rnai mediated curcin precursor gene silencing in jatropha (jatropha curcas l.)
TRANSCRIPT
RNAi Mediated curcin precursor gene silencing in Jatropha(Jatropha curcas L.)
Vikas Yadav Patade • Deepti Khatri • Kamal Kumar •
Atul Grover • Maya Kumari • Sanjay Mohan Gupta •
Devender Kumar • Mohammed Nasim
Received: 25 June 2013 / Accepted: 14 February 2014
� Springer Science+Business Media Dordrecht 2014
Abstract Curcin, a type I ribosomal inhibiting protein-
RIP, encoded by curcin precursor gene, is a phytotoxin
present in Jatropha (Jatropha curcas L.). Here, we report
designing of RNAi construct for the curcin precursor gene
and further its genetic transformation of Jatropha to reduce
its transcript expression. Curcin precursor gene was first
cloned from Jatropha strain DARL-2 and part of the gene
sequence was cloned in sense and antisense orientation
separated by an intron sequence in plant expression binary
vector pRI101 AN. The construction of the RNAi vector
was confirmed by double digestion and nucleotide
sequencing. The vector was then mobilized into Agrobac-
terium tumefaciens strain GV 3101 and used for tissue
culture independent in planta transformation protocol
optimized for Jatropha. Germinating seeds were injured
with a needle before infection with Agrobacterium and
then transferred to sterilized sand medium. The seedlings
were grown for 90 days and genomic DNA was isolated
from leaves for transgenic confirmation based on real time
PCR with NPT II specific dual labeled probe. Result of the
transgenic confirmation analysis revealed presence of the
gene silencing construct in ten out of 30 tested seedlings.
Further, quantitative transcript expression analysis of the
curcin precursor gene revealed reduction in the transcript
abundance by more than 98 % to undetectable level. The
transgenic plants are being grown in containment for
further studies on reduction in curcin protein content in
Jatropha seeds.
Keywords Physic nut � in planta � Genetic
transformation � Curcin
Introduction
Jatropha (Jatropha curcas L.), also known as physic nut, is
an important non-edible tropical and subtropical oilseed
deciduous plant with great potential as a petro crop. The
plant belongs to euphorbiaceae family and is indigenous
to Mexico and Central America. Multiple including
medicinal uses of the plant as a whole are reported [1]. The
plant has attracted attention as a potential biofuel crop
owing to its hardiness, easy propagation, drought endur-
ance, high oil content, and suitability of seed oil for biofuel
conversion [2, 3]. Better performance of Jatropha biodiesel
compared with petro-diesel has been demonstrated [4].
Therefore, large-scale cultivation of Jatropha is promoted
for biodiesel production. At present, the varieties being
used to establish plantations outside Central American
region are toxic preventing use of the Jatropha seed meals
as animal feed or as a fertilizer. Besides, the extensive
prolonged exposure to crushed seeds or oil increases the
risk among the growers, processors and consumers [4]. The
toxicity of the whole seed of Jatropha has been attributed to
a protein component, designated as ‘‘curcin’’, a type I
ribosome inhibiting protein-RIP [5]. Curcin is a phytotoxin
found mainly in the seeds of Jatropha, however, its induced
expression has been reported in leaves on exposure to
biotic and abiotic stress factors [6, 7].
A range of methods like extraction with polar organic
solvent and/or heat/NaHCO3 treatment have been proposed
Electronic supplementary material The online version of thisarticle (doi:10.1007/s11033-014-3301-8) contains supplementarymaterial, which is available to authorized users.
