sara oyler-mccance usgs, fort collins science center, fort collins, co paul leberg

Download Sara Oyler-McCance USGS, Fort Collins Science Center, Fort Collins, CO  Paul Leberg

Post on 14-Jan-2016

33 views

Category:

Documents

0 download

Embed Size (px)

DESCRIPTION

CONSERVATION GENETICS AND MOLECULAR ECOLOGY IN WILDLIFE MANAGEMENT. Sara Oyler-McCance USGS, Fort Collins Science Center, Fort Collins, CO Paul Leberg University of Louisiana at Lafayette, LA. Introduction. Genetic techniques have only recently been applied to wildlife studies - PowerPoint PPT Presentation

TRANSCRIPT

  • Sara Oyler-McCance USGS, Fort Collins Science Center, Fort Collins, CO

    Paul LebergUniversity of Louisiana at Lafayette, LA

    CONSERVATION GENETICS AND MOLECULAR ECOLOGY IN WILDLIFE MANAGEMENT

  • IntroductionGenetic techniques have only recently been applied to wildlife studies

    Due to technological advances that have made genetic methods straightforward and inexpensive

  • Molecular Genetic TechniquesAll techniques examine portions of DNA at some scale

    Nuclear genome biparentally inherited, found in cell nucleus, evolves slowly (yet some regions evolve rapidly)

    Mitochondrial genome maternally inherited, housed in mitochondrion, much smaller than nuclear genome, evolves quickly, well mapped in many species

  • Investigating Genetic VariationSome techniques consider gene products (e.g. proteins) while others examine variation at the nucleotide level (e.g., DNA sequencing, fragment analysis)

    Polymerase Chain Reaction (PCR) a region of DNA is targeted and amplified exponentially

  • Polymerase Chain ReactionAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGAGCTTAGCTATATGForward PrimerReverse Primer

  • Analysis of Gene ProductsProteins are a series of amino acids joined by peptide bonds

    Mutations cause changes in shape, charge, and migration rates in electrophoresis

    Variation can be detected among individuals, populations, or species

    Can only examine a small proportion of variation present in DNA that codes for proteins

  • Fragment AnalysisGenetic techniques that explore variation indirectly by comparing the size of DNA fragment electrophoretically

    Examples include RFLP, AFLP, Minisatellites and microsatellites

    The most widely used for wildlife studies are microsatellites

  • Microsatellites

    Regions in the nuclear genome characterized by short tandem repeats (e.g., CT repeated 20 times)PCR based technique that identifies diploid genotypes for specific lociExample of a microsatellite locus. This locus is heterozygous in this individualWith 1 allele sized 362 and 1 allele sized 366 base pairs.

  • DNA SequencingDNA sequencing involves targeting a certain region of the genome, amplifying it, and reading the DNA sequence in that regionExample of DNA sequence

  • Single Nucleotide PolymorphismsEmerging marker that is a specific site in a DNA sequence in which a single nucleotide variesIndividual 1 (A) ATGCGGCGATTGCCATGGGTAIndividual 2 (A) ATGCGGCGATTGCCATGGGTAIndividual 3 (A) ATGCGGCGATTGCCATGGGTAIndividual 4 (B) ATGCGGCCATTGCCATGGGTAIndividual 5 (B) ATGCGGCCATTGCCATGGGTAIndividual 6 (B) ATGCGGCCATTGCCATGGGTASNP

  • Applicability of Common Types of Molecular Markers for Wildlife BiologistsNumber of Xs indicates the relative applicability of each technique to a specific question (modified from Mace et al. 1996).

    Type of markerTaxonomic delineationsRegional/sub-specific population structureGenetic diversity and subpopulation structureIndividual ID and paternity/maternity analysisAllozymesXXXXXXXXXXMtDNA sequences XXXXXXXXXXXMicrosatellitesXXXXXXXXXXXMinisatellitesXXXXXXXXAFLPXXXXXXXSNPXXXXXXXX

  • Genetic SamplingDNA can be extracted from a variety of tissues including muscle, heart, liver, blood, skin, hair, feathers, saliva, feces, urine, scales, bone, fins, eggshell membranes and potentially cervid antlers

    Destructive sampling when an organism is killed during the process of sampling

    Nondestructive sampling when a genetic sample can be obtained without sacrificing the animal

