2012 Balm 12-176, 12-178
2012 Floral City 12-320, 12-321, 12-322
2012 Wimauma 12-384, 12-385, 12-386
2012 Riverview 12-428, 12-429, 12-430
2013 Balm 13-03, 13-15, 13-16, 13-17
2013 Plant City 13-152, 13-153, 13-154, 13-155, 13-184, 13-185, 13-186, 13-188
2013 Floral City 13-390, 13-391, 13-392, 13-417 a Year of collection. All isolates were collected from different cities in Florida, prior to isofetamid registration. b Isolates were obtained from Dr. Natalia Peres, Gulf Coast Research and Education Center (GCREC), University of Florida, Wimauma, FL.
59
Table 2-2. Phenotypic characterization of succinate dehydrogenase subunit B (SdhB) mutations to isofetamid
Boscalida Isofetamidb
Genotypec Isolate Phenotype EC50d Phenotype
WT 11-45 HS 0.18 a S
12-221 HS 0.30 a S
12-241 S 0.22 a S
H272R 11-67 MR 0.30 a S
10-35 HR 0.19 a S
H272Y 12-332 HR 0.26 a S
12-65 VHR 0.01 a S
N230I 12-450 VHR 1.46 a S
12-255 HR 7.15 b MR
P225F 11-62 VHR >500.00 c HR
12-355 VHR >500.00 c HR
12-374 VHR >500.00 c HR a Phenotype of the SdhB mutations conferring different levels of resistance on Botrytis cinerea isolates to boscalid according to Amiri et al. (2014). b Phenotypes for isofetamid were determined based on EC50 values obtained in this study. S = sensitive (< 5 μg/mL), MR = moderate resistance (5 to 50 μg/mL), and HR = highly resistant (> 50 μg/mL). c Mutations in the subunit B of the SDH complex. WT = wild type. d EC50 values followed by the same letter are not significantly different based on one way ANOVA and least significant difference test at P ≥ 0.05.
60
Table 2-3. Botrytis cinerea isolates used for the monitoring of fungicide resistance
2015-2016a 2016-2017a
Region Originb Cultivar Leaves Fruit Leaves Fruit
Nova Scotia, CA A Camarosa 20 … … …
A Strawberry Festival 20 … … …
A Florida 127 20 … … …
A Florida Radiance … … 70 …
B Florida Radiance 20 … … …
C Florida Radiance 16 … … …
Ontario, CA D Florida Radiance 3 … … …
Quebec, CA E Florida Radiance 20 … … …
North Carolina, US F Strawberry Festival 5 … … …
G Florida Radiance 10 … … …
H Florida 127 15 … … …
California, US I Strawberry Festival 19 … … …
I Florida 127 20 … … …
Florida, US aa … … 24 … …
bb … … 24 … …
cc … … 24 … …
dd … … 46 … …
ee Florida 127 … 23 … …
ff Florida 127 … … … 41
gg DrisStraw 24 … … … 25
hh Winter Star … … … 24
hh Florida Radiance … … … 37
ii Florida Radiance … … … 39 a Number of strawberry isolates collected from either fruit or leaf tissue during two consecutive season in Florida. b Single capital letters indicate different strawberry nurseries and double lower case letters the different farms in Florida.
61
Figure 2-1. Incubation of strawberry leaves over wave-shaped chicken wire inside plastic boxes for isolation of Botrytis cinerea. August 23, 2017. Courtesy of Adrian Zuniga.
Figure 2-2. Evaluation of Botrytis cinerea infection on strawberry leaves. Examination of conidiophores and conidia of B. cinerea using a stereomicroscope (14x). August 28, 2017. Courtesy of Adrian Zuniga.
62
Figure 2-3. Spiral gradient dilution method setup for mycelium-covered agar strips radially placed on: A) potato dextrose agar (PDA) control plate (15-cm diameter) without fungicide; and B) PDA plate amended with isofetamid (89.5 μg/mL). August 18, 2017. Courtesy of Adrian Zuniga.
Figure 2-4. Petri dish plate (15-cm diameter) containing yeast bacto acetate agar (YBA) medium divided into 30 rectangles for conidial germination assay. September 20, 2017. Courtesy of Adrian Zuniga.
63
Table 2-4. Determination of phenotypes based on conidial germination of Botrytis cinerea isolates to succinate dehydrogenase inhibitors (SDHI) fungicides
Lower concentration Higher concentration
Phenotypea Germination (%)b Ratingc Germination (%) Rating
Sensitive <50 -1 0 0
Moderately Resistance >50 1 <50 -1
Highly Resistance >50 2,3 <50 >1 a Different levels of resistance (phenotypes) determined by the spore germination assay originally developed by Weber and Hahn (2011) and modified for this study. b Percentage of geminated B. cinerea conidia at two different fungicide concentrations. c Rating of germ tube elongation (-1, 0, 1, 2, and 3) [illustrated in Figure 2-5].
Figure 2-5. Rating of germ tube elongation on germinated Botrytis cinerea conidia. A) Non-germinated conidium (0); B) Germ tube same size as conidium (-1); C) Germ tube double the size of conidium (1); D) Germ tube triple the size of conidium (2); and E) Germ tube size-x4 bigger than conidium (3). September 1, 2017. Courtesy of Adrian Zuniga.
64
Figure 2-6. Frequency distribution of effective concentration at which mycelial growth
was inhibited by 50% (EC50) for 70 Botrytis cinerea baseline isolates to isofetamid. Fungicide sensitivity was determined using spiral grading dilution (SDG) method. Isolates were collected from strawberry fruit originating from different areas within Florida and were never exposed to isofetamid prior to this study. Values on the X-axis indicate the individual isolates grouped in EC50 ranges with intervals of 0.05 μg/mL.
65
Figure 2-7. Frequency of resistant Botrytis cinerea isolates collected during 2015-2016
strawberry season to five succinate dehydrogenase inhibitors (SDHI) fungicides. The concentrations used were 2 or 5 μg/mL of boscalid (Endura) and fluopyram (Luna Privilege), and 1 and 5 μg/mL of penthiopyrad (Fontelis), benzovindiflupyr (not registered for strawberry) and isofetamid (Kenja) each. Spore germination data were used to determine frequency of resistance to the fungicides on the evaluated nurseries and Florida fields.
0
10
20
30
40
50
60
70
80
90
100R
esis
tan
ce
Fre
qu
en
cy (
%)
Farms
Nurseries
66
Table 2-5. Resistance frequency to five fungicides on Botrytis cinerea isolates from nurseries and Florida strawberry fields
a The concentrations of the fungicides used were 2 or 5 μg/mL of boscalid (Endura) and fluopyram (Luna Privilege), and 1 or 5 μg/mL of penthiopyrad (Fontelis), benzovindiflupyr (not registered for strawberry) and isofetamid (Kenja) each. b Single capital letters indicate different strawberry nurseries and double lower case letters the different farms in Florida.
Frequency of resistance (%)a
Year Region Isolate originb Total isolates Boscalid Penthiopyrad Fluopyram Benzovindiflupyr Isofetamid
2015 - 2016 Florida aa 24 87.5 12.5 12.5 8.3 0.0
Florida bb 24 100.0 25.0 8.3 20.8 0.0
Florida cc 24 100.0 45.8 41.7 45.8 0.0
Florida dd 46 100.0 19.6 0.0 26.1 0.0
Florida ee 23 100.0 78.3 73.9 60.9 0.0
Nova Scotia A 60 96.7 45.0 28.3 18.3 0.0
Nova Scotia B 20 100.0 50.0 50.0 40.0 0.0
Nova Scotia C 16 81.3 12.5 6.3 0.0 0.0
Ontario D 3 100.0 0.0 0.0 0.0 0.0
Quebec E 20 100.0 25.0 0.0 10.0 0.0
North Carolina F 5 100.0 0.0 0.0 0.0 0.0
North Carolina G 10 100.0 40.0 40.0 50.0 0.0
North Carolina H 15 60.0 0.0 0.0 0.0 0.0
California I 39 97.4 38.5 7.7 30.8 0.0
2016 - 2017 Florida ff 41 97.6 100.0 87.8 63.4 2.4
Florida gg 25 96.0 96.0 28.0 12.0 4.0
Florida hh 61 88.5 91.8 39.3 21.3 1.6
Florida ii 39 100.0 97.4 69.2 46.2 0.0
Nova Scotia A 70 85.7 92.9 14.3 4.3 0.0
67
Figure 2-8. Frequency of resistant Botrytis cinerea isolates collected during 2016-2017
strawberry season to five succinate dehydrogenase inhibitors SDHI fungicides. The concentrations used were 2 or 5 μg/mL of boscalid (Endura) and fluopyram (Luna Privilege), and 1 or 5 μg/mL of penthiopyrad (Fontelis), benzovindiflupyr (not registered for strawberry) and isofetamid (Kenja) each. Spore germination data were used to determine frequency of resistance to the fungicides in the evaluated nurseries and Florida fields.
0
10
20
30
40
50
60
70
80
90
100
Re
sis
tan
ce
Fre
qu
en
cy (
%)
Farms
Nurseries
68
Figure 2-9. Frequency levels of resistant isolates collected from nurseries and Florida fields during 2015-2016 strawberry season. The number of conidia germinated and germ tube elongation obtained in the conidial germination assay determined the sensitivity levels.
69
Figure 2-10. Frequency levels of resistant isolates collected from nurseries and Florida fields during 2016-2017 strawberry season. The number of conidia germinated and germ tube elongation obtained in the conidial germination assay determined the sensitivity levels.
70
Figure 2-11. Frequency of multi-fungicide resistance (MFR) to five succinate dehydrogenase inhibitors (SDHI) fungicides on Botrytis cinerea isolates collected during two strawberry seasons from different nurseries and Florida fields. The evaluated fungicides were boscalid (Endura), penthiopyrad (Fontelis), fluopyram (Luna Privilege), benzovindiflupyr (not registered for strawberry), and isofetamid (Kenja). [FR1 = resistance to one fungicide, MFR2 = resistance to two fungicides, MFR3 = resistance to three fungicides, MFR4 = resistance to four fungicides, and MFR5 = resistance to five fungicides]
0
10
20
30
40
50
60
70
80
FR1 MFR2 MFR3 MFR4 MFR5
Re
sis
tan
ce
Fre
qu
en
cy (
%)
2015-2016
2016-2017
71
Table 2-6. Number of Botrytis cinerea isolates collected from different nurseries and Florida fields showing single and multi-fungicide resistance
Number of Isolates
Fungicidesa
Yearb Boscalid Penthiopyrad Fluopyram Benzovindiflupyr Isofetamid
2015-2016 197 R - - - -
50 R R R R -
25 R R - R -
19 R R R - -
16 R R - - -
15 - - - - -
7 R - - R -
2016-2017 109 R R - - -
57 R R R R -
44 R R R - -
11 - - - - -
8 - R - - -
3 R R - R -
3 R R R R R
1 R - - - - a Resistant isolates to one or multiple succinate dehydrogenase inhibitors (SDHI) fungicides. b Strawberry season in which isolates were collected.