V. Y. Patade (&) � D. Khatri � K. Kumar � A. Grover �M. Kumari � S. M. Gupta � D. Kumar � M. Nasim
Defence Institute of Bio-Energy Research, Haldwani-263 139,
Nainital, Uttarakhand, India
e-mail: [email protected]
123
Mol Biol Rep
DOI 10.1007/s11033-014-3301-8
to detoxify the defatted seed meal, however economically
feasible method for large-scale detoxification is yet to
develop [4, 8]. Thus, adoption of varieties lacking curcin
and other toxins will improve economic feasibility of
Jatropha cultivation as well as eliminate any potential risk
associated with prolonged exposure. However, the genetic
improvement through conventional breeding may be
hampered due to limited genetic diversity in Jatropha
germplasm. Non-toxic/edible Mexican Jatropha is known
to lack phorbol esters, but its curcin content is not lesser
than the other toxic genotypes [9]. Therefore, great scope
exists for genetic improvement of the Jatropha with
reduced curcin content through biotechnological interven-
tions. Genetic engineering approach of RNA mediated
gene silencing [10–12] may be employed for reducing the
toxic protein content in the seed meal. Agrobacterium
tumefaciens mediated genetic transformation of plants has
become a method of choice for transgenic development
owing to its advantages such as lower copy stable genomic
integration of transgene and fewer DNA rearrangements
leading to its stable inheritable expression as compared to
direct DNA delivery methods [13–15]. An efficient genetic
transformation is an important pre-requisite for transgenic
development. Though, in vitro regeneration from various
explants have been reported in Jatropha [16–19], applica-
tion of these regeneration systems in tissue culture
dependent genetic transformation have been restricted due
to lower transformation efficiency and several handling
steps. Further, more time is required for transgenic devel-
opment which is another serious concern in the perennial
plant. As against, tissue culture independent in planta
Agrobacterium mediated genetic transformation method is
easy to perform, fast and having higher transformation
efficiency [20]. Feasibility of in planta genetic transfor-
mation is reported in other crops [21], but such reports are
missing in Jatropha. We report herewith the designing of
RNAi construct for curcin precursor gene and optimization
of in planta Agrobacterium mediated genetic transforma-
tion to develop Jatropha with low curcin transcript
expression.
Materials and methods
Seed material
Seeds of Jatropha strain DARL-2 were cleaned by washing
with tap water for multiple times, and soaked overnight in a
solution (0.1 %, w/v) of carbendazim based broad spec-
trum systemic fungicide. Seeds were then allowed to dry in
shed for 24 h. The dried seeds were then germinated on
filter paper placed in glass plates for 4 days at room
temperature.
Cloning curcin precursor gene
Genomic DNA was isolated from young leaves using plant
genomic DNA isolation kit (BioServe-India, India). Prim-
ers were designed based on the sequence information [6]
available in NCBI GenBank (http://ncbi.nlm.nih.gov/gen
bank). The PCR master mix and thermal cycling were
optimized to amplify the curcin precusor gene. The puri-
fied PCR product was cloned in pGEMT cloning vector
and sequenced commercially (Eurofins, India). The
sequence was analyzed for homology using Blast program
[22]. The gene structure was predicted using FGENESH
2.6 tool (http://linux1.softberry.com/berry.phtml). The
Motif scanning of the predicted amino acid sequence was
performed using MyHits program [23].
Design of RNAi construct
Part of the curcin precursor gene sequence (334 bp at
position 601–934) was cloned in sense and antisense ori-
entation separated by 192 bp intronic sequence (X04753)
under the regulation of constitutive promoter CaMV 35S in
plant expression binary vector pRI101 AN (Takara Bio,
Inc.). The silencing construct (pRI101 AN–CurSil-1)
preparation was confirmed by double digestion with
restriction enzymes (Eco RI/Sac I) as well as by
sequencing.
Establishment of in planta genetic transformation
The germinating seeds (5 days after sowing) were used for
in planta genetic transformation studies. Seed coats were
removed and the seeds were washed with tap water. Further
steps were carried out in laminar air flow. The seeds were
first washed with sterilized distilled water and blot dried on
autoclave sterilized tissue paper. The embryonic axes of
the germinating seeds were exposed with a sterilized blade
for infection.
Agrobacterium tumefaciens strain GV 3101 harboring
plant expression vector pRI101 AN carrying selectable
marker gene NPT II was used for standardization of the
genetic transformation experiment. The single isolated
colony was inoculated in yeast extract mannitol-YEM
(MgSO4�7H2O, 0.2 g/L; yeast extract, 1.0 g/L; mannitol
10.0 g/L; NaCl 0.1 g/L; K2HPO4, 0.5 g/L; pH adjusted to
7.0) broth medium with appropriate Kanamycin (50 mg/L)
and Rifampicin (25 mg/L) selection. The cultures were
incubated at 28 �C at 200 rpm for 24 h. The growth of the
culture was estimated based on spectrophotometric
absorption at 600 nm. The cells were precipitated by cen-
trifugation at 22 �C for 3 min at 8,0009g. The cells were
washed with Acetosyringone solution (100 lM) by cen-
trifugation at 8,0009g at 22 �C for 3 min to remove traces
Mol Biol Rep
123
of the antibiotics. The washed cells were re-suspended in
the Acetosyringone solution to adjust final optical density
of 1.0–2.0.
