Sara Oyler-McCanceSara Oyler-McCance

USGS, Fort Collins Science Center, Fort USGS, Fort Collins Science Center, Fort Collins, CO Collins, CO

Paul LebergPaul LebergUniversity of Louisiana at Lafayette, LAUniversity of Louisiana at Lafayette, LA

CONSERVATION GENETICS AND CONSERVATION GENETICS AND MOLECULAR ECOLOGY IN WILDLIFE MOLECULAR ECOLOGY IN WILDLIFE

MANAGEMENTMANAGEMENT

IntroductionIntroduction

►Genetic techniques have only recently been Genetic techniques have only recently been applied to wildlife studiesapplied to wildlife studies

►Due to technological advances that have Due to technological advances that have made genetic methods straightforward and made genetic methods straightforward and inexpensiveinexpensive

Molecular Genetic TechniquesMolecular Genetic Techniques

►All techniques examine portions of DNA at some scale All techniques examine portions of DNA at some scale

►Nuclear genome – biparentally inherited, found in cell Nuclear genome – biparentally inherited, found in cell nucleus, evolves slowly (yet some regions evolve nucleus, evolves slowly (yet some regions evolve rapidly)rapidly)

►Mitochondrial genome – maternally inherited, housed Mitochondrial genome – maternally inherited, housed in mitochondrion, much smaller than nuclear genome, in mitochondrion, much smaller than nuclear genome, evolves quickly, well mapped in many speciesevolves quickly, well mapped in many species

Investigating Genetic VariationInvestigating Genetic Variation

►Some techniques consider gene products (e.g. Some techniques consider gene products (e.g. proteins) while others examine variation at the proteins) while others examine variation at the nucleotide level (e.g., DNA sequencing, nucleotide level (e.g., DNA sequencing, fragment analysis) fragment analysis)

►Polymerase Chain Reaction (PCR) – a region of Polymerase Chain Reaction (PCR) – a region of DNA is targeted and amplified exponentiallyDNA is targeted and amplified exponentially

Polymerase Chain Reaction

…………AGCTTAGCTATATG…………AGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATG

AGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATG

AGCTTAGCTATATG

…………AGCTTAGCTATATG…………

Forward PrimerForward Primer Reverse PrimerReverse Primer

Analysis of Gene ProductsAnalysis of Gene Products

►Proteins are a series of amino acids joined by peptide Proteins are a series of amino acids joined by peptide bonds bonds

►Mutations cause changes in shape, charge, and Mutations cause changes in shape, charge, and migration rates in electrophoresismigration rates in electrophoresis

►Variation can be detected among individuals, Variation can be detected among individuals, populations, or speciespopulations, or species

►Can only examine a small proportion of variation Can only examine a small proportion of variation present in DNA that codes for proteinspresent in DNA that codes for proteins

Fragment AnalysisFragment Analysis

►Genetic techniques that explore variation Genetic techniques that explore variation indirectly by comparing the size of DNA indirectly by comparing the size of DNA fragment electrophoreticallyfragment electrophoretically

►Examples include RFLP, AFLP, Minisatellites Examples include RFLP, AFLP, Minisatellites and microsatellitesand microsatellites

►The most widely used for wildlife studies are The most widely used for wildlife studies are microsatellitesmicrosatellites

MicrosatellitesMicrosatellites

►Regions in the nuclear genome characterized Regions in the nuclear genome characterized by short tandem repeats (e.g., CT repeated 20 by short tandem repeats (e.g., CT repeated 20 times)times)

►PCR based technique that identifies diploid PCR based technique that identifies diploid genotypes for specific logenotypes for specific locici

Example of a microsatellite locus. This locus is heterozygous in this individualWith 1 allele sized 362 and 1 allele sized 366 base pairs.