72
CHAPTER 3 HEAT TREATMENT AS A POSSIBLE MEANS TO REDUCE BOTRYTIS CINEREA
RESISTANT POPULATIONS ON STRAWBERRY TRANSPLANTS
Introduction
Florida is the largest producer of the cultivated strawberry, Fragaria x ananassa
Duch, in the southeastern U.S. and second nationwide with 7% of the total production.
In the latest annual report corresponding to 2017, Florida produced 122 thousand tons
on 4,330 hectares of harvested fields with a production value of approximately 450
million dollars (Hancock et al. 2008; USDA 2017b). Strawberry production occurs mainly
in the Plant City area in Hillsborough County with annual plasticulture as the production
system used throughout the state (Whitaker et al. 2017).
In Florida, strawberry producers use bare-root, green-top transplants with
tolerance to high temperatures that are produced in nurseries located in southern
Canada and some regions in the U.S. such as California and North Carolina (Hochmuth
et al. 2006b; Torres-Quezada et al. 2015). Prior to planting, which starts in mid-
September and ends in October, soil is fumigated for the control of soilborne pathogens
among other pests. Compacted raised beds are covered with black polythene plastic
mulch and transplants are planted in two staggered rows spaced 15-in in between
(Peres et al. 2006; Zuniga et al. 2017). The plant establishment period consists of 10 to
14 days of overhead irrigation and drip irrigation is used afterwards to provide water and
fertilizer during the season. The peak yield occurs in February and the season ends in
mid- to late March or early April when prices fall due to market competition (Zotarelli et
al. 2017; Zuniga et al. 2017).
Strawberry producers in Florida face many challenges to control the various
diseases affecting the crop during the season. One of the most important is Botrytis fruit
73
rot (BFR) or gray mold caused by the pathogen Botrytis cinerea (Grabke et al. 2014).
This fungus is considered the most important among Botrytis spp. because of its wide
host range affecting over 1400 plant species and the significant yield loss of
economically important crops such as strawberry, apple, lettuce, and others (Frías et al.
2016; Williamson et al. 2007).
Botrytis fruit rot control in Florida relies mainly on the use of fungicides. The
applications of fungicides are made weekly for the multi-sites thiram or captan that can
be rotated or tank mixed with the single sites during periods of peak bloom, as advised
by the Strawberry Advisory System (Amiri et al. 2013; Cordova et al. 2017). The
different fungicides available in the state are classified in five chemical classes:
succinate dehydrogenase inhibitors (SDHI), anilinopyrimidines (AP), phenylpyrroles
(PP), hydroxyanilides (Hyd), and quinone outside inhibitors (QoI), but the SDHI group is
the most popular due to its high efficacy (Amiri et al. 2013). The repetitive use of SDHI
fungicides has selected for resistant B. cinerea isolates due to their targeted mode of
action and resistance has been associated with different mutations in the SdhB subunit
(Fernández-Ortuño et al. 2012).
Recent studies by Oliveira et al. (2017) reported that B. cinerea did not survive
the high summer temperatures in Florida to serve as inoculum for next season. In
addition, the authors showed that strawberry transplants from nurseries are infected
with the pathogen, and that these isolates serving as the primary source of inoculum are
resistant to multiple fungicides. Although information about fungicide programs in the
nurseries is not widely available, the same fungicides used in strawberry commercial
74
fields are believed to be used in nurseries, which might explain the high resistance
frequencies observed by Amiri et al. (2014) for some SDHI’s.
Despite the pest management programs implemented by nurseries for the control
of pathogens causing different diseases, the certification program for transplants targets
viruses (Rahman et al. 2015; Strand 2008), and the production of disease-free
transplants is not guaranteed. One of the management practices used by some
nurseries is hot water of strawberry transplants to control mites (Herder and Turechek
2006). Heat treatment is also used in the sugarcane industry to produce disease-free
planting material (Cheavegatti-Gianotto et al. 2011; Ferreira and Comstock 1989;
Viswanathan and Rao 2011). The use of heat treatment has also been reported to
eliminate ‘Candidatus Liberibacter asiaticus’ infection on citrus seedlings (Hoffman et al.
2013). Furthermore, a study by Turechek and Peres (2009) showed that heat treatment
effectively controlled systemic infections on strawberry plants caused by the bacterium
Xanthomonas fragariae. Thus, our hypothesis was that heat treatments of nursery
transplants prior planting could reduce inoculum of B. cinerea including fungicide-
resistant isolates. Therefore, the objective of this study was to evaluate the efficacy of
heat treatment as a possible means to reduce B. cinerea populations on strawberry
transplants.
Materials and methods
Fungal Isolates
Four isolates of B. cinerea, 05-36, 10-37, 12-201, and 15-350 that were
previously collected during different strawberry seasons were used for in vitro and in
vivo studies. All isolates were collected from strawberry fruit from different locations in
Central Florida, US: Dover (05-26), Lake Wales (10-37), Balm (12-201), and Plant City
75
(15-350). Lake Wales is in Polk County whereas the other three cities are in
Hillsborough County, where most of the strawberry production takes place in the state.
Isolates were preserved as conidial suspensions in 1 mL of 20 % glycerol at -80˚C in
the strawberry pathology laboratory culture collection, located at the Gulf Coast
Research and Education Center (GCREC). To revive isolates, 6-cm diameter petri
dishes with HA medium (10g malt extract, 4g glucose, 4g yeast extract, 15g agar)
(Leroch et al. 2012) were used to transfer a small portion of the preserved suspension.
Plates were incubated for 6 to 7 days at 23˚C.
Fungicide Sensitivity Test
After the incubation period, a conidial suspension of 106 spore/mL was prepared
for each isolate using a hemacytometer. Two 7-μL drops of the suspension were placed
diagonally on 6-cm diameter petri dishes containing yeast bacto acetate agar (YBA; 10g
bacto peptone, 20g sodium acetate, 10g yeast extract, 15g agar). Plates were divided
into four quadrants allowing testing four isolates at a time and drops were placed in
each quadrant. YBA was amended with two concentrations of five different SDHI
compounds, 1 or 5 μg/mL of penthiopyrad, 2 or 5 μg/mL of fluopyram, 2 or 5 μg/mL of
boscalid, 1 or 5 μg/mL of benzovindiflupyr, and 1 or 5 μg/mL of isofetamid. Amiri et al.
(2013) previously determined the concentrations for penthiopyrad, fluopyram, and
boscalid. Control plates contained non-amended YBA. After inoculation, plates were
incubated for 18 to 24 h at 23˚C. To determine levels of fungicide resistance, a method
developed by Weber and Hahn (2011) was modified for this study. Each conidia germ
tube of 100 conidia counted using a microscope (10X) was given a rating according to
their fungicide sensitivity (Table 3-1). The number of conidia germinated in combination
with the rating of germ tube elongation (Figure 3-1) were used to determine levels of
76
fungicide resistance of each isolate to the compounds tested. One plate for each
fungicide concentration in combination with the isolates was used and the assay was
repeated twice.
Heat Treatment in Vitro
Effect of heat treatments on B. cinerea conidial survival
Conidia from each incubated isolate were used to prepare a 1-mL conidial
suspension of 103 spores/mL using a hemacytometer and 1.5 mL polypropylene
microcentrifuge tubes. Conidia were exposed to four temperatures, 44, 48, 52 and 56˚C
for seven different duration times, 1, 5, 10, 30, 60, 120 and 240 min. Four Isotemp
Digital-Control Water Baths (Model 210) (Figure 3-2) were used to reach the
temperatures tested. Floating racks made of styrofoam measuring 11.5-cm by 8-cm
were used to hold the tubes inside the water baths (Figure 3-3). Racks had a thickness
of 10-mm to allow immersion of the tubes in the water. After exposure of conidia to the
heat treatment, 100-μL of the suspension was transferred to 9-cm diameter petri dishes
containing potato dextrose agar (PDA; Becton Dickinson, Sparks, MD). PDA plates
were incubated at 23˚C for 18 to 24 h. To determine the percentage of spore survival,
100 spores were observed under a microscope (100x) to count the number of
germinated spores (Figure 3-4). The experiment was conducted twice using a split split
plot design with three replicated tubes per isolate (sub-subplot-factor C), per duration
time (subplot-factor B), and per temperature (whole plot-factor A). Data were analyzed
using a generalized linear mixed models fitted with a binomial distribution and means
were separated using Fisher’s protected least significant difference (LSD) test at P =
0.05.
77
Effect of heat treatments on B. cinerea sclerotial survival
Isolates 05-36, 10-37, 12-201, and 15-350 were grown on HA medium for 5 to 7
days at 23˚C. After sporulation of isolates, 4 plugs measuring 4 mm dimeter each were
taken with a cork borer from the plates and placed into 250 mL Erlenmeyer flasks
containing 90 mL of V8 medium (300 mL V8 juice, 4.3g CaCO3). Seven flasks were
used per isolate. A platform shaker InnovaTM 2100 (New Brunswick Scientific) was used
to continuously shake the flasks with a rotational speed of 110 rpm and they were
exposed to 12 h light at 23˚C for 5 days. Then, the content was ground and poured in 9-
cm diameter petri dish using approximately 16 mL each. Plates were stored in clear
plastic boxes at 5˚C for 45 days.
Sclerotia were harvested with sterile forceps and placed in 1.5 mL polypropylene
microcentrifuge tubes containing 1 mL of sterile deionized water. The number of
sclerotia per tube was determined by the sclerotial production of each isolate.
Styrofoam floating racks (11.5-cm x 8-cm) with 10-mm thickness were used to support
the tubes for immersion in Isotemp Digital-Control Water Baths (Model 210). Sclerotial
survival was tested at 44, 48, 52 or 56˚C for 1, 5, 10, 30, 60, 120 or 240 min. After heat
treatment, sclerotia were transferred to potato dextrose agar (PDA; Becton Dickinson,
Sparks, MD) on 9-cm diameter petri dishes and incubated for 48 hours at 23˚C.
