saint cecilia churchaug 23, 2020 · saint cecilia church will be september 2nd at 7:00pm....
TRANSCRIPT
Saint Cecilia Church 23 August, 2020
Twenty-first Sunday in Ordinary Time
#179 2
OFFICES Rectory 215.725.1240 Eleanor Kerwick Business 215.725.1240 Susan Wagner PREP 215.725.2821 Eileen Litka School 215.725.8588 Bobbie Mitchell Tuition 215.725.2201 Lisa Hnat Fax 215.725.2130 Website: www.stceciliafc.org School: scsfoxchase.org CYO Facebook: Saint Cecilia Catholic Youth Organization
Rectory Office Hours Currently closed ~ call 215-725-1240 for emergency.
Saint Cecilia Church 535 Rhawn Street
Philadelphia, Pennsylvania 19111
PASTOR Reverend Charles E. Bonner
PASTOR EMERITUS Reverend Msgr. Francis X. Dreger
PAROCHIAL VICAR Reverend Robert Lucas PERMANENT DEACON Deacon Patrick Diamond
PRINCIPAL Sister Catherine Irene Masino , IHM
VICE PRINCIPAL Sister Carolyn Elizabeth Braun, IHM
SACRAMENTS Baptism First three Sundays of the month at 12:15pm. Arrangements must be made at least two weeks prior to the Baptism. At-tendance at a Pre-Jordan class is required for first time par-ents. Please pre-register for class by contacting the Rectory at 215-725-1240. Marriage Couples must contact a priest six months prior to the wedding. Reconciliation Saturdays from 4:00 to 5:00pm Homebound Visitation Please contact the Rectory.
Mass Schedule for Weekend ~ August 29 & 30 Saturday (Vigil) 5:00pm Celebrant: Fr. Lucas Lector: Colleen Demusz 6:30am Celebrant: Fr. Bonner Lector: Celine Severino 8:00am Celebrant: Fr. Bonner Lector: Kate Meredith 9:30am Celebrant: Fr. Lucas Lector: Rita Malfara 11:00am Celebrant: Fr. Lucas Lector: Dale Tan
Mass is live-streamed 9:30am on Sundays
https://www.facebook.com/St-Cecilia-Church-Fox-Chase
God bless our newly baptized Kacy Josephina Nicolo Gemma Grace Gillen
PREP Parish Religious Education Program
Register NOW for 2020-2021 year
Classes will be online via Zoom beginning Sunday, September 13.
Call the rectory at 215-725-1240 to register for PREP. A completed form along with payment, baptismal certifi-cate or permission from Pastor of another parish are due to the rectory immediately. COST: $75 (one child) $125 (two children) $175 (three or more children) Study books will be available for pick up on Saturday, August 29 at the PREP office from 9:30am to 12:00 noon. This is the only day you will be able to pick up your books.
Sunday Vigil 5:00pm (Saturday)
6:30am, 8:00am, 9:30am, 11:00am
Monday through Friday 6:30 and 8:30 am
Saturday 8:30 am
#179 3
Pray For Our Troops Jason Showmaker (Navy) Mark Strecker (Navy) Michael D’Antonio (Air Force) Sean Lay (Army) Brian A. Mason (Army) Christopher J. Starrett (USMC) Brandan Beaudet (USMC) Michael Molz (Army) Patrick Breslin (Army) Erin Bartholomew (Navy) Nick Marteney (Navy) Martin P. O’Donnell (Trauma Nurse-Air Force)
21st Sunday in Ordinary Time The Liturgy of the Word First Reading Book of prophet Isaiah 22:19-23 Thus says the LORD to Shebna, master of the palace: “I will thrust you from your office and pull you down from your station. On that day I will summon my servant Eliakim, son of Hilkiah; I will clothe him with your robe, and gird him with your sash, and give over to him your authority. He shall be a father to the inhab-itants of Jerusalem, and to the house of Judah. I will place the key of the House of David on Eliakim’s shoulder; when he opens, no one shall shut when he shuts, no one shall open. I will fix him like a peg in a sure spot, to be a place of honor for his family.” The word of the Lord. Thanks be to God. Responsorial Psalm Lord, your love is eternal; do not forsake the work of your hands. Second Reading Letter of St. Paul to the Romans 11:33-36
Oh, the depth of the riches and wisdom and knowledge of God! How inscrutable are his judgments and how unsearchable his ways! For who has known the mind of the Lord or who has been his counselor? Or who has given the Lord anything that he may be repaid? For from him and through him and for him are all things. To him be glory forever. Amen. The word of the Lord. Thanks be to God. Gospel The holy Gospel according to Matthew 16: 13-20
Jesus went into the region of Caesarea Philippi and he asked his disciples, “Who do people say that the Son of Man is?” They re-plied, “Some say John the Baptist, others Elijah, still others Jere-miah or one of the prophets.” He said to them, “But who do you say that I am?” Simon Peter said in reply, “You are the Christ, the Son of the living God.” Jesus said to him in reply, “Blessed are you, Simon son of Jonah. For flesh and blood has not revealed this to you, but my heavenly Father. And so I say to you, you are Peter, and upon this rock I will build my church, and the gates of the netherworld shall not prevail against it. I will give you the keys to the kingdom of heaven. Whatever you bind on earth shall be bound in heaven; and whatever you loose on earth shall be loosed in heaven.” Then he strictly ordered his disciples to tell no one that he was the Christ. The Gospel of the Lord. Praise to you, Lord Jesus Christ.