The prepared seeds were then injured and infected with
needle (21 G X 1.5) dipped in the Agrobacterium suspen-
sion. The infected seeds were incubated with the Agro-
bacterium suspension in flask at 28 �C for up to 60 min in
an incubator shaker at 100 rpm (Table 1). Another set of
the seeds after infection was subjected to vacuum
(80 K Pa) treatment. The seeds were placed in an ultrafil-
tration assembly with the Agrobacterium suspension and
vacuum was applied for up to 20 min. The seeds were then
blot dried and transferred to sterilized sand medium satu-
rated with water in pots. The grown seedlings were given
Hoagland medium and grown in a contained laboratory for
90 days. Transformation experiment was repeated to con-
firm the reproducibility of the results. Upon standardiza-
tion, the same set of protocol and bacterial strain was used
for genetic transformation with silencing vector.
Transgenic validation
Genomic DNA was isolated from the young leaves using
plant genomic DNA isolation kit (BioServe–India, India).
The genomic DNA was quantified based on spectropho-
tometric absorbance at 260/280 nm. The isolated genomic
DNA (50 ng/reaction) was used in transgenic confirmation
using an indirect assay of real-time detection of NPT II
gene. In brief, real time PCR reaction (50 lL) was set up
with the master mix components including molecular
biology grade water, 109 PCR buffer, dNTP mix
(10 mM), primers (10 lM) and dual labeled probe (3 lM)
specific to NPT II gene sequence, and Taq DNA poly-
merase (0.2 U). At the end, genomic DNA was added to
the master mix. Two step PCR reaction was performed in
real time PCR (Mx3005P; Stratagene, Germany) with ini-
tial denaturation for 5 min, followed by 28 cycles of
denaturation at 95 �C for 30 s and primer annealing/
extension at 60 �C for 30 s. Fluorescence specific to the
reporter dye was collected at the end of annealing/exten-
sion step of each cycle. The threshold fluorescence was set
by the instrument and the obtained Ct values were recor-
ded. Further, to avoid false negative results in the putative
transgenic samples, the isolated samples were amplified
with primers specific to internal control gene, b Actin. The
transgenic confirmation reactions were performed in trip-
licate and the experiment was repeated twice to check the
reproducibility of the results.
Validation of gene silencing by qRT PCR analysis
All the glassware and plastic ware used in RNA isolation
were made RNase free by treating with 0.1 % (v/v) diethyl
pyrocarbonate (DEPC; SIGMA Chemicals, USA) for 16 h
followed by autoclaving for 1 h and oven drying at 80 �C
for 48 h. The leaves were mechanically wounded before
the RNA isolation from five independent confirmed (as
above) transformed and wild type seedlings using TRIzol
reagent (SIGMA Chemicals, USA) as described earlier
[24]. The quality and quantity of the isolated total RNA
was assessed based on O.D. at 260/280 nm. First strand
cDNA was synthesized from the isolated RNA (1.0 lg)
using QuantiTect� Reverse Transcription Kit (Qiagen,
USA) in the reaction volume of 20 lL at 42 �C for 30 min
in a thermal cycler (Bio-Rad S1000, Singapore).
Primers specific to b Actin (as an internal control) and
curcin precursor gene were designed (Table 2) using Pri-
mer3 software [25]. The reaction mixture was prepared
using QuantiFastTM SYBR�Green PCR master mix con-
taining pre-optimized ROX as passive reference dye (Qia-
gen, USA), gene specific primers (10 lM), cDNA as a
template and nuclease free molecular biology grade water.
Thermal cycling program consisted initial denaturation
(95 �C, 10 min), followed by 30 cycles of denaturation
(95 �C, 30 s), primer annealing (55 �C, 30 s) and primer
extension (72 �C, 20 s). The qRT PCR reactions were
carried out in a real time thermal cycler-Mx3005P (Strata-
gene, Germany). Fold expression of the target genes was
quantified based on CT values using DDCT method [26].
The qRT PCR products were further separated on aga-
rose gel (2 %) and the fluorescence emitted was detected
using a multipurpose phosphor-imager (Typhoon 9410, GE
Table 1 Summary of the in
planta genetic transformationSr.
no.