DNA SequencingDNA Sequencing

►DNA sequencing involves targeting a certain DNA sequencing involves targeting a certain region of the genome, amplifying it, and region of the genome, amplifying it, and reading the DNA sequence in that regionreading the DNA sequence in that region

Example of DNA sequence

Single Nucleotide PolymorphismsSingle Nucleotide Polymorphisms

►Emerging marker that is a specific site in a Emerging marker that is a specific site in a DNA sequence in which a single nucleotide DNA sequence in which a single nucleotide variesvaries

Individual 1 (A) ATGCGGCGATTGCCATGGGTAIndividual 2 (A) ATGCGGCGATTGCCATGGGTAIndividual 3 (A) ATGCGGCGATTGCCATGGGTAIndividual 4 (B) ATGCGGCCATTGCCATGGGTAIndividual 5 (B) ATGCGGCCATTGCCATGGGTAIndividual 6 (B) ATGCGGCCATTGCCATGGGTA

SNP

Applicability of Common Types of Applicability of Common Types of Molecular Markers for Wildlife BiologistsMolecular Markers for Wildlife Biologists

Type of marker Taxonomic delineations

Regional/sub-specific population structure

Genetic diversity and subpopulation

structure

Individual ID and paternity/maternity

analysis

Allozymes XXX XXX XXX X

MtDNA sequences XXXX XXXX XX X

Microsatellites X XX XXXX XXXX

Minisatellites X X XX XXXX

AFLP X X XX XXX

SNP XXX XX XX X

Number of Xs indicates the relative applicability of each technique to a specific question (modified from Mace et al. 1996).

Genetic SamplingGenetic Sampling

►DNA can be extracted from a variety of tissues DNA can be extracted from a variety of tissues including muscle, heart, liver, blood, skin, hair, including muscle, heart, liver, blood, skin, hair, feathers, saliva, feces, urine, scales, bone, fins, feathers, saliva, feces, urine, scales, bone, fins, eggshell membranes and potentially cervid antlerseggshell membranes and potentially cervid antlers

►Destructive sampling – when an organism is Destructive sampling – when an organism is killed during the process of samplingkilled during the process of sampling

►Nondestructive sampling – when a genetic sample Nondestructive sampling – when a genetic sample can be obtained without sacrificing the animalcan be obtained without sacrificing the animal

Sources of DNA and How Samples Sources of DNA and How Samples Should be CollectedShould be Collected

Tissue type Amount Quantity Quality Preservation method

Blood 5 – 10 drops High Good EDTA coated tubesLysis Buffer (Longmire)

        Filter paper Muscle  

Square 2 cm on a side High Good Buffer

Feather At least 1 Low Good Dry Egg shell membranes

 As much as is possible

 Depends

 Good

 Dry

 Hair

 At least 1

 Low

 Good

 Dry

 Scat

 Variable

 Low

 Poor

 Ethanol or Dry

 Teeth

 Variable

 Low

 Depends

 Dry

 Bone

 Variable

 Low

 Depends

 Dry

Buccal Swab

Variable Low Good Lysis Buffer (Longmire)

TaxonomyTaxonomy► While most taxonomic classes are somewhat arbitrary While most taxonomic classes are somewhat arbitrary

(subspecies, genera, order) the species classification is (subspecies, genera, order) the species classification is perceived to be based on real, evolutionary unitsperceived to be based on real, evolutionary units

► Species definition is integral to the Endangered Species Act Species definition is integral to the Endangered Species Act

► Two most common and applied species concepts are Two most common and applied species concepts are Biological (BSC) and Phylogenetic (PSC)Biological (BSC) and Phylogenetic (PSC)

► BSC emphasizes reproductive isolationBSC emphasizes reproductive isolation

► PSC uses the criterion of reciprocal monophyly and typically PSC uses the criterion of reciprocal monophyly and typically relies solely on genetic datarelies solely on genetic data

Comparison of greater sage-grouse (left) and Gunnison sage-grouse (right). Comparison of greater sage-grouse (left) and Gunnison sage-grouse (right).

Gunnison sage-grouse were recognized as a new Gunnison sage-grouse were recognized as a new species in 2000 based on differences in morphology, species in 2000 based on differences in morphology, behavior, and genetics.behavior, and genetics.