Germination was evaluated to determine the percentage of germinated sclerotia (Figure
3-5). The experiment was repeated twice using two or three replicate tubes depending
on the isolate with a split split plot design. Data were analyzed following similar
statistical procedures used for conidial survival in vitro test.
78
Heat Treatment in Vivo
Effect of heat treatment on strawberry transplants
Bare-root, green-top strawberry transplants of the cultivar Florida Radiance
produced in a nursery in Nova Scotia, Canada, were shipped in early October 2016 to
GCREC where the trial was conducted. Transplants were established on October 19
and 20 on compacted, raised beds 71-cm wide, 32-cm high at the center, 26-cm high on
the edges and were 1.2-m apart measuring from their centers. Beds were fumigated
with 336.3 kg/Ha of 1,3-dichloropropene and chloropicrin (Telone® C-35, Dow
AgroSciences, Indianapolis, IN) before covering with black plastic mulch. Two
staggered rows of transplants spaced 30-cm apart were planted per bed with 38-cm
between rows. For establishment of the transplants, plants were overhead irrigated
using sprinklers for 10 to 12 days and drip irrigation system was used to provide water
and fertilizer for the rest of the season.
Upon arrival, transplants were sorted and labeled in different bundles, and
divided in two sets according to the experimental field design. One set of transplants
was inoculated with a spore suspension of 105 spore/mL using a spray bottle. Inoculum
was prepared using a hemacytometer to count the conidial suspensions of the four
isolates previously described. Then, each isolate was adjusted to the concentration
above to obtain a combined mixture of all isolates. The inoculum suspension was
prepared the same day of inoculation. The second set of transplants was sprayed with
water to maintain similar levels of humidity within both sets, approximately 3 mL of
water or B. cinerea inoculum was used per transplant. Non-inoculated and inoculated
transplants were incubated at room temperature (23˚C) for 18 to 24 h before heat
treatment.
79
Transplants were heat treated one day before planting using an adapted steam
chamber (Figure 3-6). To avoid cross-contamination, non-inoculated and inoculated
transplants were kept in different plastic bags. Treatments included: preheat at 37˚C for
1 h followed by heat treatment at 44˚C for 2 h, preheat at 37˚C for 1 h followed by heat
treatment at 44˚C for 4 h, heat treatment at 44˚C for 2 h, heat treatment at 44˚C for 4 h,
and non-treated control. After treatments, transplants were stored overnight in a cooler
at 4˚C. To determine the heat treatment effect after planting, fruit were harvested twice
weekly from 12 December 2016 to 9 March 2017 to evaluate Botrytis fruit rot incidence
and yield, and plants were counted weekly to obtain mortality data. The experiment was
conducted once using a split-plot design with four replications and fifteen plants per plot.
Replicates one and two were conducted separately from three and four, using different
inoculum batches and different inoculations, heat treatments, and planting dates.
Disease incidence, yield and plant mortality data were analyzed using generalized linear
mixed models procedure with a binomial distribution and a logit-link function using SAS
(version 9.4). Means were separated using Fisher’s protected least significant difference
(LSD) test at P = 0.05.
Detached leaf assay for colonization of B. cinerea
A detached leaf assay protocol (Oliveira et al. 2017) was followed to recover
natural fungal propagules, propagules after artificial inoculation, and after heat
treatments. For that, eight leaves from different transplants within each bundle were
collected before and after inoculation and after heat treatment. Leaves were kept in
bundles with the same label of origin, saved in sealable clear plastic bags of 22 x 30 cm
and then stored at -20˚C for over 24 h to induce senescence of the tissue. A total of 960
80
leaves collected from non-inoculated and inoculated transplants were used for this
experiment and they were stored separately to avoid cross-contamination.
Leaves were disinfested using sodium hypochlorite of 0.02% for 2 min and sterile
deionized water was used to rinse the leaves twice before incubation. Clear plastic
boxes 31.5 x 25 x 10 cm were used as moist chambers to incubate eight leaves/box for
7 days at 23˚C. To maintain high levels of humidity, 250 mL of sterile deionized water
were poured into the bottom of the box and wave-shaped chicken wire used to avoid
contact with the leaves (Figure 3-7). The evaluation consisted of examining the leaves
under a stereomicroscope (14X) to determine presence of B. cinerea (Figure 3-8). Leaf
assay data were analyzed through a generalized linear mixed models procedure and
Fisher’s protected least significant difference (LSD) test at P = 0.05 was used to
separate means.
Results
Phenotypic Characterization of Isolates
Four isolates (05-26, 10-37, 12-201, and 15-350) collected from strawberry fruit
in different locations in Central Florida were evaluated for fungicide sensitivity using the
conidial germination assay. According to our results (Table 3-2), isolate 05-26 was
sensitive to all five fungicides whereas the others isolates had different levels of
resistance. Isolates 10-37 and 12-201 showed similar results for boscalid with high
resistance levels in both, and only 10-37 was moderately resistant to penthiopyrad.
Resistance to the five fungicides tested was observed for the isolate 15-350 with high
resistance phenotypes to boscalid, penthiopyrad, and fluopyram, and moderate
resistance to benzovindiflupyr and isofetamid.
81
Heat Treatment in Vitro
Effect of heat treatments on B. cinerea conidial survival
Since the analysis of variance showed no significant differences (P ≥ 0.05)
between isolates, data were combined to analyze the effect of temperature and time
against B. cinerea conidial germination (Table 3-3). Our results (Figure 3-9) showed
spore germination (88.8%) in absence of heat treatments. When exposed to 44˚C,
germination was reduced to 78.3, 65.5, and 21.8% during 1, 5, and 10 min, respectively.
No germination was observed when spores were heat treated for 30, 60, 120, and 240
min at 44˚C. The temperatures 48, 52, and 56˚C inhibited spore germination by 100% at
5, 10, 30, 60, 120, and 240 min; at 1 min, these temperatures reduced germination by
15.3, 23.3, and 48.3%, respectively.
Effect of heat treatments on B. cinerea sclerotial survival
For this experiment, production of sclerotia was not sufficient for isolate 12-201,
therefore; only the isolates 05-26, 10-37, and 15-350 were used. The analysis of
variance was significantly different (P ≤ 0.05) for the variables: isolate, temperature, and
time, and their interactions (Table 3-4). Thus, isolates were analyzed separately within
each temperature tested. Sclerotia not exposed to heat treatments had 100%
germination for all isolates tested. Results for the effect of 44˚C (Figure 3-10A) on B.
cinerea germination of sclerotia were similar for isolates 10-37 and 15-350, compared to
isolate 05-26, whose germination was reduced from 100% at 1 min to 60 , 25, and 0%
at 5, 10, and 30 and 60 min, respectively. At 120 min, 8.5% germination was observed
but not at 240 min (0%) (Figure 3-10A). This differs from isolates 10-37 and 15-350 that
maintained germination of sclerotia between 100 and 91.5% from 1 to 60 min. Sclerotia
of isolate 10-37 still geminated at 120 min (87.5%) of exposure to heat but it was
82
reduced to 2% when the exposure reached 240 min. In contrast, isolate 13-350 had its
germination reduced to 33.5% at 120 min but interestingly increased to 44.3% at the
highest time tested. Sclerotia exposed to 48˚C (Figure 3-10B) had different responses
according to the isolate. For example, isolate 05-26 germinated at 1 and 5 min with 100
and 8.5%, respectively, and 0% for the remaining duration times. Germination on isolate
10-37 was observed in a range of 100 to 62.5% among all the times tested whereas on
isolate 15-350 germination was reduced to 7% at 60 min but increased to 12 and 23%
for the following times. The results obtained for 52˚C (Figure 3-10C) showed higher
inhibition of sclerotial germination compared to the previous temperatures. The isolate
05-26 did not germinate at 5 min whereas germination on isolates 10-37 and 15-350
decreased at this duration time by 52 and 77.5%, respectively, but still germinated at
240 min with 2% each. Finally, the highest temperature tested (56˚C) (Figure 3-10D)
showed less variable results for the three isolates. In the case of 05-26, germination
was observed only at 1minute with 48.5%. A similar tendency was observed between
10-37 and 15-350 with inhibition of sclerotial germination at 1 min (6 to 9%), 30 min
(91.5 to 93.5%), and 100% inhibition at 240 min for both isolates.
Heat Treatment in Vivo
Effect of heat treatment of strawberry transplants
After planting, fruit were harvested twice a week to evaluate effect of the heat
treatment on disease incidence. The analysis of variance was not significantly different
among treatments (P ≥ 0.05) compared to the non-treated control for both: non-
inoculated and inoculated plants. Disease incidence for non-inoculated plants (Figure 3-
11) that were not exposed to heat treatment was 5.6%, similar to 5.2, 4.6, 5.5, 5.2%
obtained for the different treatments: preheat at 37˚C for 1 h followed by heat treatment
83
at 44˚C for 2 h, preheat at 37˚C for 1 h followed by heat treatment at 44˚C for 4 h, heat
treatment at 44˚C for 2 h, and heat treatment at 44˚C for 4 h, respectively. The
corresponding BFR incidences for inoculated plants were 6.1, 5.4, 5.1, 5.4, and 5.6%
(Figure 3-11). Overall, incidence of Botrytis fruit rot in the experimental area was the
highest at 6.1% during the 2016-2017 strawberry season.
Heat treatment effect was not significantly different (P ≥ 0.05) between
treatments and control (Table 3-5). Non-inoculated and inoculated plants produced
20,323 and 20,110 kg/Ha of strawberry in the non-treated control, respectively. Plant
mortality was evaluated weekly to determine effect of heat treatments on plant survival
after planting. Similar to strawberry yield results, no significant differences (P ≥ 0.05)
were found among treatments on plant mortality (Figure 3-12). The non-treated control
of non-inoculated plants showed mortality incidence of 8.9% and 1.8% on inoculated
plants.
Detached leaf assay for colonization of B. cinerea
The frequency of B. cinerea colonization on strawberry nursery transplants
before inoculation was 42.5%. After plants were sprayed with water or inoculated with a
spore suspension of B. cinerea, the overall frequency of colonization was 59.4 and
71.9%, respectively (Figure 3-13).