Transformation
experiments
O.D.
600 nm
Infection time
(min)
Vacuum
(min)
Survival
(%)
Positive plants
(%)
1 I 2.0 30 10 Nil NA
2 II 2.0 60 20 Nil NA
3 III 2.0 30 – Nil NA
4 IV 1.0 40 10 Nil NA
5 V 1.0 40 – Nil NA
6 VI 1.0 20 – 70 12
7 VII 1.0 20 10 50 15
Mol Biol Rep
123
Healthcare, USA) with emission filter: 610 BP30 (Deep
Purple, SYPRO, Ruby, EtBR) at 488 nm, with focal plane
adjusted ?3 mm above the surface. The captured 1D gel
images were further analyzed using ImageQuantTM TL
software (GE Healthcare, USA).
Results
Establishment of in planta transformation
and confirmation
Infection with Agrobacterium to germinating seeds was
carried out at 5 days after sowing. Seeds infected at an
earlier stage resulted in complete mortality whereas,
infection at later stages resulted in failure in genetic
transformation. The seeds were then transferred to the
sterilized sand medium in the contained laboratory and
were allowed to grow for 90 days. Transgenic confirma-
tion was carried out with real time PCR analysis using
NPT II gene specific primers with genomic DNA as a
template from the putative transgenic seedlings, subjected
to in planta transformation. Ct values were obtained only
in positive samples (Fig. 1). Possibilities of false positives
were eliminated as no Ct was obtained in case of negative
(no template controls) and wild type seedlings. Further,
the genomic DNA samples were PCR amplified with
primers specific to b Actin as an internal control. The
results revealed amplification in all the test samples, thus,
eliminating the possibility of false negatives. Ct was
obtained in positive reaction with pRI101 AN plasmid
DNA as a template. Higher bacterial cell density used for
transformation (as measured by O.D. at 600 nm of 2.0) or
longer infection (30 min or higher) resulted in zero sur-
vival of the seedlings. The O.D. of 1.0 and infection time
of 20 min resulted in higher survival (70 %) as well as
successful transformation in 12 % of the transformed
seedlings. Infection of the germinating seeds without
Acetosyringone treatment resulted in lower transformation
efficiency. Application of vacuum for 10 min after the
infection slightly reduced the survival (by 20 %), however
improved the rate of success of transformation (Table 1).
The transgenic confirmation was repeated twice, with the
same results. The transgenic plants are being grown in
containment for analysis of stability of gene integration
and expression in subsequent generations.
Cloning and sequence analysis of curcin precursor
gene
Curcin precursor gene was amplified and cloned in pGEM-
T vector. The gene sequence was determined by DNA
sequencing, followed by sequence analysis using BLASTn
at NCBI server. The processed sequence (1,075 bp),
bearing variations from previously known sequences, was
submitted to NCBI GenBank database (Accession No.
JF357910). Gene structure prediction using FGENESH 2.6
tool indicated an exon in the plus chain (score 30.280566).
Coding sequence and ORF (11–940) with a length of
930 bp was predicted (score 36.15) along with poly A
starting at 973 bp (score 1.06).
Motif scanning of the predicted amino acid sequence
(FGENESH tool) using MyHits program [23] indicated
confirmed status of the Shiga/ricin ribosomal inactivating
toxins active site signature (204–220) as well as ribosome
inactivating protein motif (48–293 aa; N-score = 66.096;
E-value = 1.7e-59).
Construction of RNAi vector and genetic
transformation
A 334 bp long gene fragment was cloned in sense and
antisense orientation separated by intron sequence (192 bp)
in plant expression binary vector pRI101 AN to produce
double stranded RNA as a trigger for the sequence specific
silencing, upon genomic integration and expression of the
cassette (Fig. 2). Construction of the vector confirmed by
double digestion with restriction enzymes (Eco R1 and Sac
1), produced digestion product of expected size (860 bp).
Further, sequencing also confirmed the cloning of correct
gene sequence in sense and antisense orientation with
intron. The minimum free energy secondary structure
prediction of the cloned sequence with RNAfold program
suggested formation of the hairpin RNA with loop [27].
