saint cecilia churchaug 23, 2020  · saint cecilia church will be september 2nd at 7:00pm....

8
Saint Cecilia Church 23 August, 2020 Twenty-first Sunday in Ordinary Time

Upload: others

Post on 26-Sep-2020

3 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Saint Cecilia ChurchAug 23, 2020  · Saint Cecilia Church will be September 2nd at 7:00pm. Pre-registration is required by contacting the rectory at 215-725-1240. The following Pre-Jordan

Saint Cecilia Church 23 August, 2020

Twenty-first Sunday in Ordinary Time

Page 2: Saint Cecilia ChurchAug 23, 2020  · Saint Cecilia Church will be September 2nd at 7:00pm. Pre-registration is required by contacting the rectory at 215-725-1240. The following Pre-Jordan

#179 2

OFFICES Rectory 215.725.1240 Eleanor Kerwick Business 215.725.1240 Susan Wagner PREP 215.725.2821 Eileen Litka School 215.725.8588 Bobbie Mitchell Tuition 215.725.2201 Lisa Hnat Fax 215.725.2130 Website: www.stceciliafc.org School: scsfoxchase.org CYO Facebook: Saint Cecilia Catholic Youth Organization

Rectory Office Hours Currently closed ~ call 215-725-1240 for emergency.

Saint Cecilia Church 535 Rhawn Street

Philadelphia, Pennsylvania 19111

PASTOR Reverend Charles E. Bonner

PASTOR EMERITUS Reverend Msgr. Francis X. Dreger

PAROCHIAL VICAR Reverend Robert Lucas PERMANENT DEACON Deacon Patrick Diamond

PRINCIPAL Sister Catherine Irene Masino , IHM

VICE PRINCIPAL Sister Carolyn Elizabeth Braun, IHM

SACRAMENTS Baptism First three Sundays of the month at 12:15pm. Arrangements must be made at least two weeks prior to the Baptism. At-tendance at a Pre-Jordan class is required for first time par-ents. Please pre-register for class by contacting the Rectory at 215-725-1240. Marriage Couples must contact a priest six months prior to the wedding. Reconciliation Saturdays from 4:00 to 5:00pm Homebound Visitation Please contact the Rectory.

Mass Schedule for Weekend ~ August 29 & 30 Saturday (Vigil) 5:00pm Celebrant: Fr. Lucas Lector: Colleen Demusz 6:30am Celebrant: Fr. Bonner Lector: Celine Severino 8:00am Celebrant: Fr. Bonner Lector: Kate Meredith 9:30am Celebrant: Fr. Lucas Lector: Rita Malfara 11:00am Celebrant: Fr. Lucas Lector: Dale Tan

Mass is live-streamed 9:30am on Sundays

https://www.facebook.com/St-Cecilia-Church-Fox-Chase

God bless our newly baptized Kacy Josephina Nicolo Gemma Grace Gillen

PREP Parish Religious Education Program

Register NOW for 2020-2021 year

Classes will be online via Zoom beginning Sunday, September 13.

Call the rectory at 215-725-1240 to register for PREP. A completed form along with payment, baptismal certifi-cate or permission from Pastor of another parish are due to the rectory immediately. COST: $75 (one child) $125 (two children) $175 (three or more children) Study books will be available for pick up on Saturday, August 29 at the PREP office from 9:30am to 12:00 noon. This is the only day you will be able to pick up your books.

Sunday Vigil 5:00pm (Saturday)

6:30am, 8:00am, 9:30am, 11:00am

Monday through Friday 6:30 and 8:30 am

Saturday 8:30 am

Page 3: Saint Cecilia ChurchAug 23, 2020  · Saint Cecilia Church will be September 2nd at 7:00pm. Pre-registration is required by contacting the rectory at 215-725-1240. The following Pre-Jordan

#179 3

Pray For Our Troops Jason Showmaker (Navy) Mark Strecker (Navy) Michael D’Antonio (Air Force) Sean Lay (Army) Brian A. Mason (Army) Christopher J. Starrett (USMC) Brandan Beaudet (USMC) Michael Molz (Army) Patrick Breslin (Army) Erin Bartholomew (Navy) Nick Marteney (Navy) Martin P. O’Donnell (Trauma Nurse-Air Force)