There were significant differences (P ≤ 0.05) among treatments on non-
inoculated plants that were sprayed only with water (Figure 3-14). Leaves from non-
treated plants showed higher incidence of B. cinerea infection (60%) compared to plants
heat-treated for 2 h with pre-heat (25%) or without pre-heat (34.4%). B. cinerea
colonization was not observed on leaves from plants treated for 4 h with or without pre-
heat and treatments were not significantly different. On inoculated plants, all treatments
84
were significantly different (P ≤ 0.05) from the control (Figure 3-15). B. cinerea
incidence was 75% on leaves collected from plants that were not exposed to heat,
whereas 21.9 and 37.5% incidence were observed on leaves from plants heat-treated
for 2 h with or without pre-heat, respectively. Better results were obtained for treatments
conducted for 4 h where B. cinerea incidence on leaves was 0% with pre-heat step and
3.1% without pre-heat.
Discussion
In this study, survival of B. cinerea conidia was not significantly different among
the four isolates tested at different temperatures and times. Three isolates were
resistant to SDHI fungicides, and one was sensitive, but conidial germination from all
were totally inhibited at 30 min when exposed to 44˚C and at 5 min for 48, 52, and 56˚C.
This indicates that conidia of fungicide resistant and sensitive isolates of B. cinerea are
equally sensitive to heat treatments. Considering resistance of this pathogen is
associated with mutations in the SdhB subunit (Fernández-Ortuño et al. 2012), our
results might suggest there are no fitness penalties related to high temperatures on
mutated isolates. However, future investigation using larger numbers of isolates with
characterized genotypes is needed to determine the effect of heat treatments on
isolates with different SdhB mutations.
The results for conidial survival were contradicted by results obtained with
sclerotia. In contrast to conidia, a significant difference was found between isolates and
the effect of heat treatment on germination of sclerotia. Overall, the fungicide-sensitive
isolate was more sensitive to all temperatures tested as compared to resistant isolates.
We observed that heat sensitivity was variable between isolates of B. cinerea, therefore,
85
additional research with a larger number of both fungicide sensitive and resistant
isolates will be required before conclusions can be drown.
Variability in vitro of the pathogen in relation to sclerotial production was
previously reported by Kumai et al. (2014) with no sclerotia produced by 38% of their
isolates. In our case, variation in survival frequency might be due to the size of the
sclerotium and the number of sclerotia used for the experiment. In our study, we did not
measure or select for any particular size, but variation in size within and among isolates
was observed. Therefore, different numbers and sizes of sclerotia were used, which
could have resulted in the irregular germination during the different times tested.
Another reason could be the resistance to SDHI fungicides and associated mutations.
The substitutions in the subunit B of the SDH complex could play a role in the survival of
B. cinerea sclerotia at high temperatures. A study by Amiri et al. (2014) showed
production of sclerotia by isolates harboring SdhB mutations was significantly lower
than wild type or sensitive isolates. In contradiction to results reported by Veloukas et al.
(2014) showing high sclerotial production in the presence of these mutations but their
viability at 37˚C was significantly lower compared to sensitive isolates. However, these
authors tested production and not survival of sclerotia in relation to the mutations,
therefore, future studies on the effect of size and genotype would certainly help to better
understand the response of sclerotia to heat.
The treatment at 44˚C for 4 h in vitro was efficacy at inhibiting and reducing B.
cinerea conidial and sclerotial germination, respectively. Elad et al. (2017) reported that
B. cinerea conidia can survive temperatures up to 40˚C.
86
Tolerance of strawberry plants to heat depends on the cultivar but 44˚C for 4 h
was the treatment found to cause minimum damage to most cultivars tested (Turechek
and Peres 2009). This time-temperature combination was also found to significantly
reduce bacterial infections by Xanthomonas fragariae. Thus, these parameters were
used in the field trials to determine the effect of heat treatment on B. cinerea incidence
on strawberry nursery transplants.
During the 2016-2017 strawberry season, transplants of the cultivar Florida
Radiance from one nursery were heat-treated and planted in the experimental area at
GCREC. Disease incidence was very low even on the non-treated plants (6.1%), which
prevented us from determining the effect of heat treatments against Botrytis fruit rot.
The incidence of BFR was also reported at very low frequencies during the same
season in other experimental trials in commercial fields in the area (Cordova et al.
2017a; Zuniga et al. 2017). Other parameters such as yield and plant mortality were
also evaluated in this study. No effect of heat treatment on strawberry yield was
observed, indicating production is not reduced when plants are exposed to heat. Plant
mortality data showed no effect of heat on plant survival. Similar results were obtained
by Turechek and Peres (2009) and Turechek et al. (2013) for strawberry cultivars
Diamante, Camino Real, Oso Grande, Strawberry Festival, and Camarosa that were
heat treated in hot water at 44˚C for 4 h and bagged dry. Based on these, it could be
assumed that heat treatment of strawberry transplants would not result in high mortality
in the fields; however, these authors used hot water as the heat source in contrast to
steam used in our experiment. Thus, further investigation is needed to look at the effect
of heat using steam on the survival of different strawberry cultivars.
87
The detached leaf assays indicated that B. cinerea incidence was significantly
reduced when plants were heat treated at 44˚C for 4 h with or without preheat. The
preheat step was applied at 37˚C for 1 h to induce production of heat shock proteins in
the plant to help them survive the 4 h of heat treatment at 44˚C. Although plant mortality
in the field trial was not significantly different between treatments with and without
preheat, it seems the extra h of exposure to heat helped reduce inoculum of the
pathogen. Overall, our results indicate that heat treatment represents a highly effective
practice to reduce B. cinerea inoculum on strawberry transplants. Most importantly, heat
treatment can reduce the fungicide-resistant population that remain as quiescent
infections until environmental conditions are conducive to infect plants in the fields. Heat
treatment has also been reported to be effective against Xanthomonas fragariae
causing angular leaf spot on strawberry (Turechek et al. 2013), and Botrytis cinerea
causing grey mold (Elad et al. 2017) and Peronospora belbahrii causing downy mildew
(Elad et al. 2016c) on sweet basil. Since previous studies by Turechek and Peres
(2009) showed that heat treatment of strawberry plants can delay plant growth and
affect production of flowers, this practice is advised to be performed at the nurseries
before the final multiplication cycle and delivery for strawberry commercial production.
Reducing B. cinerea fungicide-resistant inoculum at the nursery level can help
strawberry fruit growers to improve the efficacy of fungicides currently available to
control Botrytis fruit rot.
88
Table 3-1. Characterization of resistance phenotypes of Botrytis cinerea isolates based on conidial germination assays
Lower concentration Higher concentration
Phenotypea Germination (%)b Ratingc Germination (%) Rating
Sensitive <50 -1 0 0
Moderately Resistance >50 1 <50 -1
Highly Resistance >50 2,3 <50 >1 a Phenotypes were determined by the spore germination assay modified for this study and originally developed by Weber and Hahn (2011). b Two different fungicide concentrations were used to determine the percentage of geminated B. cinerea conidia. c Germ tube elongation was given a rating of -1, 0, 1, 2, and 3 (illustrated in Figure 3-1).
Figure 3-1. Germinated Botrytis cinerea conidia and the corresponding rating for germ
tube elongation: A) Non-germinated conidia (0); B) Germ tube same size as conidia (-1); C) Germ tube double the size of conidia (1); D) Germ tube triple the size of conidia (2); and E) Germ tube size-x4 bigger than conidia (3). September 1, 2017. Courtesy of Adrian Zuniga.
89
Figure 3-2. Isotemp Digital-Control Water Baths (Model 210) used to heat treat Botrytis cinerea conidia and sclerotia. September 21, 2017. Courtesy of Adrian Zuniga.
Figure 3-3. Styrofoam floating racks used for heat treatment experiments of Botrytis cinerea conidia and sclerotia. A) Top view. B) Lateral view. September 21, 2017. Courtesy of Adrian Zuniga.
90
Figure 3-4. Survival evaluation of Botrytis cinerea conidial germination under the microscope (100x) after heat treatments. A) Non-germinated conidia. B) Germinated conidia. June 7, 2017. Courtesy of Adrian Zuniga.
Figure 3-5. Survival evaluation of Botrytis cinerea sclerotial germination after heat treatments. A) Non-germinated sclerotia. B) Germinated sclerotia. July 15, 2017. Courtesy of Adrian Zuniga.
91
Figure 3-6. Adapted steam chamber used for the heat treatments of strawberry transplants. March 23, 2017. Courtesy of Adrian Zuniga.
Figure 3-7. Incubation of strawberry leaves for the evaluation of heat treatment effect on
Botrytis cinerea. April 19, 2017. Courtesy of Adrian Zuniga.
92
Figure 3-8. Evaluation of Botrytis cinerea infection on strawberry leaves. A) Infection observed by naked eye. B) Examination of conidiophores and conidia of B. cinerea using a stereomicroscope (14x). August 28, 2017. Courtesy of Adrian Zuniga.
Table 3-2. Phenotypic characterization of isolates used in this study
Phenotypea
Isolateb Isofetamid Benzovindiflupyr Fluopyram Penthiopyrad Boscalid
05-26 S S S S S
10-37 S S S MR HR
12-201 S S S S HR
15-350 MR MR HR HR HR a Different levels of fungicide resistance were classified in three categories: sensitive (S), moderately resistant (MR), and highly resistant (HR). The fungicide concentrations used were 2 or 5 μg/mL of boscalid (Endura) and fluopyram (Luna Privilege), and 1 or 5 μg/mL of penthiopyrad (Fontelis), benzovindiflupyr (not registered for strawberries) and isofetamid (Kenja) each. b Isolates were collected from symptomatic fruit during different strawberry seasons.
93
Table 3-3. Analysis of variance of Botrytis cinerea conidial survival after heat treatment
Variable df F Pa
Isolate 3 0.71 0.5494
Temperature 3 22.87 <0.0001
Time 7 481.09 <0.0001
Isolate x temperature 9 1.19 0.3063
Isolate x time 21 1.38 0.1363
Temperature x time 21 20.70 <0.0001 a The P value indicates the significant difference based on least significant difference test at P ≤ 0.05 between variables isolate, temperature, time, and their interaction, and data were analyzed using a generalized linear mixed model.
Figure 3-9. Percentage of Botrytis cinerea conidial germination from isolates 05-26, 10-
37, 12-201, and 15-350 after heat treatment at 44, 48, 52, and 56˚C for seven different duration times in minutes.