The binary silencing vector was then transferred to chem-
ically competent Agrobacterium tumefaciens strain GV
3101 cells by heat shock method and the recombinant
Table 2 Primers designed for
quantitative transcript
expression analysis using
Primer3 tool
Sr. no. Primer Length (50–30) Tm (oC) Amplicon (bp)
1 Curcin F TTCCAGAGGCAGCAAGATTC 60 111
2 Curcin R GGTCTCCCCAGTTGTTCTCA 60
3 Actin F CAGAGGAACACCCAGTGCTT 60 148
4 Actin R CGACCACTGGCATACAAAGA 60
Mol Biol Rep
123
colonies appeared on Kanamycin selection medium were
confirmed by real-time PCR with primers and fluorescent
dual labeled probe specific to the marker gene NPT II.
Germinating seeds after in planta genetic transforma-
tion, carried out as described above, were grown in labo-
ratory and transgenic confirmation carried out using real
time PCR with the primers specific to NPT II. Genomic
DNA isolated from ten out 30 tested seedlings produced Ct
(Fig. 3) confirming transgenic nature of the seedlings for
the construct. However, Cts were not obtained in negative
control or wild type sample.
Transcript expression of curcin precursor gene
Under non-stress condition, the transcript expression of the
curcin precursor gene was not detected in the leaves of the
wild type or the lines transformed with the silencing con-
struct (Data not shown). However, the transcript expression
was increased on mechanical wounding of the leaves in the
wild types. In one transgenic line, Ct was not obtained in
qRT PCR with the curcin precursor gene, indicating
reduction in transcript expression below the detectable
level (Fig. 4). In other four transgenic lines tested, lower
Transgenic
Wild types, NTC, non-transgenic
Fig. 1 Amplification plot depicting transgenic confirmation in plants
transformed with binary vector pRI101 AN. Genomic DNA isolated
from leaves of the putative transgenic and wild types was used as a
template in quantitative PCR for transgenic confirmation with NPT II
gene specific primers. Cts were obtained in five of the tested (34)
samples but not in the rest of the putative transgenic plants or the wild
types
Sense Intron Anti-sense
pRI101-AN-CurSil-1
(11,277 bp)
Fig. 2 Custom designed RNAi construct (pRI101 AN–CurSil-1). Sequence of the custom designed precursor silencing fragment (860 nt) cloned
in the binary vector (pRI101 AN). Sequence (334 nt) in sense and antisense orientation is separated by intronic sequence (192 nt)
Mol Biol Rep
123
levels of transcripts of curcin precursor gene were detected
as indicated by higher Ct values than the wild type. The
transcripts of the normalizer gene (b Actin) were detected
in all the cDNA samples. The normalized quantitative
transcript expression analysis also indicated reduced tran-
script abundance in these lines by more than 98 % as that
of the wild type (Fig. 4). Further, the qRT PCR products
were separated on agarose gel without ethidium bromide
and SYBR specific fluorescence was detected with multi-
purpose phosphor-imager (Fig. 5). Fluorescence was
detected for all the cDNA samples in the normalizer
reactions but not in no template control. Whereas, fluo-
rescence was detected only with wild type cDNA in reac-
tion with curcin precursor gene, but not in cDNAs from the
five transgenic samples or no template control. Thus, the
results confirmed the qRT PCR data on considerable
reduction in transcript expression of the curcin precursor
gene. Thus, the results confirmed the development of
transgenic Jatropha with considerably reduced transcript
expression of the curcin precursor gene through RNAi
technology. Morphologically transgenic plants were simi-
lar to that of wild types up to seedling stage. Further, the
transgenic plants with low curcin precursor gene transcript
expression are being grown for analysis on curcin content
in seeds and other plant parts.