FOCUS: Jesus is the Christ, the Son of the living God.
We are reminded in the reading from Romans that God is the ulti-mate authority. It is God who gives all, who creates all, and for whom all exists. Let us, then, through prayer and deeds, humbly and con-fidently acknowledge Jesus as the Son of the Living God. LITURGY OF THE WORD: The Lord tells Shebna, the scribe, I will thrust you from your office and pull you down from your station and replace you with the honorable Eliakim. In the second reading, Paul writes to the Romans about the in-scrutable judgments and unsearchable ways of God: For from him and through him and for him are all things. In the Gospel, Peter answers Jesus’ ques-tion, saying, You are the Christ, the Son of the liv-ing God. Jesus blesses Peter and proclaims him as the rock upon whom he will build his Church. REFLECTION: Jesus is not just a wise teacher or another prophet like John the Baptist, Elijah or Jer-emiah. In our accepting Christ as "the Son of the living God" and receiving the grace God offers us in him, we can change our lives and affect the world around us. We can more and more show the person of Jesus to the world so that others will also come to acknowledge him as "the Son of the living God." So we ask ourselves:
What response would we give if Jesus were to ask us what he asked Peter? "But who do you say that I am?"
What changes must I make so that others will experience me as a person who believes that Jesus is "the Son of the living God?"
Help for YOU Food Cupboard Catholic Social Services at 7340 Jackson St. 19136 Monday, Wednesday, Friday 9:00am—12:00pm
Diaper Pantry We offer diapers, formula and baby items for those 32 weeks pregnant and parents with children under age 3. By appointment only—call 215-624-5920 Catholic Social Services at 7340 Jackson St. 19136
Rental Assistance (Rent, mortgage or utility assistance) Call Catholic Social Services at 215-624-5920
#179 4
Lectors play a key role in the cele-bration of Mass. A lector is a Minis-ter of the Word who proclaims
God’s Word to the assembled faith community. Liturgical proclamation of the Word is an awesome responsibility to which one is called and into which one is formed.
Anyone interested in joining this ministry for Sunday Masses, please contact Dave Schein by stopping in the Sacristy on the weekend or call 215-725-0903.
Pre-Jordan First time parents must attend a Pre-Jordan class and Godparents are also welcome. The next Pre-Jordan class at Saint Cecilia Church will be September 2nd at 7:00pm. Pre-registration is required by contacting the rectory at 215-725-1240.
The following Pre-Jordan class will be held at Saint Albert the Great on October 4th at 1:15pm in their rectory. Please call 215-947-3500 to register for that class.
We also would like to say Thank You to Marcia Mason as she is stepping down from the job of PREP Coordinator. For the past 6 years as the Coordinator and 4 years as a Catechist, Marcia has dedicated her time and talent to this program in many ways. We thank her for all that she has done and continues to do for our parish community.
We extend a warm welcome to members of our education community.
Principal Our Saint Cecilia School has a new Principal! We welcome Sister Catherine Irene Masino, IHM to our school community. For the past 12 years, Sister Catherine was the Principal of St. Joseph School in Downingtown, PA. She also served as the Principal of St. Matthew School in Forestville, CT for 4 years. Sister taught at St. Aloysius Academy in Bryn Mawr for 8 years and served as an IHM Community Supervisor for 7 years.