HybridizationHybridization

►Genetic methods can be used to document Genetic methods can be used to document hybridization, introgression, and taxonomic hybridization, introgression, and taxonomic statusstatus

►Molecular techniques can also be used to Molecular techniques can also be used to determine the maternity and paternity of determine the maternity and paternity of hybridshybrids

Evolutionary Significant UnitsEvolutionary Significant Units

►Genetic methods can be used to objectively Genetic methods can be used to objectively prioritize conservation and management value prioritize conservation and management value below the species levelbelow the species level

►Evolutionary Significant Units (ESU) and Evolutionary Significant Units (ESU) and Management Units (MU) allow for that Management Units (MU) allow for that prioritizationprioritization

Conservation of Genetic DiversityConservation of Genetic Diversity

►Four main forces affect Genetic DiversityFour main forces affect Genetic Diversity MutationMutation

Gene FlowGene Flow

Genetic driftGenetic drift

SelectionSelection

►Understanding these forces can aid in the Understanding these forces can aid in the management of genetic diversitymanagement of genetic diversity

MutationMutation

► Changes in the DNA sequence that result in new genetic Changes in the DNA sequence that result in new genetic variationvariation

► Usually management actions have little affect on this Usually management actions have little affect on this processprocess

► Mutations can be increased by some environmental Mutations can be increased by some environmental contaminants contaminants

► Mutations are low frequency events and thus have been Mutations are low frequency events and thus have been hard to detect; this is changing with the development of hard to detect; this is changing with the development of better screening technologiesbetter screening technologies

Gene FlowGene Flow

► Results from individuals moving from their natal population to a Results from individuals moving from their natal population to a new one, where they successfully reproducenew one, where they successfully reproduce

► Often reported as Often reported as Nm,Nm, the number of migrants per generation, the number of migrants per generation, where N is the average size of the populations and where N is the average size of the populations and mm is the is the migration rate between them.migration rate between them.

► Gene flow is negatively related to the amount of differentiation Gene flow is negatively related to the amount of differentiation observed between populationsobserved between populations

► Population differentiation is often expressed as the Population differentiation is often expressed as the FFSTST , which , which

can be defined as the proportion of the total variance in allele can be defined as the proportion of the total variance in allele frequencies due to differences among populations frequencies due to differences among populations

Gene FlowGene Flow►The greater the exchange of individuals The greater the exchange of individuals

between populations the more that genetic between populations the more that genetic similarity of the populations will increasesimilarity of the populations will increase

Number of Migrants Per Generation

0 1 2 3 4 5 6 7 8 9 10

Gen

etic

Diff

eren

tiatio

n A

mon

g S

ubpo

pula

tions

0.0

0.2

0.4

0.6

0.8

1.0

Equilibrium relationship of Equilibrium relationship of genetic differentiation genetic differentiation among subpopulations (as among subpopulations (as measured by Fmeasured by F

STST) and ) and

number of migrants per number of migrants per generation (modified from generation (modified from Mills and Allendorf 1996).Mills and Allendorf 1996).

Sex-biased DispersalSex-biased Dispersal

►In many wildlife species, one sex tends to In many wildlife species, one sex tends to disperse to a new area, while the other remains disperse to a new area, while the other remains near its natal sitenear its natal site

►In such species, DNA that is paternally In such species, DNA that is paternally inherited, such as the Y chromosome in inherited, such as the Y chromosome in mammals, or maternally inherited, such as mammals, or maternally inherited, such as mtDNA, can have very different patterns of mtDNA, can have very different patterns of population structure than nuclear markers population structure than nuclear markers

Gene FlowGene Flow

► Because gene flow is high between most wildlife Because gene flow is high between most wildlife populations, populations, FFSTST tends to be low tends to be low

► However, even in migratory birds, such as in the golden-However, even in migratory birds, such as in the golden-cheeked wabler and black-capped vireo, that can move cheeked wabler and black-capped vireo, that can move great distances, population differentiation can result from great distances, population differentiation can result from cases of habitat fragmentationcases of habitat fragmentation

(Photographs by Kelly Barr)

Habitat FragmentationHabitat Fragmentation

► Because fragmentation can lead to genetic differentiation Because fragmentation can lead to genetic differentiation and loss of variation, management often attempts to and loss of variation, management often attempts to prevent fragmentation or to reconnect habitat fragments prevent fragmentation or to reconnect habitat fragments with corridorswith corridors

► In extreme cases, managers may assist migration by In extreme cases, managers may assist migration by moving individuals between fragmented populationsmoving individuals between fragmented populations

► Reintroduction programs, that translocation individuals Reintroduction programs, that translocation individuals from sites they are common, to sites they are rare or from sites they are common, to sites they are rare or absent, also can result in gene flow. absent, also can result in gene flow.