Discussion
Jatropha curcas, is a potential source of biodiesel, espe-
cially in third world countries. Jatropha cake, which con-
stitutes up to 70 % by weight of the oil extracted seed, is a
protein-rich by-product, and a potential source of livestock
feed. However, higher levels of curcin along with phorbol
esters impart toxic nature to Jatropha cake [8]. Besides, the
composition analysis also revealed presence of other toxic/
antimetabolic constituents including trypsin inhibitors,
Transgenic
Wild types, NTC, non-transgenic
Fig. 3 Amplification plot
depicting transgenic
confirmation of the plants
transformed with RNAi vector
for curcin silencing. Genomic
DNA isolated from leaves of the
putative transgenic and wild
types was used as a template in
real time PCR for transgenic
confirmation with NPT II gene
specific primers. Cts were
obtained in ten of the tested (30)
samples but not in the rest of the
putative transgenic plants, NTC
or the wild types
-0.200
0.000
0.200
0.400
0.600
0.800
1.000
1.200
WT 93A 88A 71 93 100Fo
ld E
xpre
ssio
n O
ver
WT
Transgenic Lines
Fig. 4 Quantitative transcript expression analysis of curcin precursor
gene in leaves. The transcript expression was normalized with
expression of house keeping gene b Actin. Fold transcript expression
in five transgenic lines over the wild type (WT) is represented in
graph
Fig. 5 Gel images showing transcript abundance of curcin precurosr
gene in leaves of WT and transgenic Jatropha lines. Fluorescence of
SYBR Green 1 dye bind with real time PCR products was
documented in multi-purpose phosphor-imager (Typhoon Scanner,
Model Typhoon TRIO?, GE HealthCare, USA) with 610 BP30
emission filter and blue laser. PCR products obtained for the internal
control (b Actin) were also visualized for data normalization
Mol Biol Rep
123
phytates, saponins and lectins in the Jatropha seed meals.
Though, the seeds of non-toxic edible Jatropha genotypes
from Mexico have considerably low phorbol esters, con-
tents of curcin and other antimetabolic constituents are
similar to that of toxic genotypes [8, 28]. Currently, acid
and alkali treatments are used to reduce the toxicity of
Jatropha cake [29] however, no treatment has been suc-
cessful in completely eliminating the antimetabolic factors
and toxic principles of defatted Jatropha kernel meal of
non-toxic and toxic varieties. Biotechnological interven-
tions, like RNAi mediated gene silencing coupled with
genetic transformation techniques may be utilized to
develop the curcin deficient transgenic Jatropha lines.
Though, tissue culture in vitro regeneration from various
explants have been reported in Jatropha [16–19], its appli-
cation to establish efficient and reproducible genetic trans-
formation method for genetic engineering towards the
improvement in desired traits have failed. Tissue culture
dependent genetic transformation methods with marker
genes have been reported in Jatropha with transformation
efficiency up to 13 %, however the methods are laborious,
time consuming and genotype specific [19]. Therefore, a
number of tissue-culture independent techniques have thus
been developed in other plants, wherein the transformation
of plant cells is carried out in planta. Such methods, though
produce chimeric individuals up on transformation, in the
next generation stably transformed lines can be easily
selected based on the activity of the selectable marker gene
with successful transformation rate often higher than 1 %
[21]. In the present study, we have achieved up to 15 %
transformation efficiency in T0 generation. Selection will be
applied in the next generation to isolate stably transformed
lines. Thus, the need for tissue culture plant regeneration has
been successfully avoided. The established in planta trans-
formation protocol is simpler, rapid and less resource
intensive than the reported tissue culture dependent proto-
cols [30]. To the best of our knowledge, this is the first report
on standardization of in planta transformation in Jatropha.
Interestingly, optimal bacterial load for transformation was
found at culture O.D. of 1.0. Higher bacterial load resulted in
complete mortality of the germinating seeds, while lower
cell density resulted in poor transformation efficiency. Fur-
ther, addition of Acetosyringone to the Agrobacterium sus-
pension resulted in higher transformation efficiency.
Curcin being ribosomal inhibiting protein (RIP; molec-
ular weight 28.2 kDa) is essentially a vital component of
plant’s defence system, improving its chances of survival
under stress and unfavourable conditions [31]. Molecular
evidences indicate length polymorphism of curcin ORF
isolated from different accessions. While, finally processed
protein has a length of 251 amino acid residues, nascent
polypeptide was found spanning lengths between 293 and
309 amino acids [6, 7]. In the line of previous studies [6],
the curcin gene, in this study was found intronless, based
on computational predictions.
As curcin imparts toxicity to Jatropha seeds, it hinders
use of Jatropha cake as animal feed after extraction of oil.