21st Sunday in Ordinary Time The Liturgy of the Word First Reading Book of prophet Isaiah 22:19-23 Thus says the LORD to Shebna, master of the palace: “I will thrust you from your office and pull you down from your station. On that day I will summon my servant Eliakim, son of Hilkiah; I will clothe him with your robe, and gird him with your sash, and give over to him your authority. He shall be a father to the inhab-itants of Jerusalem, and to the house of Judah. I will place the key of the House of David on Eliakim’s shoulder; when he opens, no one shall shut when he shuts, no one shall open. I will fix him like a peg in a sure spot, to be a place of honor for his family.” The word of the Lord. Thanks be to God. Responsorial Psalm Lord, your love is eternal; do not forsake the work of your hands. Second Reading Letter of St. Paul to the Romans 11:33-36

Oh, the depth of the riches and wisdom and knowledge of God! How inscrutable are his judgments and how unsearchable his ways! For who has known the mind of the Lord or who has been his counselor? Or who has given the Lord anything that he may be repaid? For from him and through him and for him are all things. To him be glory forever. Amen. The word of the Lord. Thanks be to God. Gospel The holy Gospel according to Matthew 16: 13-20

Jesus went into the region of Caesarea Philippi and he asked his disciples, “Who do people say that the Son of Man is?” They re-plied, “Some say John the Baptist, others Elijah, still others Jere-miah or one of the prophets.” He said to them, “But who do you say that I am?” Simon Peter said in reply, “You are the Christ, the Son of the living God.” Jesus said to him in reply, “Blessed are you, Simon son of Jonah. For flesh and blood has not revealed this to you, but my heavenly Father. And so I say to you, you are Peter, and upon this rock I will build my church, and the gates of the netherworld shall not prevail against it. I will give you the keys to the kingdom of heaven. Whatever you bind on earth shall be bound in heaven; and whatever you loose on earth shall be loosed in heaven.” Then he strictly ordered his disciples to tell no one that he was the Christ. The Gospel of the Lord. Praise to you, Lord Jesus Christ.

FOCUS: Jesus is the Christ, the Son of the living God.

We are reminded in the reading from Romans that God is the ulti-mate authority. It is God who gives all, who creates all, and for whom all exists. Let us, then, through prayer and deeds, humbly and con-fidently acknowledge Jesus as the Son of the Living God. LITURGY OF THE WORD: The Lord tells Shebna, the scribe, I will thrust you from your office and pull you down from your station and replace you with the honorable Eliakim. In the second reading, Paul writes to the Romans about the in-scrutable judgments and unsearchable ways of God: For from him and through him and for him are all things. In the Gospel, Peter answers Jesus’ ques-tion, saying, You are the Christ, the Son of the liv-ing God. Jesus blesses Peter and proclaims him as the rock upon whom he will build his Church. REFLECTION: Jesus is not just a wise teacher or another prophet like John the Baptist, Elijah or Jer-emiah. In our accepting Christ as "the Son of the living God" and receiving the grace God offers us in him, we can change our lives and affect the world around us. We can more and more show the person of Jesus to the world so that others will also come to acknowledge him as "the Son of the living God." So we ask ourselves:

What response would we give if Jesus were to ask us what he asked Peter? "But who do you say that I am?"

What changes must I make so that others will experience me as a person who believes that Jesus is "the Son of the living God?"

Help for YOU Food Cupboard Catholic Social Services at 7340 Jackson St. 19136 Monday, Wednesday, Friday 9:00am—12:00pm

Diaper Pantry We offer diapers, formula and baby items for those 32 weeks pregnant and parents with children under age 3. By appointment only—call 215-624-5920 Catholic Social Services at 7340 Jackson St. 19136

Rental Assistance (Rent, mortgage or utility assistance) Call Catholic Social Services at 215-624-5920

Page 4: Saint Cecilia ChurchAug 23, 2020  · Saint Cecilia Church will be September 2nd at 7:00pm. Pre-registration is required by contacting the rectory at 215-725-1240. The following Pre-Jordan

#179 4

Lectors play a key role in the cele-bration of Mass. A lector is a Minis-ter of the Word who proclaims

God’s Word to the assembled faith community. Liturgical proclamation of the Word is an awesome responsibility to which one is called and into which one is formed.