94
Table 3-4. Analysis of variance of Botrytis cinerea sclerotial survival after heat treatment
Variable df F Pa
Isolate 2 291.66 <0.0001
Temperature 3 35.27 <0.0001
Time 7 43.15 <0.0001
Isolate x temperature 6 48.14 <0.0001
Isolate x time 14 23.26 <0.0001
Temperature x time 21 1.74 0.0964 a The P value indicates the significant difference based on least significant difference test at P ≤ 0.05 between variables isolate, temperature, time, and their interaction, and data were analyzed using a generalized linear mixed model.
95
Figure 3-10. Percentage of Botrytis cinerea sclerotia germination of isolates with different resistance phenotypes in response to heat treatment at: A) 44, B) 48, C), 52, and D) 56˚C.
96
Figure 3-11. Botrytis fruit rot (BFR) incidence in field experiment during the 2016-2017 strawberry season after heat treatment of non-inoculated and inoculated transplants. Each bar represent the disease incidence of four replicate plots of 15 plants each. Open and filled bars, independently, with the same letter are not significantly different based on least significant difference test at P ≥ 0.05.
Table 3-5. Strawberry yield in field experiment during 2016-2017 strawberry season
after heat treatment of plants inoculated or not with Botrytis cinerea
Yield (kg/Ha)a
Treatment Non-inoculated Inoculated
Non-treated control 20,323 a 20,110 a
Preheat (37°C, 1 h) + Heat treatment (44°C, 2h) 21,734 a 23,389 a
Preheat (37°C, 1 h) + Heat treatment (44°C, 4h) 19,889 a 19,921 a
Heat treatment (44°C, 2h) 22,515 a 17,924 a
Heat treatment (44°C, 4h) 16,018 a 22,468 a a Yield produced in four replicated plots of 15 plants each per treatment. Columns with the same letter are not significantly different based on least significant difference test at P ≥ 0.05.
0
1
2
3
4
5
6
7
8
9
10
Non-treated control Pre-heat (37°C, 1 h)+ Heat treatment
(44°C, 2h)
Pre-heat (37°C, 1 h)+ Heat treatment
(44°C, 4h)
Heat treatment(44°C, 2h)
Heat treatment(44°C, 4h)
BF
R in
cid
en
ce
(%
)Non-inoculated
Inoculated
A
A
AA
AA
AAAA
97
Figure 3-12. Plant mortality (%) in a field experiment during 2016-2017 strawberry season after heat treatment of non-inoculated and inoculated transplants. Each bar represents the disease incidence of four replicate plots with 15 plants each. Open and filled bars, independently, with the same letter are not significantly different based on least significant difference test at P ≥ 0.05.
Figure 3-13. Percentage of Botrytis cinerea colonization on strawberry plants before inoculation (Natural Inoculum), after water spray (Non-inoculated), and after inoculation (Inoculated).
0
2
4
6
8
10
12
14
16
18
20
Non-treated control Pre-heat (37°C, 1 h)+ Heat treatment
(44°C, 2h)
Pre-heat (37°C, 1 h)+ Heat treatment
(44°C, 4h)
Heat treatment(44°C, 2h)
Heat treatment(44°C, 4h)
Pla
nt m
ort
alit
y (
%)
Non-inoculated
Inoculated
AA
A
A
A
A
A
A
A
A
42.5
59.4
71.9
0
10
20
30
40
50
60
70
80
Natural Inoculum Non-Inoculated Inoculated
B. cin
ere
a incid
en
ce
(%
)
98
Figure 3-14. Incidence of Botrytis cinerea on leaves collected from non-inoculated plants after heat treatment. Each bar represent incidence of 32 evaluated leaves per treatment. Bars with different letters are significantly different based on least significant difference test at P ≤ 0.05. The error bars indicate the standard deviation of four replicates within each treatment.
Figure 3-15. Incidence of Botrytis cinerea on leaves collected from inoculated plants after heat treatment. Each bar represents incidence of 32 evaluated leaves per treatment. Bars with different letter are significantly different based on least significant difference test at P ≤ 0.05. The error bars indicate the standard deviation of four replicates within each treatment.
0.0
10.0
20.0
30.0
40.0
50.0
60.0
70.0
80.0
90.0
100.0
Non-treated control Pre-heat (37°C, 1 h)+ Heat treatment
(44°C, 2h)
Pre-heat (37°C, 1 h)+ Heat treatment
(44°C, 4h)
Heat treatment(44°C, 2h)
Heat treatment(44°C, 4h)
B. cin
ere
a incid
en
ce
(%
)
A
AB
B
C C
0.0
10.0
20.0
30.0
40.0
50.0
60.0
70.0
80.0
90.0
100.0
Non-treated control Pre-heat (37°C, 1 h)+ Heat treatment
(44°C, 2h)
Pre-heat (37°C, 1 h)+ Heat treatment
(44°C, 4h)
Heat treatment(44°C, 2h)
Heat treatment(44°C, 4h)
B. cin
ere
a incid
en
ce
(%
)
A
B
BC
CC
99
CHAPTER 4 CONCLUSIONS
For over a decade, the use of succinate-dehydrogenase inhibitor (SDHI)
fungicides have formed part of the disease management program for Botrytis fruit rot
(BFR) in strawberry commercial fields in Florida. The rapid selection for resistance to
single-site fungicides observed in Botrytis cinerea, the causal agent of this disease,
represents an imminent threat to the efficacy of this group against BFR. Evaluation of
isofetamid, the newest SDHI registered for BFR on strawberry in Florida, showed high
activity against baseline isolates with no prior exposure, inhibiting 50% of the pathogen
growth at very low concentrations. Resistance to SDHI fungicides are linked to
mutations in the subunit B of the SDH complex (i.e. H272R, H272Y, N230I, and P225F)
but our results showed that only the mutations N230I and P225F conferred moderate
and high resistance to isofetamid, respectively.
B. cinerea isolates resistant to boscalid and penthiopyrad were found at higher
frequencies than compared to fluopyram and benzovindiflupyr, whereas resistance to
isofetamid was very low. Thus, boscalid and penthiopyrad should no longer be used to
control BFR in strawberry fields. If benzovindiflupyr were to be registered for strawberry,
it should be used with caution considering it belongs to the same sub-chemical group as
penthiopyrad. Isofetamid had a very low frequency of resistance but to avoid selection
pressure, its use should be restricted to three applications per season during peak
bloom or when environmental conditions are conducive for disease development as
determine by the Strawberry Advisory System.
Our findings demonstrate that resistance to older SDHIs has increased in Florida
fields in the two seasons tested and to previous studies. This suggests that
100
improvement of fungicide resistance management in strawberry production is necessary
to conserve the efficacy against BFR of newly registered fungicides such as isofetamid.
An alternative strategy for management of fungicide resistance could be the use
of heat treatment on strawberry transplants, considering they represent the primary
source of B. cinerea inoculum for commercial fields. Our study showed that the infective
propagules of the pathogen (conidia and sclerotia) were sensitive to heat and the field
experiment demonstrated that the use of heat did not have a negative effect on
strawberry yield or plant mortality. Although B. cinerea colonization was significantly
reduced when transplants were treated with heat, future investigation is needed to
determine effect of heat on overall BFR incidence. Nevertheless, we can conclude that
the use of heat treatment is an effective and feasible strategy to reduce resistant
populations of B. cinerea on strawberry transplants, and it could be performed at the
nurseries before delivery for strawberry commercial production.
101
LIST OF REFERENCES
Albregts, E., Howard, C., and Chandler, C. K. 1992. Defoliation of strawberry transplants for fruit production in Florida. HortScience 27:889-891.
Amiri, A., Heath, S., and Peres, N. 2012. Sensitivity of Botrytis cinerea field isolates to
the novel succinate dehydrogenase inhibitors fluopyram, penthiopyrad, and fluxapyroxad. (Abstr.) Phytopathology 102:S4.4.
Amiri, A., Heath, S., and Peres, N. 2013. Phenotypic characterization of multifungicide
resistance in Botrytis cinerea isolates from strawberry fields in Florida. Plant Disease 97:393-401.
Amiri, A., Heath, S. M., and Peres, N. A. 2014. Resistance to fluopyram, fluxapyroxad,
and penthiopyrad in Botrytis cinerea from strawberry. Plant Disease 98:532-539. Amiri, A., and Peres, N. A. 2014. Diversity in the erg27 gene of Botrytis cinerea field
isolates from strawberry defines different levels of resistance to the hydroxyanilide fenhexamid. Plant Disease 98:1131-1137.
Avenot, H. F., Sellam, A., Karaoglanidis, G., and Michailides, T. 2008. Characterization
of mutation in the iron-sulphur subunit of succinate dehydrogenase correlating with boscalid resistance in Alternaria alternata from California pistachio. Phytopathology 98:736-742.
Avenot, H. F., Van Den Biggelaar, H., Morgan, D. P., Moral, J., Joosten, M., and
Michailides, T. 2014. Sensitivities of baseline isolates and boscalid-resistant mutants of Alternaria alternata from pistachio to fluopyram, penthiopyrad, and fluxapyroxad. Plant Disease 98:197-205.
Beever, R. E., and Weeds, P. W. 2007. Taxonomy and genetic variation of Botrytis and
Botryotinia. Pages 29-52 in: Botrytis: biology, pathology and control. Y. Elad, B. Williamson, P. Tudzynski and N. Delen, eds. Springer.
Black, B. L., Enns, J. M., and Hokanson, S. C. 2002. A comparison of temperate-climate
strawberry production systems using eastern genotypes. HortTechnology 12:670-675.
Bulger, M., Ellis, M., and Madden, L. 1987. Influence of temperature and wetness
duration on infection of strawberry flowers by Botrytis cinerea and disease incidence of fruit originating from infected flowers. Phytopathology 77:1225-1230.
Carisse, O. 2016. Epidemiology and aerobiology of Botrytis spp. Pages 127-148 in:
Botrytis - the fungus, the pathogen and its management in agricultural systems. S. Fillinger and Y. Elad, eds. Springer.
102
Carpenter, J. E., Gianessi, L. P., and Lynch, L. 2000. The economic impact of the scheduled US phaseout of methyl bromide. National Center for Food and Agricultural Policy, Washington D.C.
Cheavegatti-Gianotto, A., De Abreu, H.M.C., Arruda, P., Bespalhok Filho, J. C., Lee
Burnquist, W., Creste, S., Di Ciero, L., Ferro, J. A., Oliveira Figueira, A. V., Sousa Filgueiras, T., Grossi-de-Sa, M. F., Guzzo, E. C., Hoffmann, H. P., Andrade Landell, M. G., Macedo, N., Matsouka, S., Castro Reinach, F., Romano, E., Da Silva, W. J., Castro Silva Filho, M., and Ulian, E. C. 2011. Sugarcane (Saccharum x officinarum): A reference study for the regulation of genetically modified cultivars in Brazil. Tropical Plant Biology 4:62-89.