Genetic DriftGenetic Drift

►Random changes in the frequencies of allelesRandom changes in the frequencies of alleles

►Increases with decreasing population sizeIncreases with decreasing population size

►Increases genetic differences among small, Increases genetic differences among small, isolated populationsisolated populations

►Gene flow counteracts the influence of driftGene flow counteracts the influence of drift

Genetic DriftGenetic Drift►When a normally large population goes through a When a normally large population goes through a

constriction in size, it is referred to as a genetic bottleneck constriction in size, it is referred to as a genetic bottleneck

►During bottlenecks, drift is acceleratedDuring bottlenecks, drift is accelerated

►Severe bottlenecks, reducing the size of a population to Severe bottlenecks, reducing the size of a population to just a few individuals, can cause the loss of many alleles just a few individuals, can cause the loss of many alleles from a populationfrom a population

►Long bottlenecks increase the occurrence of inbreeding in Long bottlenecks increase the occurrence of inbreeding in a populationa population

Genetic DriftGenetic Drift►The rate of loss of variation in a population is to a The rate of loss of variation in a population is to a

population’s effective size (population’s effective size (NNee))

►NNe e is often smaller than the number of breeding adults in a is often smaller than the number of breeding adults in a

populationpopulation

►NNee can be reduced below the census population size by can be reduced below the census population size by

many factors, including unequal sex ratios, temporal many factors, including unequal sex ratios, temporal differences in population size, and large variation among differences in population size, and large variation among the number of young produced by the adults in the the number of young produced by the adults in the populationpopulation

Human ActivitiesHuman Activities

►A number of human activities can increase drift:A number of human activities can increase drift:

►Creation of small populations , through habitat Creation of small populations , through habitat fragmentation and degradation, as well as over fragmentation and degradation, as well as over harvestharvest

►Releasing only a small number of individuals in Releasing only a small number of individuals in translocation programstranslocation programs

►Creating very skewed sex ratios in game species, by Creating very skewed sex ratios in game species, by harvesting only one sexharvesting only one sex

SelectionSelection

► Differential survival and fecundity of genotypes can have Differential survival and fecundity of genotypes can have complex effects on genetic diversitycomplex effects on genetic diversity

► Typically, selection plays only a minor role in discussions Typically, selection plays only a minor role in discussions about of management of genetic diversityabout of management of genetic diversity

► Technological advances are allowing better monitoring of Technological advances are allowing better monitoring of selection in natureselection in nature

► Some harvest practices have been shown to have the Some harvest practices have been shown to have the potential for producing unintended selective changes in potential for producing unintended selective changes in populationspopulations

Population ViabilityPopulation Viability

►Interest in preserving genetic diversity stems from Interest in preserving genetic diversity stems from the relationship between genetic diversity and the relationship between genetic diversity and population viabilitypopulation viability

►Small populations that lose genetic diversity due Small populations that lose genetic diversity due to inbreeding can suffer from inbreeding to inbreeding can suffer from inbreeding depression reducing survival and fecunditydepression reducing survival and fecundity

►Genetic diversity lost via drift is not available for Genetic diversity lost via drift is not available for adaptation to changing environmental conditionsadaptation to changing environmental conditions

Captive Breeding ProgramsCaptive Breeding Programs

►Because most captive populations are small, they are Because most captive populations are small, they are subject to inbreeding and driftsubject to inbreeding and drift

►To prevent loss of variation, populations should be To prevent loss of variation, populations should be established with a large number of unrelated established with a large number of unrelated individuals, and be maintained at large population sizesindividuals, and be maintained at large population sizes

►Efforts should be made to prevent adaptation to captive Efforts should be made to prevent adaptation to captive conditions, so that reintroduction into the wild remains conditions, so that reintroduction into the wild remains a viable possibilitya viable possibility

Noninvasive SamplingNoninvasive Sampling

►As DNA can be extracted from a variety of As DNA can be extracted from a variety of material, non-invasive sampling allows material, non-invasive sampling allows samples to be collected without handling or samples to be collected without handling or disturbing animalsdisturbing animals

►Because each individual has its own unique Because each individual has its own unique genetic fingerprint, DNA can be used a unique genetic fingerprint, DNA can be used a unique ‘mark’ for mark and recapture methods‘mark’ for mark and recapture methods