Anyone interested in joining this ministry for Sunday Masses, please contact Dave Schein by stopping in the Sacristy on the weekend or call 215-725-0903.

Pre-Jordan First time parents must attend a Pre-Jordan class and Godparents are also welcome. The next Pre-Jordan class at Saint Cecilia Church will be September 2nd at 7:00pm. Pre-registration is required by contacting the rectory at 215-725-1240.

The following Pre-Jordan class will be held at Saint Albert the Great on October 4th at 1:15pm in their rectory. Please call 215-947-3500 to register for that class.

We also would like to say Thank You to Marcia Mason as she is stepping down from the job of PREP Coordinator. For the past 6 years as the Coordinator and 4 years as a Catechist, Marcia has dedicated her time and talent to this program in many ways. We thank her for all that she has done and continues to do for our parish community.

We extend a warm welcome to members of our education community.

Principal Our Saint Cecilia School has a new Principal! We welcome Sister Catherine Irene Masino, IHM to our school community. For the past 12 years, Sister Catherine was the Principal of St. Joseph School in Downingtown, PA. She also served as the Principal of St. Matthew School in Forestville, CT for 4 years. Sister taught at St. Aloysius Academy in Bryn Mawr for 8 years and served as an IHM Community Supervisor for 7 years.

Sister Catherine was born and raised in South Philadelphia where she attended Our Lady of Mt. Carmel School and St. Maria Goretti High School. She is the second of 7 children and has a twin sister.

We welcome Sister to our school and parish and let us keep her in our prayers as she begins this new chapter of her life in Fox Chase.

Vice Principal Our school community also has a new Vice Principal. How lucky are we to welcome another new Sister! Sister Carolyn Elizabeth Braun, IHM is originally from St. Maria Goretti in Hatfield. She attended Catho-lic grade school through eighth grade and was homeschooled in high school. Sister Carolyn Elizabeth grad-uated from Rowan University in Glassboro, NJ with a degree in Mechanical Engineering. She then en-tered the convent in 2008. Sister taught 7th grade at St. Ephrem in Bensalem and 7th and 8th grade at St. James in Savannah, Georgia. She was also the Assistant Principal at St. James. Sister just moved back into the Archdiocese of Philadelphia and is so excited to be here! We welcome Sister Carolyn Elizabeth to our school and parish community and let’s keep her in our prayers as well.

PREP Coordinator We also have a new Coordinator of Religious Education who is taking over PREP. Eileen Litka is no stranger to our parish and PREP. She has been a catechist for 7 years in PREP spending most of her time with the Confirmation candidates. Eileen is now looking forward to assisting all the PREP students and their families and helping them continue to prepare to receive the sacraments and grow in their faith, especially during this very unusual school year. Eileen is also a Lector at Church. Let us keep Mrs. Litka in our prayers as she begins this new and exciting chapter in her life.

Page 5: Saint Cecilia ChurchAug 23, 2020  · Saint Cecilia Church will be September 2nd at 7:00pm. Pre-registration is required by contacting the rectory at 215-725-1240. The following Pre-Jordan

#179 5

Saint Cecilia School 525 Rhawn Street, Philadelphia, PA 19111

A Christ-Center Community Committed to Academic Excellence

Extra Curricular Activities Student Council Future Cities Team Forensics Mathletes Altar Servers Service Commission School Band/Strings Program CYO Sports Scouting Reading Olympics

Academics Religious Education Archdiocesan Elementary Curriculum Honors Math Science Lab Program Technology Music Education Physical Education/Health Fine Arts

Special Services CARES (after school program) CORA (Educational & Counseling Services) SHALOM Program NDS Program (we offer FREE break-fast and lunch for students) Catapult (Title 1 Reading, ELL, Family Counseling )

Middle States Accreditation PA Licensed Early Childhood Program & Afternoon School Care

Register NOW for 2020-2021 215-725-8588 (Main Office) 215-725-2201 (Tuition Office)

Sponsor a Student (2020-2021) This program helps our families who want to send their children to Saint Cecilia School and may have some financial difficulty along the way. With your help these families can keep their child in our school and receive a good Catholic education.