Cordova, L. G., Madden, L. V., Amiri, A., Schnabel, G., and Peres, N. A. 2017b. Meta-
analysis of a web-based disease forecast system for control of anthracnose and Botrytis fruit rots of strawberry in southeastern United States. Plant Disease 101:1910-1917.
Cordova, L., Zuniga, A. I., Mertely, J., and Peres, N. A. 2015. Evaluation of products for
control of Botrytis fruit rot in annual strawberry, 2014-15. Plant Disease Management Report 9:SMF020.
Cordova, L., Zuniga, A. I., Mertely, J., and Peres, N. A. 2017a. Evaluation of biorational
products for control of Botrytis fruit rot in annual strawberry, 2016-17. Plant Disease Management Report 11:SMF022.
Cosseboom, S., Ivors, K., Schnabel, G., and Holmes, G. 2018. First report of Botrytis
mali causing gray mold on strawberry in California. Plant Disease: PDIS-10-17-1539-PDN.
Daferera, D. J., Ziogas, B. N., and Polissiou, M. G. 2003. The effectiveness of plant
essential oils on the growth of Botrytis cinerea, Fusarium sp. and Clavibacter michiganensis subsp. michiganensis. Crop Protection 22:39-44.
Damicone, J. P., and Smith, D. L. 2009. Fungicide resistance management. Division of
Agricultural Sciences and Natural Resources, Oklahoma State University. Online document available at: http://pods.dasnr.okstate.edu/docushare/dsweb/Get/Rendition-3508/F-7663web.pdf.
De Meyer, G., Bigirimana, J., Elad, Y., and Höfte, M. 1998. Induced systemic resistance
in Trichoderma harzianum T39 biocontrol of Botrytis cinerea. European Journal of Plant Pathology 104:279-286.
De Miccolis Angelini, R. M., Pollastro, S., and Faretra, F. 2016. Genetics of Botrytis
cinerea. Pages 35-53 in: Botrytis - the fungus, the pathogen and its managements in agricultural systems. S. Fillinger and Y. Elad, eds. Springer.
103
Dewey, F. M., and Grant-Downton, R. 2016. Botrytis - Biology, detection and quantification. Pages 17-34 in: Botrytis - the fungus, the pathogen and its managements in agricultural systems. S. Fillinger, Elad, Y., ed. Springer.
DiMeglio, L. M., Staudt, G., Yu, H., and Davis, T. M. 2014. A phylogenetic analysis of
the genus Fragaria (strawberry) using intron-containing sequence from the ADH-1 gene. PloS one 9:e102237.
Dittmar, P. J., Dufault, N. S., Noling, J. W., Stansly, P., Boyd, N., Paret, M. L., and
Webb, S. E. 2017. Integrated pest management. Pages 19-29 in: Vegetable production handbook of Florida. G. E. Vallad, J. H. Freeman, H. Smith and P. J. Dittmar, eds., University of Florida - IFAS Extension, Gainesville-FL.
Dowling, M. E., Hu, M.-J., and Schnabel, G. 2017. Fungicide resistance in B. fragariae
and species prevalence in the mid-Atlantic United States. Plant Disease DOI: 10.1094/PDIS-10-17-1615-RE.
Droby, S., and Lichter, A. 2007. Post-harvest Botrytis infection: etiology, development
and management. Pages 349-367 in: Botrytis: biology, pathology and control. Y. Elad, B. Williamson, P. Tudzynski and N. Delen, eds. Springer.
Elad, Y. 2016. Cultural and integrated control of Botrytis spp. Pages 149-164 in: Botrytis
- the fungus, the pathogen and its managements in agricultural systems. S. Fillinger and Y. Elad, eds. Springer.
Elad, Y., Omer, C., Nisan, Z., Harari, D., Goren, H., Adler, U., Silverman, D., and Biton,
S. 2016c. Passive heat treatment of sweet basil crops suppresses Peronospora belbahrii downy mildew. Annals of applied biology 168:373-389.
Elad, Y., Pertot, I., Cotes Prado, A. M., and Stewart, A. 2016b. Plant hosts of Botrytis
spp. Pages 413-486 in: Botrytis - the fungus, the pathogen and its managements in agricultural systems. S. Fillinger, Elad, Y., ed. Springer.
Elad, Y., Rav David, D., Israeli, L., and Fogel, M. 2017. Passive heat treatment of sweet
basil crops suppresses white mould and grey mould. Plant Pathology 66:105-114.
Elad, Y., Vivier, M., and Fillinger, S. 2016a. Botrytis, the good, the bad and the ugly.
Pages 1-15 in: Botrytis - the fungus, the pathogen and its managements in agricultural systems. S. Fillinger, Elad, Y., ed. Springer.
Elad, Y., Williamson, B., Tudzynski, P., and Delen, N. 2007. Botrytis spp. and diseases
they cause in agricultural systems - an introduction. Pages 1-8 in: Botrytis: Biology, pathology and control. Y. Elad, B. Williamson, P. Tudzynski and N. Delen, eds. Springer.
104
Elmer, P. A. G., and Michailides, T. J. 2007. Epidemiology of Botrytis cinerea in orchards and vine crops. Pages 243-272 in: Botrytis: biology, pathology and control. Y. Elad, B. Williamson, P. Tudzynski and N. Delen, eds. Springer.
Esterio, M., Araneda, M., Román, A., Pizarro, L., Copier, C., and Auger, J. 2015. First
report of boscalid resistant Botrytis cinerea isolates carrying the mutations H272R, H272Y, P225L, and P225H from table grape in Chile. Plant Disease 99:891-891.
FAOSTAT. 2017. Strawberry production. Food and Agriculture Organization of the
United Nations. Statistic division. Accessed: October 19, 2017. Available: http://faostat3.fao.org/.
Fernandez, G. E., Butler, L. M., and Louws, F. J. 2001. Strawberry growth and
development in an annual plasticulture system. HortScience 36:1219-1223. Fernández-Ortuño, D., Chen, F., and Schnabel, G. 2012. Resistance to pyraclostrobin
and boscalid in Botrytis cinerea isolates from strawberry fields in the Carolinas. Plant disease 96:1198-1203.
Ferreira, S. A., and Comstock, J. C. 1989. Smut. Pages 211-230 in: Diseases of
Sugarcane: Major Diseases. C. Ricaud, B. T. Egan, A. G. Gillaspie and C. G. Hughes, eds. Elsevier.
Fillinger, S., and Walker, A. S. 2016. Chemical control and resistance management of
Botrytis diseases. Pages 189-216 in: Botrytis - the fungus, the pathogen and its managements in agricultural systems. S. Fillinger and Y. Elad, eds. Springer.
Finn, C., Hancock, J., and Heider, C. 1998. Notes on the strawberry of Ecuador: Ancient
land races, the community of farmers, and modern production. HortScience 33:583-587.
Forster, B., and Staub, T. 1996. Basis for use strategies of anilinopyrimidine and
phenylpyrrole fungicides against Botrytis cinerea. Crop Protection 15:529-537. FRAC. 2017. Fungicide Resistance Action Committee (FRAC) Code List 2017:
Fungicides sorted by mode of action (including FRAC Code numbering). Crop Life International, Brussels, Belgium. Online document available at: http://www.frac.info.
Frías, M., González, M., González, C., and Brito, N. 2016. BcIEB1, a Botrytis cinerea
secreted protein, elicits a defense response in plants. Plant Science 250:115-124.
105
Förster, H., Kanetis, L., and Adaskaveg, J. E. 2004. Spiral gradient dilution, a rapid method for determining growth responses and 50% effective concentration values in fungus-fungicide interactions. Phytopathology 94:163-170.
Garcia, M. E., and Ernst, T. 2015. Organic strawberry production in high tunnels.
PowerPoint Slides. Online document available at: https://www.slideshare.net. Geisseler, D., and Horwath, W. R. 2014. Strawberry production in California. Fertilizer
Research and Education Program (FREP):p.4. Online document available at: http://apps.cdfa.ca.gov/frep/docs/Strawberry_Production_CA.pdf.
Gordon, T. R., Kirkpatrick, S. C., Shaw, D. V., and Larson, K. D. 2002. Differential
infection of mother and runner plant generations by Verticillium dahliae in a high elevation strawberry nursery. HortScience 37:927-931.
Grabke, A., Fernández-Ortuño, D., Amiri, A., Li, X., Peres, N. A., Smith, P., and
Schnabel, G. 2014. Characterization of iprodione resistance in Botrytis cinerea from strawberry and blackberry. Phytopathology 104:396-402.
Grant, O. M., Davies, M. J., Johnson, A. W., and Simpson, D. W. 2012. Physiological
and growth responses to water deficits in cultivated strawberry (Fragaria× ananassa) and in one of its progenitors, Fragaria chiloensis. Environmental and Experimental Botany 83:23-32.
Hall T. A. 1999. BioEdit: a user-friendly biological sequence alignment editor and
analysis program for windows 95/98/NT. Nucleic Acids. Symp. Ser. 41:95-98. Hancock, J. F., and Luby, J. J. 1993. Genetic resources at our doorstep: the wild
strawberries. BioScience 43:141-147. Hancock, J. F., Sjulin, T. M., and Lobos, G. A. 2008. Strawberries. Pages 393-437 in:
Temperate Fruit Crop Breeding: Germplasm to Genomics. J. F. Hancock, ed. Springer Netherlands, Dordrecht.
Herder, K., and Turechek, W. 2006. Evaluating hot-water treatment as means for
eradicating Xanthomonas fragariae in strawberry nursery stock. (Abstr.) Phytopathology 96:S47.
Hochmuth, G., Cantliffe, D., Chandler, C., Stanley, C., Bish, E., Waldo, E., Legard, D.,
and Duval, J. 2006a. Fruiting responses and economics of containerized and bare-root strawberry transplants established with different irrigation methods. HortTechnology 16:205-210.
106
Hochmuth, G., Cantliffe, D., Chandler, C., Stanley, C., Bish, E., Waldo, E., Legard, D., and Duval, J. 2006b. Containerized strawberry transplants reduce establishment-period water use and enhance early growth and flowering compared with bare-root plants. HortTechnology 16:46-54.