RNA interference (RNAi) pathway to silence curcin pre-
cursor gene holds huge promise for industrial applications
of Jatropha. RNAi, a post-transcriptional mode of gene
silencing, has been successfully used for reducing toxicity
in a number of plant species including Jatropha [30, 32]. It
holds various benefits over other methods of gene
silencing. It is highly specific, highly potent, systemically
spread across tissues, and significantly down-regulates the
target gene. However, such efforts to knock down the
curcin gene expression in Indian Jatropha genotypes have
not been reported so far. In the present study, we report
more than 98 % reduction in the accumulation of curcin
transcript in the leaf tissues. This has been achieved by
construction of binary silencing vector by cloning part of
curcin precursor gene in sense and antisense orientations,
separated by intron. This vector was used for in planta
Agrobacterium mediated genetic transformation in Jatro-
pha strain DARL-2. Silencing efficacy varies with RNAi
construct types. Efficient silencing in a wide range of
plant species has been reported using hpRNA (hairpin
RNA) constructs containing sense/anti-sense arms ranging
from 98 to 853 nt [33]. Further, inclusion of an intron in
these constructs (ihpRNA) had a consistently enhancing
silencing effect [33]. Use of ihpRNA type of RNAi con-
struct containing sense/antisense arm of 334 nt length with
intron could be the reason for efficient curcin precursor
gene silencing in the present study. At the molecular level,
target gene silencing is brought about by systematic
degradation of specific mRNA by small interfering
(20–25 nt.) double stranded RNA (siRNA/dsRNA). RNA
mediated silencing also involves various cellular mecha-
nisms apparently triggered by double stranded RNA
(dsRNA) that results in suppression of target gene
expression [10].
As involvement of curcin in plant defence has been
established [31], constitutive silencing of the gene may
render Jatropha plants susceptible to the stresses. There-
fore, we are further focusing on achieving seed specific
silencing of the curcin precursor gene through the tissue
specific instead of constitutive promoter. In Jatropha it
takes minimum 3 years to flower and fruit. Hence, con-
stitutive gene silencing was followed in the present work
for early analysis of reduced transcript expression of the
gene in the leaf tissues. Otherwise, with seed specific
silencing construct, the analysis could be delayed up to
seed development. Thus, the curcin precursor gene
silencing in Jatropha may further enhance its economic
value and development of a strategic resource for bio-
diesel and various by-products.
Mol Biol Rep
123
Acknowledgments Research fellowship from DRDO to Deepti
Khatri and Kamal Kumar is gratefully acknowledged.
References
1. Openshaw K (2000) A review of Jatropha curcas: an oil plant
unfulfilled promise. Biomass Bioenergy 19:1–15
2. Nambisan P (2007) Biotechnological interventions in Jatropha for
biodiesel production. Curr Sci 93:1347–1348
3. Kywe TT, Oo MM (2009) Production of biodiesel from Jatropha
oil (Jatropha curcas) in pilot plant. World Academy Sci Eng
Technol 50:477–483
4. King AJ, He W, Cuevas JA, Freudenberger M, Ramiaramanana
D, Graham IA (2009) Potential of Jatropha curcas as a source of
renewable oil and animal feed. J Exp Bot 60:2897–2905
5. Barbieri L, BattelliM Stirpe F (1993) Ribosome-inactivating
protein from plants. Biochim Biophy Acta 1154:237–282
6. Lin J, Chen Y, Xu Y, Yan F, Tang L, Chen F (2003) Cloning and
expression of curcin, a ribosome-inactivating protein from the
seeds of Jatropha curcas. Acta Bot Sin 45:858–863
7. Qin W, Huang M-X, Ying X, Zhang X-S, Fang C (2005)
Expression of a ribosome inactivating protein (curcin 2) in
Jatropha curcas is induced by stress. J Biosci 30:351–357
8. Martı0nez-Herrera J, Siddhuraju P, Francis G, Davila-Ortiz G,
Becker K (2006) Chemical composition, toxic/antimetabolic
constituents, and effects of different treatments on their levels, in
four provenances of Jatropha curcas L. from Mexico. Food
Chem 96:80–89
9. He W, King AJ, Khan MA, Cuevas JA, Ramiaramanana D,
Graham IA (2011) Analysis of seed phorbol-ester and curcin
content together with genetic diversity in multiple provenances of
Jatropha curcas L. from Madagascar and Mexico. Plant Physiol
Biochem 49:1183–1190
10. Baulcombe D (2004) RNA silencing in plants. Nature
431:356–363
11. Ye J, Qu J, Bui HTN, Chua NH (2009) Rapid analysis of
Jatropha curcas gene functions by virus-induced gene silencing.