There are several gifting levels and payment options - You can make a one time payment or select any option you wish. We will identify those students with the greatest need and allocate the funds accordingly. For more information on this program or to give a tax de-ductible gift, please feel free to contact Lisa Hnat, Tuition Coordinator at 215-725-2201 or email at [email protected].

Page 6: Saint Cecilia ChurchAug 23, 2020  · Saint Cecilia Church will be September 2nd at 7:00pm. Pre-registration is required by contacting the rectory at 215-725-1240. The following Pre-Jordan

179 Church of St. Cecilia, Philadelphia, PA (3rd) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

Stone • Brick • Concrete • Pointing • EP Henry • Stucco • Waterproofi ngZucaroZucaroCONTRACTINGCONTRACTING

Masonry ContractorsSince 1922

215.533.1934215.533.1934

20% Discounton Labor for all Mechanical Work

15% Cash Paidfor Accident Referrals

$39.00+tax

Inspection & Emissions

$19.95Oil Change

(Most Cars)

Auto Body & Repair Shop

612 Huntingdon Pike, Rockledge 215-379-3113 www.abbysautocenter.com

Lifetime Warranty on all Paint & Body Work. Satisfaction Guaranteed

In Our 4th Decade of Quality Service

French Drains • Foundation Repair • Mold Remediation

215-639-8500www.morganbasementwaterproofing.com

All Work Guaranteed

Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you money with your monthly

payments on your commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four

season customer service is our top priority.

www.duqfunding.com1650 Market Street - Suite 3600, Philadelphia, PA 19103

• Physical, Occupational & Speech Therapy• Short & Long Term Care• Beautiful On-Site Chapel With Daily Mass• Memory Support • Respite Stay• Adult Daycare • Woundcare• IV Therapy • Trach Care

ST. JOHN NEUMANN CENTERFOR REHAB AND HEALTHCARE

10400 Roosevelt Blvd.Philadelphia, PA

215-698-5600www.stnrehab.org

BUILD YOUR COMMUNITYBUILD YOUR COMMUNITY- Shop Local -

P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !

Advertise Your Business Here800-333-3166

ext. 161www.jppc.net

Rafferty Roofi ng215-281-0771

PA062531

For Quality & Honest Work at Reasonable PricesFree Estimates • Licensed & Insured

20 YEAR GUARANTEE ON HOT WHITE RUBBER ROOF

After

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

rivate & Public Healthcare - La- - - -- -- - - - nforcement, Public Safety - OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOfficeccecececececececececececece

ponders - Fooooooooooood &d & d &d & d & d & d & d &d & d &d &d &d & d & d & AAAAAAgrAAAAAAAAlture - Energy Sector rrrrrrrr rrrrr - Wa- Wa- Wa- WWW- Wa- Wa- Wa- WaWa- Wa- Wa- WWaste

Waterwaste - Transportattattattattattattatattatattattattattta ion ion ion ononononon on on onon on on on & Lo&&&&&&&& gics - Public Woooooooorks r & - & Infrfffffffffffff astastrastrtstttstaststtsttstst uctur