Sister Catherine was born and raised in South Philadelphia where she attended Our Lady of Mt. Carmel School and St. Maria Goretti High School. She is the second of 7 children and has a twin sister.
We welcome Sister to our school and parish and let us keep her in our prayers as she begins this new chapter of her life in Fox Chase.
Vice Principal Our school community also has a new Vice Principal. How lucky are we to welcome another new Sister! Sister Carolyn Elizabeth Braun, IHM is originally from St. Maria Goretti in Hatfield. She attended Catho-lic grade school through eighth grade and was homeschooled in high school. Sister Carolyn Elizabeth grad-uated from Rowan University in Glassboro, NJ with a degree in Mechanical Engineering. She then en-tered the convent in 2008. Sister taught 7th grade at St. Ephrem in Bensalem and 7th and 8th grade at St. James in Savannah, Georgia. She was also the Assistant Principal at St. James. Sister just moved back into the Archdiocese of Philadelphia and is so excited to be here! We welcome Sister Carolyn Elizabeth to our school and parish community and let’s keep her in our prayers as well.
PREP Coordinator We also have a new Coordinator of Religious Education who is taking over PREP. Eileen Litka is no stranger to our parish and PREP. She has been a catechist for 7 years in PREP spending most of her time with the Confirmation candidates. Eileen is now looking forward to assisting all the PREP students and their families and helping them continue to prepare to receive the sacraments and grow in their faith, especially during this very unusual school year. Eileen is also a Lector at Church. Let us keep Mrs. Litka in our prayers as she begins this new and exciting chapter in her life.
#179 5
Saint Cecilia School 525 Rhawn Street, Philadelphia, PA 19111
A Christ-Center Community Committed to Academic Excellence
Extra Curricular Activities Student Council Future Cities Team Forensics Mathletes Altar Servers Service Commission School Band/Strings Program CYO Sports Scouting Reading Olympics
Academics Religious Education Archdiocesan Elementary Curriculum Honors Math Science Lab Program Technology Music Education Physical Education/Health Fine Arts
Special Services CARES (after school program) CORA (Educational & Counseling Services) SHALOM Program NDS Program (we offer FREE break-fast and lunch for students) Catapult (Title 1 Reading, ELL, Family Counseling )
Middle States Accreditation PA Licensed Early Childhood Program & Afternoon School Care
Register NOW for 2020-2021 215-725-8588 (Main Office) 215-725-2201 (Tuition Office)
Sponsor a Student (2020-2021) This program helps our families who want to send their children to Saint Cecilia School and may have some financial difficulty along the way. With your help these families can keep their child in our school and receive a good Catholic education.
There are several gifting levels and payment options - You can make a one time payment or select any option you wish. We will identify those students with the greatest need and allocate the funds accordingly. For more information on this program or to give a tax de-ductible gift, please feel free to contact Lisa Hnat, Tuition Coordinator at 215-725-2201 or email at [email protected].
179 Church of St. Cecilia, Philadelphia, PA (3rd) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
Stone • Brick • Concrete • Pointing • EP Henry • Stucco • Waterproofi ngZucaroZucaroCONTRACTINGCONTRACTING
Masonry ContractorsSince 1922
215.533.1934215.533.1934
20% Discounton Labor for all Mechanical Work
15% Cash Paidfor Accident Referrals
$39.00+tax
Inspection & Emissions
$19.95Oil Change
(Most Cars)
Auto Body & Repair Shop
612 Huntingdon Pike, Rockledge 215-379-3113 www.abbysautocenter.com
Lifetime Warranty on all Paint & Body Work. Satisfaction Guaranteed
In Our 4th Decade of Quality Service
French Drains • Foundation Repair • Mold Remediation
215-639-8500www.morganbasementwaterproofing.com
All Work Guaranteed
Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you money with your monthly
payments on your commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four
season customer service is our top priority.
www.duqfunding.com1650 Market Street - Suite 3600, Philadelphia, PA 19103
• Physical, Occupational & Speech Therapy• Short & Long Term Care• Beautiful On-Site Chapel With Daily Mass• Memory Support • Respite Stay• Adult Daycare • Woundcare• IV Therapy • Trach Care
ST. JOHN NEUMANN CENTERFOR REHAB AND HEALTHCARE
10400 Roosevelt Blvd.Philadelphia, PA
215-698-5600www.stnrehab.org
BUILD YOUR COMMUNITYBUILD YOUR COMMUNITY- Shop Local -
P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !
Advertise Your Business Here800-333-3166
ext. 161www.jppc.net
Rafferty Roofi ng215-281-0771
PA062531
For Quality & Honest Work at Reasonable PricesFree Estimates • Licensed & Insured
20 YEAR GUARANTEE ON HOT WHITE RUBBER ROOF
After
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications
To all those essential workers keeping us safe,
yourservice is
invaluable & appreciated.
rivate & Public Healthcare - La- - - -- -- - - - nforcement, Public Safety - OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOfficeccecececececececececececece
ponders - Fooooooooooood &d & d &d & d & d & d & d &d & d &d &d &d & d & d & AAAAAAgrAAAAAAAAlture - Energy Sector rrrrrrrr rrrrr - Wa- Wa- Wa- WWW- Wa- Wa- Wa- WaWa- Wa- Wa- WWaste
Waterwaste - Transportattattattattattattatattatattattattattta ion ion ion ononononon on on onon on on on & Lo&&&&&&&& gics - Public Woooooooorks r & - & Infrfffffffffffff astastrastrtstttstaststtsttstst uctur
Communicatatatttttttatattatttioionononsionsionionionionsionionsiooniono & I&&&&&&&&& nforf matioy Workeorkekkekekekekekekekekekkekers -rs -rs -rs -rs -rs -rs -rs rs -rs -rs -rs -rs -s -s - Community
overnment WWWWWWWWWWWWWWWorkeorkeorkeorkeorkorkorkeorkeorkeorkeorkeorkorkorkeorkerrs - Critical Maacturing -g ---g --g -g ---g --g --- CheCheCheCheCheCheCheCheCheCheCheCheCheCheChemical & Hazardouateteeeeeeeeeeeeeerialrrrrrrrrrrrrrr s FiFiFiFiFiFiFiFiFiFiFiFiFiFiFinancnancnannannananaannanannancnancnancan ial Services - Defensdustristristristristristrstrtristristristritristritritrial Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Baasasasasasasase - Commercial Faciesssssessessssssss WorWorWorWorWorWorWorWorWorWorWorWorWorWorWorkkkkkkekekekerskekekkkk - Resid ti l & Sh ltervicesicesicesicescescecescesicesicesicescescescesces & Facilities - Hygiene Prod
To all thoserivate & Publicrivate & nforcement Pubnforcement Pub
ssentialFirst RespFirst Resp
workersWaterwaste Waterwaste
keepingcs - PublicuCommunCommun
s safe,chnologychnology
yzardouzardouD fD
service isvices DefensDefenmercial Facimercial Faci
invaluable &idential & Shelteidential & ShelteH i P dH i Ptha
nk yo
u
afeeeefeeeeeeeefefefefetyty --ttty --ttttty t -tt -- OffiOOOOOOOOOOOOO cers & First RespondeFFFoFFFFFF od &d &d &d &&&d &&d &&od d &&d &d &d &d &d &d &d &d &d AgrAAgrAAAAAgrAAAAAgrgrrgrrAggrrrAgrA rrgAAA rAAAgrAAgg iculicucuiculuiculiculiculcuiculiiicuicultureturetureurertureurturertureurrrurerrrurrtur - E- E- EE- E- E- E-- EEE- EEEnergy Se
ooroorror rrr - WaWa- WaWa- Wa- WW- WaWWWWWW- W- WWaa- WWaWaWaaWaasteststtstee stesssteetsteetts ess ees e & Wa& Wa& W& Wa& WaWaWW& Wa& Wa& WaW& Wa& Wa& WaWWWaa&& W& WaWa& Waterwterwterwterwteterwterwterwterwerwtterwe wteteerwerwerwrwwterwtterwwwasteastasteaasteasteaastesteteasteaassteasteaststststeeeeeee - TTT- T- TT- TT- T--- T- TT- T-- ranrarrarararrararraararaaaraarortrtrtrtrtrrrttttttatioatitiatiotitatiattiiatataatatataaaa n &&n & n &&n &nn Logistics - Public Wor
MASSES FOR THE WEEK OF August 24