  • Sources of DNA and How Samples Should be Collected

    Tissue typeAmountQuantityQuality Preservation methodBlood5 10 dropsHighGoodEDTA coated tubesLysis Buffer (Longmire)Filter paper Muscle Square 2 cm on a sideHighGoodBufferFeatherAt least 1LowGoodDryEgg shell membranesAs much as is possibleDependsGoodDryHairAt least 1LowGoodDryScatVariableLowPoorEthanol or DryTeethVariableLowDependsDryBoneVariableLowDependsDryBuccal SwabVariableLowGoodLysis Buffer (Longmire)

  • TaxonomyWhile most taxonomic classes are somewhat arbitrary (subspecies, genera, order) the species classification is perceived to be based on real, evolutionary units

    Species definition is integral to the Endangered Species Act

    Two most common and applied species concepts are Biological (BSC) and Phylogenetic (PSC)

    BSC emphasizes reproductive isolation

    PSC uses the criterion of reciprocal monophyly and typically relies solely on genetic data

  • Comparison of greater sage-grouse (left) and Gunnison sage-grouse (right). Gunnison sage-grouse were recognized as a new species in 2000 based on differences in morphology, behavior, and genetics.

  • HybridizationGenetic methods can be used to document hybridization, introgression, and taxonomic status

    Molecular techniques can also be used to determine the maternity and paternity of hybrids

  • Evolutionary Significant UnitsGenetic methods can be used to objectively prioritize conservation and management value below the species level

    Evolutionary Significant Units (ESU) and Management Units (MU) allow for that prioritization

  • Conservation of Genetic DiversityFour main forces affect Genetic Diversity Mutation Gene Flow Genetic drift Selection

    Understanding these forces can aid in the management of genetic diversity

  • MutationChanges in the DNA sequence that result in new genetic variation

    Usually management actions have little affect on this process

    Mutations can be increased by some environmental contaminants

    Mutations are low frequency events and thus have been hard to detect; this is changing with the development of better screening technologies

  • Gene FlowResults from individuals moving from their natal population to a new one, where they successfully reproduce

    Often reported as Nm, the number of migrants per generation, where N is the average size of the populations and m is the migration rate between them.

    Gene flow is negatively related to the amount of differentiation observed between populations

    Population differentiation is often expressed as the FST , which can be defined as the proportion of the total variance in allele frequencies due to differences among populations

  • Gene FlowThe greater the exchange of individuals between populations the more that genetic similarity of the populations will increase Equilibrium relationship of genetic differentiation among subpopulations (as measured by FST) and number of migrants per generation (modified from Mills and Allendorf 1996).

  • Sex-biased DispersalIn many wildlife species, one sex tends to disperse to a new area, while the other remains near its natal site

    In such species, DNA that is paternally inherited, such as the Y chromosome in mammals, or maternally inherited, such as mtDNA, can have very different patterns of population structure than nuclear markers

  • Gene FlowBecause gene flow is high between most wildlife populations, FST tends to be low

    However, even in migratory birds, such as in the golden-cheeked wabler and black-capped vireo, that can move great distances, population differentiation can result from cases of habitat fragmentation(Photographs by Kelly Barr)

  • Habitat FragmentationBecause fragmentation can lead to genetic differentiation and loss of variation, management often attempts to prevent fragmentation or to reconnect habitat fragments with corridors

    In extreme cases, managers may assist migration by moving individuals between fragmented populations

    Reintroduction programs, that translocation individuals from sites they are common, to sites they are rare or absent, also can result in gene flow.

  • Genetic DriftRandom changes in the frequencies of alleles

    Increases with decreasing population size

    Increases genetic differences among small, isolated populations

    Gene flow counteracts the influence of drift

  • Genetic DriftWhen a normally large population goes through a constriction in size, it is referred to as a genetic bottleneck

    During bottlenecks, drift is accelerated

    Severe bottlenecks, reducing the size of a population to just a few individuals, can cause the loss of many alleles from a population

    Long bottlenecks increase the occurrence of inbreeding in a population

  • Genetic DriftThe rate of loss of variation in a population is to a populations effective size (Ne)

    Ne is often smaller than the number of breeding adults in a population

    Ne can be reduced below the census population size by many factors, including unequal sex ratios, temporal differences in population size, and large variation among the number of young produced by the adults in the population

  • Human ActivitiesA number of human activities can increase drift:

    Creation of small populations , through habitat fragmentation and degradation, as well as over harvest

    Releasing only a small number of individuals in translocation programs

    Creating very skewed sex ratios in game species, by harvesting only one sex

  • SelectionDifferential survival and fecundity of genotypes can have complex effects on genetic diversity

    Typically, selection plays only a minor role in discussions about of management of genetic diversity

    Technological