Communicatatatttttttatattatttioionononsionsionionionionsionionsiooniono & I&&&&&&&&& nforf matioy Workeorkekkekekekekekekekekekkekers -rs -rs -rs -rs -rs -rs -rs rs -rs -rs -rs -rs -s -s - Community

overnment WWWWWWWWWWWWWWWorkeorkeorkeorkeorkorkorkeorkeorkeorkeorkeorkorkorkeorkerrs - Critical Maacturing -g ---g --g -g ---g --g --- CheCheCheCheCheCheCheCheCheCheCheCheCheCheChemical & Hazardouateteeeeeeeeeeeeeerialrrrrrrrrrrrrrr s FiFiFiFiFiFiFiFiFiFiFiFiFiFiFinancnancnannannananaannanannancnancnancan ial Services - Defensdustristristristristristrstrtristristristritristritritrial Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Baasasasasasasase - Commercial Faciesssssessessssssss WorWorWorWorWorWorWorWorWorWorWorWorWorWorWorkkkkkkekekekerskekekkkk - Resid ti l & Sh ltervicesicesicesicescescecescesicesicesicescescescesces & Facilities - Hygiene Prod

To all thoserivate & Publicrivate & nforcement Pubnforcement Pub

ssentialFirst RespFirst Resp

workersWaterwaste Waterwaste

keepingcs - PublicuCommunCommun

s safe,chnologychnology

yzardouzardouD fD

service isvices DefensDefenmercial Facimercial Faci

invaluable &idential & Shelteidential & ShelteH i P dH i Ptha

nk yo

u

afeeeefeeeeeeeefefefefetyty --ttty --ttttty t -tt -- OffiOOOOOOOOOOOOO cers & First RespondeFFFoFFFFFF od &d &d &d &&&d &&d &&od d &&d &d &d &d &d &d &d &d &d AgrAAgrAAAAAgrAAAAAgrgrrgrrAggrrrAgrA rrgAAA rAAAgrAAgg iculicucuiculuiculiculiculcuiculiiicuicultureturetureurertureurturertureurrrurerrrurrtur - E- E- EE- E- E- E-- EEE- EEEnergy Se

ooroorror rrr - WaWa- WaWa- Wa- WW- WaWWWWWW- W- WWaa- WWaWaWaaWaasteststtstee stesssteetsteetts ess ees e & Wa& Wa& W& Wa& WaWaWW& Wa& Wa& WaW& Wa& Wa& WaWWWaa&& W& WaWa& Waterwterwterwterwteterwterwterwterwerwtterwe wteteerwerwerwrwwterwtterwwwasteastasteaasteasteaastesteteasteaassteasteaststststeeeeeee - TTT- T- TT- TT- T--- T- TT- T-- ranrarrarararrararraararaaaraarortrtrtrtrtrrrttttttatioatitiatiotitatiattiiatataatatataaaa n &&n & n &&n &nn Logistics - Public Wor

MASSES FOR THE WEEK OF August 24

MONDAY, August 24 6:30am – Leroy Gallus 8:30am – Gerard E. Gantert

TUESDAY, August 25 6:30am – Joseph F. Berthcsi 8:30am – Edward Urewich

WEDNESDAY, August 26 6:30am – William MacNeal 8:30am – Kyle Peahota

THURSDAY, August 27 6:30am – Joan Paladino 8:30am – Mary Beth Lavin

FRIDAY, August 28 6:30am – Peter Hallinan 8:30am – Art Vozelli

SATURDAY, August 29 8:30am – Rose Lanciotti 5:00pm – Venturine & Joseph Davino & family

Remember Our Sick and Suffering Walter Hnat Ed Lieber Christopher Rodgers Patricia Moore James J. Tobin Mary Schultz Ann Marie Tobin Masgai Charles Friel Meghan Kovacs Joan Marie Reiley John Lawrysk Maki Turner Kirsten Hosack-Edling Stephanie Morgan James Potts Owen Doyle Mary Benson Esther Sharp Mary Jane Brough Leo Wuestkamp Stephen Ruczynski Helen Tobin Mike McKee Andrew Slivjak Melissa Fischer George Burbage Patricia Greenleaf Rita Giordano Daniel Mitchell Lisa Kovacs-Breuer Gregory Farrell Ed MacNew Timothy Martin John Smykal Julia McCauley Alice Davis Mary Matthews Josephine O’Donnell Marguerite Zeltman Alice Zmijewski Jack Vogler Eileen Gaynor Alberta DeMasi Eleanor DeNoble Eugenia DiSilva Marian Diel Kathi Silcox Catherine Needham Connie Merkel Ellen Jones