MONDAY, August 24 6:30am – Leroy Gallus 8:30am – Gerard E. Gantert
TUESDAY, August 25 6:30am – Joseph F. Berthcsi 8:30am – Edward Urewich
WEDNESDAY, August 26 6:30am – William MacNeal 8:30am – Kyle Peahota
THURSDAY, August 27 6:30am – Joan Paladino 8:30am – Mary Beth Lavin
FRIDAY, August 28 6:30am – Peter Hallinan 8:30am – Art Vozelli
SATURDAY, August 29 8:30am – Rose Lanciotti 5:00pm – Venturine & Joseph Davino & family
Remember Our Sick and Suffering Walter Hnat Ed Lieber Christopher Rodgers Patricia Moore James J. Tobin Mary Schultz Ann Marie Tobin Masgai Charles Friel Meghan Kovacs Joan Marie Reiley John Lawrysk Maki Turner Kirsten Hosack-Edling Stephanie Morgan James Potts Owen Doyle Mary Benson Esther Sharp Mary Jane Brough Leo Wuestkamp Stephen Ruczynski Helen Tobin Mike McKee Andrew Slivjak Melissa Fischer George Burbage Patricia Greenleaf Rita Giordano Daniel Mitchell Lisa Kovacs-Breuer Gregory Farrell Ed MacNew Timothy Martin John Smykal Julia McCauley Alice Davis Mary Matthews Josephine O’Donnell Marguerite Zeltman Alice Zmijewski Jack Vogler Eileen Gaynor Alberta DeMasi Eleanor DeNoble Eugenia DiSilva Marian Diel Kathi Silcox Catherine Needham Connie Merkel Ellen Jones
Let us pray for the souls of all the faithful departed, especially Marie Miller Bernard Ferry Kathleen Meehan John Terembula, Sr. Helen Maksymink Kimberly Tazioly
179 Church of St. Cecilia, Philadelphia, PA (i) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
FOX CHASE WINDOWS & DOORSSALES - INSTALLATION
Please Call ... 215-725-4211
FREE ESTIMATES
Parish Member
ALL TYPES WIRING & REPAIRS215–329–9456 Parish Member
G.J. ROSSI & SONELECTRICIANS
Now In Our 3rd Generation
PATRICK J. FOY(215) 281-9656
Interior & Exterior PaintingWallpapering & Scraping
FREE Estimates • Reliable • Honest
309 Central Ave., Cheltenham379-0881
JOSEPH P. FARLEYPLUMBING & HEATING
Alterations-Jobbing
Reg. No. 3121P.A. 043294
Classic OpticalDR. AMY C. TAN, O.D. 215-722-2242
*Eye Exams * Contact Lenses * Eyeglasses6516 R S A . (G R S )
Sweeney’sVerree Tavern
KITCHEN OPEN FROM 11 AM TO MIDNIGHT
The all new Kim’s Crab CakesPhilly’s Largest Wings
All Soups & Chili HomemadeTAKE OUT AVAILABLE
All Major Sporting Events With 6 Colored TV’s
Finest Tavern Food Now Available in our
New Private Dining Room
7968 VERREE RD.215–725-3366
Mariann OwensOffi ce: (215) 698-2000Direct: (215) 698-2027Cell: (215) 280-7222Email: [email protected] Buyers and Sellersin Philadelphia, Bucks, and Montgomery CountiesEach Offi ce Independently Owned and Operated
2000
SENIOR CITIZEN DISCOUNTS
ReliableFull Service Plumber
PLUMBING, HEATING & DRAIN CLEANING EMERGENCY SERVICE
INSURED • FREE ESTIMATES215-722-6783215-379-8300
SERVING ENTIRE CITY & SUBURBS
CITY VIOLATIONS CORRECTED
SEWER LINES REPLACED • HOT WATER HEATERSFROZEN PIPES • WATER PRESSURE INCREASED
DIGGING & EXCAVATION SPECIALISTS
Reg. Master Plumber #4287Michael Zalewski
Experience Peace of Mind:Pre-Arrange Your Burial at an
Archdiocese of Philadelphia Cemetery.
• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries
CALL 215-352-4001 TODAY
Leslie AitaVocalist
Parishioner
Visit Us At Our New Location
Rockledge Plaza Huntingdon Pike
408 Huntingdon PikeRockledge, PA 19046215-379-2100
Family Ownedand Operated
Since 1948
$350Off Any New Stairlift With This Ad
• FREE in home evaluations• Family owned & operated for more than 20 years
1.888.900.8883
www.Tri-StateStairlifts.com
Traditional Funerals, Church Funerals & Memorial Services, Cremations“ONE FAMILY HELPING ANOTHER”
7450 Oxford Ave Phila, PA 19111 215-728-1050
David G RichardsonSupervisor/Owner
Cher l A Webb-RichardsonManager & LCBA Insurance Rep
Parishioner
richardsonsfuneralhome.com Councilman Brian O’Neill
Northeast offi ces near St. Cecilia ParishionersFox Chase - 432 Rhawn Street • 215-685-6431 • Rhawnhurst - 7522 Castor Ave • 215-685-0438
FreeNotaryPublic
Free copies
& Faxes
Karon MassadoReal Estate Salesperson
o 267.435.8015 m [email protected]
1601 Market St.- Fl. 19, Phila, PA
Wackerman Funeral Home, Inc.Wackerman Funeral Home, Inc.8060 Verree Rd. Philadelphia, PA 19111
www.wackermanfuneralhome.com 215-342-5200 Elizabeth Wackerman Bailey, Supervisor 1944 – Austin C. Wackerman - 2017 Emily Wackerman Funeral Director
Free & Confi dential Pregnancy Services24 Hour Hotline: 1-800-550-4900
www.BirthRight.org
“It is the right of every pregnant woman to give birth, and the right of every child to be born.”
~Birthright Charter7986 Oxford Avenue
Philadelphia, PA 19111215-728-0385
A Blessing from God
John DeCristofaroROOFING
Specializing in: Hot Asphalt RoofsShingle Roofs • Gutters • Spouts
215-379-2953 Member of St. Cecilia
A Tompkins Community BankFormerly Madison Bank
8000 Verree Rd., Philadelphia(215) 722-4566
www.risingsunhomecare.org
Providing The Highest Quality Care
Parishioner of St. Cecilia
215-605-9555
catering For your next event, call ahead to order
- Pickup or Delivery -WHITMAN SQUARE 215-969-3455 x1
Eric McHughParishioner
CYO Volunteer OFFERING AUTO, HOME, LIFE,
& BUSINESS INSURANCE Call for a quote
215-328-9990 x7001 or email [email protected]
210 Huntingdon Pike, Rockledge
Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting. This describes the power of...
ve, supuuuu portive, refefefefefefefferrals, relationshipppps,,,, affordable, repeeee etitious, versatile, last
Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN! Call 1.800.333.3166!
What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle
to make sure it is the car they are supposed to enter.
In Remembrance of Samantha Josephson
#WHATSMYNAME
Patronize the Adve isers who make this bulletin possible!
BUILD YOUR COMMUNITY!
Patt o i e the A
SHOP LOCAL
To advertise your business in this weekly bulletin,contact us at 1.800.333.3166
or visit us at www.jppc.net
179 - Church of St. Cecilia, Philadelphia, PA (b) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
Schmidt’s Florist 700 Solly Ave., Phila., PA 19111
www.schmidtsfl orist.com 215-745-6234
LAW OFFICES
PAUL A. COGHLAN437 RHAWN STREET
PHILADELPHIA, PA 19111(215) 725-5998
FAX (215) 725-3904
Robert Wetzel, F.D.419 Huntingdon Pike, Rockledge
Erich Wetzel, Supv.Willow Grove - Bill Herchenroder, Supv. INC.
Funeral Directors Since 1881 215-663-8550 • www.wetzelandson.com
Stewart and McGowanATTORNEYS-AT-LAW
6221 RISING SUN AVE. (Opposite St. William’s Church)338-2800
S W D ’ E
WE DELIVER~ Traditional Pizza~ White Pizza~ Tomato Pies
The Original
Pizza6500 Rising Sun Ave. • 215-745-9992
Nora McCloskeyParishioner
Fine Art ClassesWorkshops & Partiesfor Children & Adults215-301-0103
www.bloomingartiststudio.comwww.bloomingartiststudio.com
PLUMBING, HEATING, DRAIN CLEANING & AIR CONDITIONING
SENIOR CITIZEN DISCOUNTFREE ESTIMATES
Ph: (215) 728-1482Fax: (215) 742-7098
8675 Torresdale Ave.Philadelphia, PA 19136
WWW.BILLFRUSCO.COM
O’Donnell PaintingInterior and Exterior
House Painting & Drywall RepairNeat Clean Work • No Job Too SmallFree Estimates 215-677-5854
THOMAS A. CUNNINGHAM, ESQ.Attorney At Law
AUTO ACCIDENT — PERSONAL INJURYWILLS — DIVORCE — REAL ESTATE
109 Huntingdon Pike • Rockledge, PA 19046215-722-6230
JOHN F. GIVNISH(3rd Generation)
JOHN F.X. GIVNISH, III(4th Generation)
Serving the Archdioceseof Philadelphia with
grace and dignity since 1928
1-800-GIVNISH
Each Offi ce Independently Owned and Operated
Larry AitaREALTOR®
Seniors Real Estate SpecialistOutstanding Agents. Outstanding Results.