Hoffman, M. T., Doud, M. S., Williams, L., Zhang, M.-Q., Ding, F., Stover, E., Hall, D.,
Zhang, S., Jones, L., Gooch, M., Fleites, L., Dixon, W., Gabriel, D., and Duan, Y.-P. 2013. Heat treatment eliminates ‘Candidatus Liberibacter asiaticus’ from infected citrus trees under controlled conditions. Phytopathology 13:15-22.
Hokanson, S. C., Takeda, F., Enns, J. M., and Black, B. L. 2004. Influence of plant
storage duration on strawberry runner tip viability and field performance. HortScience 39:1596-1600.
Holz, G., Coertze, S., and Williamson, B. 2007. The ecology of Botrytis on plant
surfaces. Pages 9-27 in: Botrytis: biology, pathology and control. Y. Elad, B. Williamson, P. Tudzynski and N. Delen, eds. Springer.
Hu, M.-J., Dowling, M. E., and Schnabel, G. 2018. Genotypic and Phenotypic Variations
in Botrytis spp. Isolates from Single Strawberry Flowers. Plant Disease 102:179-184.
Hu, M.-J., Fernández-Ortuño, D., and Schnabel, G. 2016. Monitoring resistance to SDHI
fungicides in Botrytis cinerea from strawberry fields. Plant Disease 100:959-965. Hummer, K. E., Bassil, N., and Njuguna, W. 2011. Fragaria. Pages 17-44 in: Wild Crop
Relatives: Genomic and Breeding Resources: Temperate Fruits. C. Kole, ed. Springer Berlin Heidelberg, Berlin, Heidelberg.
Hummer, K. E., and Janick, J. 2009. Rosaceae: Taxonomy, Economic Importance,
Genomics. Pages 1-17 in: Genetics and Genomics of Rosaceae. K. M. Folta and S. E. Gardiner, eds. Springer New York, New York, NY.
Jeanmart, S., Edmunds, A. J., Lamberth, C., and Pouliot, M. 2016. Synthetic
approaches to the 2010–2014 new agrochemicals. Bioorganic & medicinal chemistry 24:317-341.
Kirschbaum, D. S., Cantliffe, D. J., and Chandler, C. K. 1998. Propagation site latitude
influences initial carbohydrate concentration and partitioning, growth, and fruiting of 'Sweet Charlie' strawberry (Fragaria x Ananassa Duch.) transplants grown in Florida. Proceedings of Florida State Horticultural Society 111:93:96.
Kumari, S., Tayal, P., Sharma, E., and Kapoor, R. 2014. Analyses of genetic and
pathogenic variability among Botrytis cinerea isolates. Microbiological Research 169:862-872.
107
Kumar, S., Stecher, G., and Tamura, K. 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33:1870-1874.
Kuznetsov, D., Cazenave, A. B., Rambach, O., Camblin, P., Nina, M., and Leipner, J.
2017. Foliar application of benzovindiflupyr shows non‐fungicidal effects in wheat plants. Pest Management Science. DOI: 10.1002/ps.4754.
Lalève, A., Gamet, S., Walker, A. S., Debieu, D., Toquin, V., and Fillinger, S. 2014. Site‐
directed mutagenesis of the P225, N230 and H272 residues of succinate dehydrogenase subunit B from Botrytis cinerea highlights different roles in enzyme activity and inhibitor binding. Environmental microbiology 16:2253-2266.
Larson, K. D., and Shaw, D. V. 2000. Soil fumigation and runner plant production: A
synthesis of four years of strawberry nursery field trials. HortScience 35:642-646. Leandro, L., Gleason, M., Nutter Jr, F., Wegulo, S., and Dixon, P. 2001. Germination
and sporulation of Colletotrichum acutatum on symptomless strawberry leaves. Phytopathology 91:659-664.
Legard, D. E., Mertely, J. C., Xiao, C. L., Chandler, C. K., Duval J. R., and Price, J. P.
2002. Cultural and chemical control of Botrytis fruit rot of strawberry in annual winter production systems. Acta Hortic 567, 651-654. DOI: 10.17660/ActaHortic.2002.567.141.
Leroch, M., Plesken, C., Weber, R. W., Kauff, F., Scalliet, G., and Hahn, M. 2013. Gray
mold populations in German strawberry fields are resistant to multiple fungicides and dominated by a novel clade closely related to Botrytis cinerea. Applied and environmental microbiology 79:159-167.
Leroux, P. 2007. Chemical control of Botrytis and its resistance to chemical fungicides.
Pages 195-222 in: Botrytis: biology, pathology and control. Y. Elad, B. Williamson, P. Tudzynski and N. Delen, eds. Springer.
Leroux, P., Gredt, M., Leroch, M., and Walker, A.-S. 2010. Exploring mechanisms of
resistance to respiratory inhibitors in field strains of Botrytis cinerea, the causal agent of gray mold. Applied Environmental Microbiology 76:6615-6630.
Li, H., Li, T., Gordon, R. J., Asiedu, S. K., and Hu, K. 2010. Strawberry plant fruiting
efficiency and its correlation with solar irradiance, temperature and reflectance water index variation. Environmental and experimental botany 68:165-174.
Martin, R. R., and Tzanetakis, I. E. 2013. High risk strawberry viruses by region in the
United States and Canada: implications for certification, nurseries, and fruit production. Plant Disease 97:1358-1362.
108
Mass, J. L. 1998. Opportunities to reduce the potential for disease infection and spread with strawberry plug plants. Acta Hortic. 513:409-416.
Meletiadis, J., Mouton, J. W., Meis, J. F., Bouman, B. A., Verweij, P. E., and Network, E.
2002. Comparison of the Etest and the sensititre colorimetric methods with the NCCLS proposed standard for antifungal susceptibility testing of Aspergillus species. Clinical Microbiology 40:2876-2885.
Menzel, C. M., and Smith, L. 2012. Relationship between the levels of non-structural
carbohydrates, digging date, nursery-growing environment, and chilling in strawberry transplants in a subtropical environment. HortScience 47:459-464.
Mertely, J. C., Oliveira, M. S., and Peres, N. A. 2018. Botrytis fruit rot or gray mold of
strawberry. EDIS Plant Pathology Department, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences (IFAS), University of Florida, Gainesville-FL.
Mertely, J. C., and Peres, N. A. 2009. Botrytis fruit rot or gray mold of strawberry. EDIS
Plant Pathology Department, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences (IFAS), University of Florida, Gainesville-FL.
Miles, T., Miles, L., Fairchild, K., and Wharton, P. 2014. Screening and characterization
of resistance to succinate dehydrogenase inhibitors in Alternaria solani. Plant Pathology 63:155-164.
Nicot, P. C., Stewart, A., Bardin, M., and Elad, Y. 2016. Biological control and
biopesticide suppression of Botrytis-incited diseases. Pages 165-187 in: Botrytis - the fungus, the pathogen and its managements in agricultural systems. S. Fillinger and Y. Elad, eds. Springer.
Oliveira, M. S. 2014. Botrytis cinerea. Bugwood Wiki. Accessed December 4, 2017.
Available: https://wiki.bugwood.org/Botrytis_cinerea. Oliveira, M. S., Amiri, A., Zuniga, A. I., and Peres, N. A. 2017. Sources of primary
inoculum of Botrytis cinerea and their impact on fungicide resistance development in commercial strawberry fields. Plant Disease 101:1761-1768.
Pavan, W., Clyde W. F., Cordova, L. G., and Peres, N. A. 2012. The Strawberry
Advisory System: A web-based decision support tool for timing fungicide applications in strawberry. EDIS Plant Pathology Department, Florida. Cooperative Extension Service, Institute of Food and Agricultural Sciences (IFAS), University of Florida, Gainesville-FL.
109
Pavan, W., Fraisse, C. W., Cordova, L. G., and Peres, N. A. 2009. The Strawberry Advisory System: A web-based decision support tool for timing fungicide applications in strawberry. EDIS Plant Pathology Department, Florida. Cooperative Extension Service, Institute of Food and Agricultural Sciences (IFAS), University of Florida, Gainesville-FL.
Peres, N. A. 2015a. Florida plant disease management guide: Strawberry. EDIS Plant
Pathology Department, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences (IFAS), University of Florida, Gainesville-FL.
Peres, N. A. 2015b. Fungicides recommended for control of Anthracnose and Botrytis
Fruit Rots in Florida. AgroClimate. Available: http://agroclimate.org/tools/Strawberry-Advisory-System/.
Peres, N., Price, J., Stall, W., Chandler, C., Olson, S., Taylor, T., Smith, S., and
Simonne, E. 2006. Strawberry production in Florida. Vegetable production handbook for Florida 2007:375-382.
Pertuzé, R., Barrueto, M., Diaz, V., and Gamardella, M. 2006. Evaluation of strawberry
nursery management techniques to improve quality of plants. Acta Hortic. 708:245-248.
Pettit, R. K., Weber, C. A., Kean, M. J., Hoffmann, H., Pettit, G. R., Tan, R., Franks, K.
S., and Horton, M. L. 2005. Microplate alamar blue assay for Staphylococcus epidermidis biofilm susceptibility testing. Antimicrobial agents and chemotherapy 49:2612-2617.
Piqueras, C., Latorre, B., and Torres, R. 2014. Effectiveness of isofetamid, a new
succinate dehydrogenase inhibitor fungicide, in the control of grapevine gray mold. Ciencia e investigación agraria 41:365-374.
Rahman, M., Ojiambo, P., and Louws, F. 2015. Initial inoculum and spatial dispersal of
Colletotrichum gloeosporioides, the causal agent of strawberry anthracnose crown rot. Plant Disease 99:80-86.
Reekie, J., Hicklenton, P., Duval, J., Duval, C., and Struik, P. 2005. Leaf removal and
prohexadione-calcium can modify Camarosa strawberry nursery plant morphology for plasticulture fruit production. Canadian journal of plant science 85:665-670.
Rosslenbroich, H.-J., and Stuebler, D. 2000. Botrytis cinerea—history of chemical
control and novel fungicides for its management. Crop Protection 19:557-561. Rupp, S., Weber, R. W., Rieger, D., Detzel, P., and Hahn, M. 2017. Spread of Botrytis
cinerea strains with multiple fungicide resistance in German horticulture. Frontiers in Microbiology 7:2075.
110
Santos, B. M., Peres, N. A., Price, J. F., Chandler, C. K., Whitaker, V. M., Stall, W. M., Olson, S. M., Smith, S. A., and Simone, E. H. 2012. Strawberry production in Florida. Pages 271-282 in: Vegetable production handbook for Florida. S. M. Olson and B. Santos, eds. University of Florida - IFAS Extension, Gainesville-FL.