Let us pray for the souls of all the faithful departed, especially Marie Miller Bernard Ferry Kathleen Meehan John Terembula, Sr. Helen Maksymink Kimberly Tazioly

Page 7: Saint Cecilia ChurchAug 23, 2020  · Saint Cecilia Church will be September 2nd at 7:00pm. Pre-registration is required by contacting the rectory at 215-725-1240. The following Pre-Jordan

179 Church of St. Cecilia, Philadelphia, PA (i) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

FOX CHASE WINDOWS & DOORSSALES - INSTALLATION

Please Call ... 215-725-4211

FREE ESTIMATES

Parish Member

ALL TYPES WIRING & REPAIRS215–329–9456 Parish Member

G.J. ROSSI & SONELECTRICIANS

Now In Our 3rd Generation

PATRICK J. FOY(215) 281-9656

Interior & Exterior PaintingWallpapering & Scraping

FREE Estimates • Reliable • Honest

309 Central Ave., Cheltenham379-0881

JOSEPH P. FARLEYPLUMBING & HEATING

Alterations-Jobbing

Reg. No. 3121P.A. 043294

Classic OpticalDR. AMY C. TAN, O.D. 215-722-2242

*Eye Exams * Contact Lenses * Eyeglasses6516 R S A . (G R S )

Sweeney’sVerree Tavern

KITCHEN OPEN FROM 11 AM TO MIDNIGHT

The all new Kim’s Crab CakesPhilly’s Largest Wings

All Soups & Chili HomemadeTAKE OUT AVAILABLE

All Major Sporting Events With 6 Colored TV’s

Finest Tavern Food Now Available in our

New Private Dining Room

7968 VERREE RD.215–725-3366

Mariann OwensOffi ce: (215) 698-2000Direct: (215) 698-2027Cell: (215) 280-7222Email: [email protected] Buyers and Sellersin Philadelphia, Bucks, and Montgomery CountiesEach Offi ce Independently Owned and Operated

2000

SENIOR CITIZEN DISCOUNTS

ReliableFull Service Plumber

PLUMBING, HEATING & DRAIN CLEANING EMERGENCY SERVICE

INSURED • FREE ESTIMATES215-722-6783215-379-8300

SERVING ENTIRE CITY & SUBURBS

CITY VIOLATIONS CORRECTED

SEWER LINES REPLACED • HOT WATER HEATERSFROZEN PIPES • WATER PRESSURE INCREASED

DIGGING & EXCAVATION SPECIALISTS

Reg. Master Plumber #4287Michael Zalewski

Experience Peace of Mind:Pre-Arrange Your Burial at an

Archdiocese of Philadelphia Cemetery.

• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries

CALL 215-352-4001 TODAY

Leslie AitaVocalist

[email protected]

Parishioner

Visit Us At Our New Location

Rockledge Plaza Huntingdon Pike

408 Huntingdon PikeRockledge, PA 19046215-379-2100

Family Ownedand Operated

Since 1948

$350Off Any New Stairlift With This Ad

• FREE in home evaluations• Family owned & operated for more than 20 years

1.888.900.8883

www.Tri-StateStairlifts.com

Traditional Funerals, Church Funerals & Memorial Services, Cremations“ONE FAMILY HELPING ANOTHER”

7450 Oxford Ave Phila, PA 19111 215-728-1050

David G RichardsonSupervisor/Owner

Cher l A Webb-RichardsonManager & LCBA Insurance Rep

Parishioner

richardsonsfuneralhome.com Councilman Brian O’Neill

Northeast offi ces near St. Cecilia ParishionersFox Chase - 432 Rhawn Street • 215-685-6431 • Rhawnhurst - 7522 Castor Ave • 215-685-0438

[email protected]

FreeNotaryPublic

Free copies

& Faxes

Karon MassadoReal Estate Salesperson

o 267.435.8015 m [email protected]

1601 Market St.- Fl. 19, Phila, PA

Wackerman Funeral Home, Inc.Wackerman Funeral Home, Inc.8060 Verree Rd. Philadelphia, PA 19111

www.wackermanfuneralhome.com 215-342-5200 Elizabeth Wackerman Bailey, Supervisor 1944 – Austin C. Wackerman - 2017 Emily Wackerman Funeral Director

Free & Confi dential Pregnancy Services24 Hour Hotline: 1-800-550-4900

www.BirthRight.org

“It is the right of every pregnant woman to give birth, and the right of every child to be born.”