Regency Realty
Cell: (215) 478-4344Offi ce: (215) [email protected]’s Get Moving!
2018 Outstanding
Agentof the Year
s.
ParishionerServing Families Since 1900
Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick, F.D. 1924-2013
Th omas M. McGoldrick, F.D. SupervisorJames T. Meyers, F.D. • Timothy J. Meyers, F.D.
215-884-0800 507 West Avenue, Jenkintown, PA 19046 www.mcgoldrickfh .com
Mallory’s Army FoundationUnited Together In The Fight Against Bullying...
Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com
(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send your email address by text message:
Text MALLORYSARMY to 22828 to get started.Message and data rates may apply.
Advertise Your Business Here800-333-3166
ext. 161www.jppc.net
JIM CASEYWallcoveringPainting • ScrapingClean Work • Since 1986215-379-0558 Member of Parish
Professionals Serving Professionals
Jay B. ComlyBuilding & Offi ce Maintenance
w/an A+ Rating
Commercial • AutomotiveResidential • Safes
Fully Equipped RadioDispatched Mobile Trucks
7936 Oxford Ave. 215-745-5007
Full Service Locksmith Since 1978Member of Parish
VERREEPHARMACY
7960 VERREE RD.(AT RHAWN)Free Delivery
M-F 9AM - 8PMSat. 9AM - 6PM
Sun. 9AM - 1 PM215-342-0100
Mitchell Spivack, R. PH.
HandymanElectric, PlumbingOdd jobs... Just Ask!
From McCloy’s TV 267-231-8785
Tax & AccountingFrancis J. McConnell CPA
Tax Preparation • Individual & Business(Across from St. Williams)
Call (215) 742-3428 for Appointments
Charles P. Elliott, PC 110 Central Ave
Cheltenham, PA 19012
215-663-2500We Make House Calls
Complimentary InitialConsultation
We are here for all your tax, IRS, fraud investigations,
& inheritance tax.
RENEE ROACHEREALTOR ~ PARISHIONER
FOX CHASE SPECIALISTBuying or Selling a Home?
Call Today!
Office 215-961-6000 Cell [email protected]
EASTERNEEEAEAAEAEEEEEEEEEEEEEEEEAEASTSTTTSTTTSSTTTTTTTTTEEREEEEEEEEEEEEEEAEAEAEEEEEEEEASTSTTTSTTSSTTTEEEREEEE
A Signature Hair Salon llc$10 OFF Color ServiceMen | Women | Children
7950 Bustleton Ave., Philadelphia, PA215-821-3522
Cochrane Construction LLC
ROOFINGSIDING * GUTTERS
Chimney Restorations & RepairsLicensed & Insured PA # 154589
Senior Citizen Discounts • Free Est.215-839-4317
www.cochraneconstruction.org
Friends, Family, Neighbors!
1-844-640-4200 PaulsRun.org/Living
Wedding Invitations Wedding Invitations & Holiday Cards& Holiday CardsLog onto Log onto www.jppc.netwww.jppc.netconveniently from yourconveniently from yourhome or offi ce.home or offi ce.Online CatalogOnline CatalogOnline OrderingOnline OrderingOnline ProofingOnline ProofingAll Major Credit All Major Credit Cards AcceptedCards Accepted
FREE UPS FREE UPS GROUND GROUND SHIPPINGSHIPPING!
WE CARE AND IT SHOWS
Beautiful On-Site Chapel with Daily Mass - Respite Stay Available
We Acknowledge We Appreciate
2990 Holme Ave., Phila.215-335-2100
www.imrehab.org
IMMACULATE MARYCENTER
Rehabilitation & Healthcare
Advertise Your Business Here
800-333-3166 ext. 161www.jppc.net