Noninvasive SamplingNoninvasive Sampling

►This type of sampling also can be used to This type of sampling also can be used to identify species, estimate sex ratios, and identify species, estimate sex ratios, and provide genetic material for population and provide genetic material for population and landscape genetic studieslandscape genetic studies

Baiting a hair snare with cat nip

Estimating Population Size and Estimating Population Size and SurvivalSurvival

► Requires a set of markers polymorphic enough to Requires a set of markers polymorphic enough to distinguish among individuals (microsatellites)distinguish among individuals (microsatellites)

► DNA from non-invasively collected samples is low DNA from non-invasively collected samples is low quantity and can be degradedquantity and can be degraded

► Contamination is an issueContamination is an issue

► Allelic dropout can be a problem (when only 1 of 2 Allelic dropout can be a problem (when only 1 of 2 alleles of template DNA is amplified, looks like a alleles of template DNA is amplified, looks like a homozygote when it is a heterozygote)homozygote when it is a heterozygote)

Tracking Individual MovementsTracking Individual Movements

►As individuals can be uniquely identified with As individuals can be uniquely identified with genetic markers, movement data can be genetic markers, movement data can be obtained by “recapturing” individuals at obtained by “recapturing” individuals at different times in different locationsdifferent times in different locations

►Genetic stock identification – when breeding Genetic stock identification – when breeding populations differ genetically, it is possible to populations differ genetically, it is possible to identify dispersing or migrating individualsidentify dispersing or migrating individuals

Species IdentificationSpecies Identification

► Wildlife “sign” such as feces, tufts of hair, feathers, Wildlife “sign” such as feces, tufts of hair, feathers, blood and even frozen urine are often found and need blood and even frozen urine are often found and need to be identified to speciesto be identified to species

► This can be particularly important for monitoring This can be particularly important for monitoring programs that don’t need individual identification but programs that don’t need individual identification but need to confirm the species that left the signneed to confirm the species that left the sign

► MtDNA sequencing can be used to identify speciesMtDNA sequencing can be used to identify species

Dietary AnalysisDietary Analysis

►Molecular probes can be used to examine food Molecular probes can be used to examine food habits (in the absence of recognizable remnants habits (in the absence of recognizable remnants of plant and animal parts)of plant and animal parts)

►Such work can be conducted on feces, stomach Such work can be conducted on feces, stomach contents, and bird regurgitatecontents, and bird regurgitate

►DNA analysis of scat can trace multiple food DNA analysis of scat can trace multiple food items to a given individual and can even be items to a given individual and can even be quantifiedquantified

Gender IdentificationGender Identification

►For some species it is difficult to determine For some species it is difficult to determine gender without invasive proceduresgender without invasive procedures

►Gender of the individual who left a wildlife Gender of the individual who left a wildlife “sign” is often unknown as well but important “sign” is often unknown as well but important for survival and population estimates as well as for survival and population estimates as well as sex ratiossex ratios

►Molecular techniques can easily determine Molecular techniques can easily determine gendergender

Gender IdentificationGender Identification

►Procedures for mammals and birds are slightly Procedures for mammals and birds are slightly different different

►In mammals, males are heterogametic sex In mammals, males are heterogametic sex (X,Y)(X,Y)

►In birds, females are heterogametic sex (W,Z)In birds, females are heterogametic sex (W,Z)

►Both techniques amplify regions on the sex Both techniques amplify regions on the sex chromosomes chromosomes

SUMMARYSUMMARY

► Molecular genetic techniques represent a powerful set of tools Molecular genetic techniques represent a powerful set of tools for wildlife sciencefor wildlife science

► They can be used to identify species and appropriate units for They can be used to identify species and appropriate units for conservation, document effective population sizes, and levels conservation, document effective population sizes, and levels of connectivity among areasof connectivity among areas

► Noninvasive collection of DNA has been used to estimate sex Noninvasive collection of DNA has been used to estimate sex ratios, food habits, population sizes, survival rates, and mating ratios, food habits, population sizes, survival rates, and mating systemssystems

► Rapid development of DNA-based technologies will Rapid development of DNA-based technologies will revolutionize wildlife research in the futurerevolutionize wildlife research in the future