~Birthright Charter7986 Oxford Avenue

Philadelphia, PA 19111215-728-0385

A Blessing from God

John DeCristofaroROOFING

Specializing in: Hot Asphalt RoofsShingle Roofs • Gutters • Spouts

215-379-2953 Member of St. Cecilia

A Tompkins Community BankFormerly Madison Bank

8000 Verree Rd., Philadelphia(215) 722-4566

www.risingsunhomecare.org

Providing The Highest Quality Care

Parishioner of St. Cecilia

215-605-9555

catering For your next event, call ahead to order

- Pickup or Delivery -WHITMAN SQUARE 215-969-3455 x1

Eric McHughParishioner

CYO Volunteer OFFERING AUTO, HOME, LIFE,

& BUSINESS INSURANCE Call for a quote

215-328-9990 x7001 or email [email protected]

210 Huntingdon Pike, Rockledge

Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting. This describes the power of...

ve, supuuuu portive, refefefefefefefferrals, relationshipppps,,,, affordable, repeeee etitious, versatile, last

Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN! Call 1.800.333.3166!

What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle

to make sure it is the car they are supposed to enter.

In Remembrance of Samantha Josephson

#WHATSMYNAME

Patronize the Adve isers who make this bulletin possible!

BUILD YOUR COMMUNITY!

Patt o i e the A

SHOP LOCAL

To advertise your business in this weekly bulletin,contact us at 1.800.333.3166

or visit us at www.jppc.net

Page 8: Saint Cecilia ChurchAug 23, 2020  · Saint Cecilia Church will be September 2nd at 7:00pm. Pre-registration is required by contacting the rectory at 215-725-1240. The following Pre-Jordan

179 - Church of St. Cecilia, Philadelphia, PA (b) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

Schmidt’s Florist 700 Solly Ave., Phila., PA 19111

www.schmidtsfl orist.com 215-745-6234

LAW OFFICES

PAUL A. COGHLAN437 RHAWN STREET

PHILADELPHIA, PA 19111(215) 725-5998

FAX (215) 725-3904

Robert Wetzel, F.D.419 Huntingdon Pike, Rockledge

Erich Wetzel, Supv.Willow Grove - Bill Herchenroder, Supv. INC.

Funeral Directors Since 1881 215-663-8550 • www.wetzelandson.com

Stewart and McGowanATTORNEYS-AT-LAW

6221 RISING SUN AVE. (Opposite St. William’s Church)338-2800

S W D ’ E

WE DELIVER~ Traditional Pizza~ White Pizza~ Tomato Pies

The Original

Pizza6500 Rising Sun Ave. • 215-745-9992

Nora McCloskeyParishioner

Fine Art ClassesWorkshops & Partiesfor Children & Adults215-301-0103

www.bloomingartiststudio.comwww.bloomingartiststudio.com

PLUMBING, HEATING, DRAIN CLEANING & AIR CONDITIONING

SENIOR CITIZEN DISCOUNTFREE ESTIMATES

Ph: (215) 728-1482Fax: (215) 742-7098

8675 Torresdale Ave.Philadelphia, PA 19136

WWW.BILLFRUSCO.COM

O’Donnell PaintingInterior and Exterior

House Painting & Drywall RepairNeat Clean Work • No Job Too SmallFree Estimates 215-677-5854

THOMAS A. CUNNINGHAM, ESQ.Attorney At Law

AUTO ACCIDENT — PERSONAL INJURYWILLS — DIVORCE — REAL ESTATE

109 Huntingdon Pike • Rockledge, PA 19046215-722-6230

JOHN F. GIVNISH(3rd Generation)

JOHN F.X. GIVNISH, III(4th Generation)

Serving the Archdioceseof Philadelphia with

grace and dignity since 1928

1-800-GIVNISH

Each Offi ce Independently Owned and Operated

Larry AitaREALTOR®

Seniors Real Estate SpecialistOutstanding Agents. Outstanding Results.