Shtienberg, D. 2007. Rational management of Botrytis-incited diseases: integration of
control measures and use of warning systems. Pages 335-347 in: Botrytis: biology, pathology and control. Y. Elad, B. Williamson, P. Tudzynski and N. Delen, eds. Springer.
Shulaev, V., Sargent, D. J., Crowhurst, R. N., Mockler, T. C., Folkerts, O., Delcher, A.
L., Jaiswal, P., Mockaitis, K., Liston, A., Mane, S. P., Burns, P., Davis, T. M., Slovin, J. P., Bassil, N., Hellens, R. P., Evans, C., Harkins, T., Kodira, C., Desany, B., Crasta, O. R., Jensen, R. V., Allan, A. C., Michael, T. P., Setubal, J. C., Celton, J.-M., Rees, D. J. G., Williams, K. P., Holt, S. H., Rojas, J. J. R., Chatterjee, M., Liu, B., Silva, H., Meisel, L., Adato, A., Filichkin, S. A., Troggio, M., Viola, R., Ashman, T.-L., Wang, H., Dharmawardhana, P., Elser, J., Raja, R., Priest, H. D., Bryant Jr, D. W., Fox, S. E., Givan, S. A., Wilhelm, L. J., Naithani, S., Christoffels, A., Salama, D. Y., Carter, J., Girona, E. L., Zdepski, A., Wang, W., Kerstetter, R. A., Schwab, W., Korban, S. S., Davik, J., Monfort, A., Denoyes-Rothan, B., Arus, P., Mittler, R., Flinn, B., Aharoni, A., Bennetzen, J. L., Salzberg, S. L., Dickerman, A. W., Velasco, R., Borodovsky, M., Veilleux, R. E., and Folta, K. M. 2010. The genome of woodland strawberry (Fragaria vesca). Nature Genetics 43:109.
Sierotzki, H., and Scalliet, G. 2013. A review of current knowledge of resistance aspects
for the next-generation succinate dehydrogenase inhibitor fungicides. Phytopathology 103:880-887.
Simonne, E., and Hochmuth, G. 2005. Soil and fertilizer management for vegetable
production in Florida. Vegetable production handbook for Florida 2006:3-15. Sjulin, T. M. 2008. Special problems in nursery propagation of day-neutral strawberry
cultivars susceptible to Colletotrichum acutatum. Hortscience 43:78-80. Staudt, G. 1989. The species of Fragaria, their taxonomy and geographical distribution.
Acta Hortic 265, 223-234. Stammler, G., and Speakman, J. 2006. Microtiter method to test the sensitivity of
Botrytis cinerea to boscalid. Phytopathology 154, 508-510. Strand, L. L. 2008. Integrated pest management for strawberries. 2nd edition ed.
University of California, Division of Agriculture and Natural Resources, Oakland, CA.
111
Sutton, J., and Peng, G. 1993. Biocontrol of Botrytis cinerea in strawberry leaves. Phytopathology 83:615-621.
Tenberge, K. B. 2007. Morphology and cellular organization in Botrytis interactions with
plants. Pages 67-84 in: Botrytis: biology, pathology and control. Y. Elad, B. Williamson, P. Tudzynski and N. Delen, eds. Springer.
Thomas, A., Langston Jr, D., and Stevenson, K. 2012. Baseline sensitivity and cross-
resistance to succinate-dehydrogenase-inhibiting and demethylation-inhibiting fungicides in Didymella bryoniae. Plant Disease 96:979-984.
Torres-Quezada, E. A., Zotarelli, L., Whitaker, V. M., Santos, B. M., and Hernandez-
Ochoa, I. 2015. Initial crown diameter of strawberry bare-root transplants affects early and total fruit yield. HortTechnology 25:203-208.
Turechek, W. W., and Peres, N. A. 2009. Heat treatment effects on strawberry plant
survival and angular leaf spot, caused by Xanthomonas fragariae, in nursery production. Plant Disease 93:299-308.
Turechek, W. W., Wang, S., Tiwari, G., and Peres, N. A. 2013. Investigating alternative
strategies for managing bacterial angular leaf spot in strawberry nursery production. International journal of fruit science 13:234-245.
USDA. 2017a. National statistics for strawberries and Florida agricultural overview
(2016). United States Department of Agriculture, National Agricultural Statistics Service (USDA, NASS). Data and statistics. Accessed October 19, 2017. Available: https://www.nass.usda.gov/Data_and_Statistics/index.php.
USDA. 2017b. Plant health import information. United States Department of
Agriculture, Animal Plant Health Inspection Service (USDA, APHIS). Plant health/Import into the U.S. Accessed November 29, 2017. Available: http://www.aphis.usda.gov/aphis/ourfocus/planthealth/import-information/ct_plant_import_information.
Vega, B., Liberti, D., Harmon, P. F., and Dewdney, M. M. 2012. A rapid resazurin-based
microtiter assay to evaluate QoI sensitivity for Alternaria alternata isolates and their molecular characterization. Plant Disease 96:1262-1270.
Veloukas, T., Kalogeropoulou, P., Markoglou, A., and Karaoglanidis, G. 2014. Fitness
and competitive ability of Botrytis cinerea field isolates with dual resistance to SDHI and QoI fungicides, associated with several sdh B and the cyt b G143A mutations. Phytopathology 104:347-356.
Veloukas, T., Leroch, M., Hahn, M., and Karaoglanidis, G. S. 2011. Detection and
molecular characterization of boscalid-resistant Botrytis cinerea isolates from strawberry. Plant Disease 95:1302-1307.
112
Veloukas, T., Markoglou, A. N., and Karaoglanidis, G. S. 2013. Differential effect of SdhB gene mutations on the sensitivity to SDHI fungicides in Botrytis cinerea. Plant Disease 97:118-122.
Villani, S. M., Ayer, K., and Cox, K. D. 2016. Molecular characterization of the sdhB
gene and baseline sensitivity to penthiopyrad, fluopyram, and benzovindiflupyr in Venturia inaequalis. Plant Disease 100:1709-1716.
Vincelli, P. 2014. Some principles of fungicide resistance. Plant Pathology Fact Sheet
PPFS-MISC-02, University of Kentucky, College of Agriculture, Plant Pathology Extension.
Viswanathan, R., and Rao, G. P. 2011. Disease scenraio and management of major
sugarcane diseases in India. Sugar Tech 13(4):336-353. Vitale, A., Panebianco, A., and Polizzi, G. 2016. Baseline sensitivity and efficacy of
fluopyram against Botrytis cinerea from table grape in Italy. Annals of Applied biology 169:36-45.
Walker, A. S. 2016. Diversity within and between species of Botrytis. Pages 91-125 in:
Botrytis - the fungus, the pathogen and its managements in agricultural systems. S. Fillinger and Y. Elad, eds. Springer.
Weber, R. W., and Hahn, M. 2011. A rapid and simple method for determining fungicide
resistance in Botrytis. Journal of Plant Diseases and Protection:17-25. Whitaker, V. M., Boyd, N. S., Peres, N. A., Noling, J. W., Rnekema, and J. 2017.
Strawberry production. Pages 293-312 in: Vegetable production handbook of Florida. G. E. Vallad, J. H. Freeman, H. Smith and P. J. Dittmar, eds., University of Florida - IFAS Extension, Gainesville-FL.
Whitaker, V. M., Chandler, C. K., Santos, B. M., Peres, N., do Nascimento Nunes, M.
C., Plotto, A., and Sims, C. A. 2012. Winterstar™(‘FL 05-107’) strawberry. HortScience 47:296-298.
Williamson, B., Tudzynski, B., Tudzynski, P., and van Kan, J. A. 2007. Botrytis cinerea:
the cause of grey mould disease. Molecular plant pathology 8:561-580. Xiong, L., Shen, Y.-Q., Jiang, L.-N., Zhu, X.-L., Yang, W.-C., Huang, W., and Yang, G.-
F. 2015. Succinate dehydrogenase: An ideal target for fungicide discovery. Pages 175-194 in: Discovery and Synthesis of Crop Protection Products. ACS Publications.
Yin, Y., Kim, Y., and Xiao, C. 2011. Molecular characterization of boscalid resistance in
field isolates of Botrytis cinerea from apple. Phytopathology 101:986-995.
113
Zotarelli, L., Dukes, M. D., Liu, G., Simonne, E. H., and Agehara, S. 2017. Principles and practices of irrigation management for vegetables. Pages 11-18 in: Vegetable production handbook of Florida. G. E. Vallad, J. H. Freeman, H. Smith and P. J. Dittmar, eds., University of Florida - IFAS Extension, Gainesville-FL.
Zuniga, A. I., Cordova, L., Mertely, J., and Peres, N. A. 2017. Evaluation of fungicide
products to control Botrytis fruit rot in annual strawberry, 2016-17. Plant Disease Management Report 11:SMF029.
114
BIOGRAPHICAL SKETCH
Adrian Israel Zuniga Pinto was born in Guayaquil and raised in Quevedo,
Ecuador. After culminating high school, Adrian enrolled at Zamorano University in 2009
where he got his bachelor’s degree of science in agronomy. During his undergraduate
program, he gained training experience in different areas of crop and food production as
well as in tissue culture, in vitro reproduction, and molecular diagnostic of plants. In the
spring of 2012, he did an internship at the Gulf Coast Research and Education Center,
University of Florida where he started working with Dr. Natalia A. Peres. Later in the
same year he presented his final project entitled ‘In vitro establishment of sugarcane
(Saccharum officinarum) cultivar CP 73-1547’ and graduated in December 2012. Adrian
returned to work with Dr. Peres in 2013 as a research scholar studying Botrytis cinerea
and Colletotrichum acutatum, causal agents of Botrytis and anthracnose fruit rot,
respectively. He was admitted for graduate school in August 2015 for the degree of
Master of Science in Plant Pathology at the University of Florida. His project studied
resistance frequencies of B. cinerea to Succinate Dehydrogenase Inhibitors (SDHI) with
molecular characterization of mutations conferring resistance to a new SDHI fungicide
and the effect of heat treatment as a possible means to reduce B. cinerea resistant
populations on strawberry nursery transplants. The project was partially funded by the
National Institute of Food and Agriculture, U.S. Department of Agriculture (USDA). In
2017, Adrian was awarded with 3rd place on the Florida Phytopathological Society
Meeting student competition and with the IFAS/CALS Graduate Student Travel Award.