Regency Realty

Cell: (215) 478-4344Offi ce: (215) [email protected]’s Get Moving!

2018 Outstanding

Agentof the Year

s.

ParishionerServing Families Since 1900

Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick, F.D. 1924-2013

Th omas M. McGoldrick, F.D. SupervisorJames T. Meyers, F.D. • Timothy J. Meyers, F.D.

215-884-0800 507 West Avenue, Jenkintown, PA 19046 www.mcgoldrickfh .com

Mallory’s Army FoundationUnited Together In The Fight Against Bullying...

Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com

(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send your email address by text message:

Text MALLORYSARMY to 22828 to get started.Message and data rates may apply.

Advertise Your Business Here800-333-3166

ext. 161www.jppc.net

JIM CASEYWallcoveringPainting • ScrapingClean Work • Since 1986215-379-0558 Member of Parish

Professionals Serving Professionals

Jay B. ComlyBuilding & Offi ce Maintenance

[email protected]

w/an A+ Rating

Commercial • AutomotiveResidential • Safes

Fully Equipped RadioDispatched Mobile Trucks

7936 Oxford Ave. 215-745-5007

Full Service Locksmith Since 1978Member of Parish

VERREEPHARMACY

7960 VERREE RD.(AT RHAWN)Free Delivery

M-F 9AM - 8PMSat. 9AM - 6PM

Sun. 9AM - 1 PM215-342-0100

Mitchell Spivack, R. PH.

HandymanElectric, PlumbingOdd jobs... Just Ask!

From McCloy’s TV 267-231-8785

Tax & AccountingFrancis J. McConnell CPA

Tax Preparation • Individual & Business(Across from St. Williams)

Call (215) 742-3428 for Appointments

Charles P. Elliott, PC 110 Central Ave

Cheltenham, PA 19012

215-663-2500We Make House Calls

Complimentary InitialConsultation

We are here for all your tax, IRS, fraud investigations,

& inheritance tax.

RENEE ROACHEREALTOR ~ PARISHIONER

FOX CHASE SPECIALISTBuying or Selling a Home?

Call Today!

Office 215-961-6000 Cell [email protected]

EASTERNEEEAEAAEAEEEEEEEEEEEEEEEEAEASTSTTTSTTTSSTTTTTTTTTEEREEEEEEEEEEEEEEAEAEAEEEEEEEEASTSTTTSTTSSTTTEEEREEEE

A Signature Hair Salon llc$10 OFF Color ServiceMen | Women | Children

7950 Bustleton Ave., Philadelphia, PA215-821-3522

Cochrane Construction LLC

ROOFINGSIDING * GUTTERS

Chimney Restorations & RepairsLicensed & Insured PA # 154589

Senior Citizen Discounts • Free Est.215-839-4317

www.cochraneconstruction.org

Friends, Family, Neighbors!

1-844-640-4200 PaulsRun.org/Living

Wedding Invitations Wedding Invitations & Holiday Cards& Holiday CardsLog onto Log onto www.jppc.netwww.jppc.netconveniently from yourconveniently from yourhome or offi ce.home or offi ce.Online CatalogOnline CatalogOnline OrderingOnline OrderingOnline ProofingOnline ProofingAll Major Credit All Major Credit Cards AcceptedCards Accepted

FREE UPS FREE UPS GROUND GROUND SHIPPINGSHIPPING!

WE CARE AND IT SHOWS

Beautiful On-Site Chapel with Daily Mass - Respite Stay Available

We Acknowledge We Appreciate

2990 Holme Ave., Phila.215-335-2100

www.imrehab.org

IMMACULATE MARYCENTER

Rehabilitation & Healthcare

Advertise Your Business Here

800-333-3166 ext. 161www.jppc.net