Plant Biotechnol J 7:964–976
12. Zhong CY, Li FW, Hui ZM, Cheng XQ. 2010. Jatropha curcas
curcin genes, tissue-specific promoters and generation of curcin-
deficient transgenic Jatropha plants. WIPO Patent Application
SG2010/000206, 2010
13. Travella S, Ross SM, Harden J, Everett C, Snape JW, Harwood
WA (2005) A comparison of transgenic barley lines produced by
particle bombardment and Agrobacterium mediated techniques.
Plant Cell Rep 23:780–789
14. Deore AC, Johnson ST (2008) High-frequency plant regeneration
from leaf-disc cultures of Jatropha curcas L.: an important bio-
diesel plant. Plant Biotechnol Rep 2:7–11
15. Kumar N, Vijay AKG, Sudheer PDVN, Sarkar T, Reddy MP,
Radhakrishnan T, Kaul T, Reddy MK, Sopori SK (2010) Sta-
ble genetic transformation of Jatropha curcas via Agrobacte-
rium tumefaciens-mediated gene transfer using leaf explants. Ind
Crops Prod 32:41–47
16. Sujatha M, Makkar HPS, Becker K (2005) Shoot bud prolifera-
tion from axillary nodes and leaf sections of non-toxic Jatropha
curcas L. Plant Growth Regul 47:83–90
17. Datta MM, Mukherjee P, Ghosh B, Jha TB (2007) In vitro clonal
propagation of biodiesel plant (Jatropha curcas L.). Curr Sci
93:1438–1442
18. Thepsamran N, Thepsithar C, Thongpukdee A (2008) In vitro
induction of shoots and roots from Jatropha curcas L. explants.
J Horticult Sci Biotechnol 83:106–112
19. Li M, Li H, Jiang H, Pan X, Wu G (2008) Establishment of an
Agrobacteriuim-mediated cotyledon disc transformation method
for Jatropha curcas. Plant Cell Tissue Org Cult 92:173–181
20. Keshamma E, Sreevathsa R, Manoj Kumar A, Reddy KN,
Manjulatha M, Shanmugam NB, Kumar ARV, Udayakumar M
(2012) Agrobacterium-mediated in planta transformation of field
bean (Lablab purpureus L.) and recovery of stable transgenic
plants expressing the cry1AcF gene. Plant Mol Biol Rep
30:67–78
21. Bent AF (2000) Arabidopsis in planta transformation. Uses,
mechanisms, and prospects for transformation of other species.
Plant Physiol 124:1540–1547
22. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990)
Basic local alignment search tool. J Mol Biol 215:403–410
23. Pagni M, Ioannidis V, Cerutti L, Zahn-Zabal M, Jongeneel CV,
Hau J, Martin O, Kuznetsov D, Falquet L (2007) MyHits:
improvements to an interactive resource for analyzing protein
sequences. Nucleic Acids Res 35:W433–W437
24. Patade VY, Bhargava S, Suprasanna P (2012) Transcript
expression profiling of stress responsive genes in response to
short-term salt or PEG stress in sugarcane leaves. Mol Biol Rep
39:3311–3318
25. Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general
users and for biologists programmers. In: Krawetzs S, Misener S
(eds) Bioinformatics methods and protocols: methods in molec-
ular biology. Humana Press, Totowa, pp 365–386
26. Livak KJ, Schmittgen TD (2001) Analysis of relative gene
expression data using a real-time quantitative PCR and the
2-DDCT method. Methods 25:402–408
27. Lorenz R, Bernhart SH, Honer zu Siederdissen C, Tafer H,
Flamm C, Stadler PF, Hofacker IL (2011) ‘‘ViennaRNA package
2.000. Algorithms Mol Biol. doi:10.1186/1748-7188-6-26
28. Makkar HPS, Becker K (1999) Nutritional studies on rats and fish
(carp Cyprinus carpio) fed diets containing unheated and heated
Jatropha curcas meal of a non-toxic provenanace. Plant Foods
Hum Nutr 53:183–192
29. Rakshit KD, Darukeshwara J, Raj KRR, Narasimhamurthy K,
Saibaba P, Bhagya S (2008) Toxicity studies of detoxified
Jatropha meal (Jatropha curcas) in rats. Food Chem Toxicol
46:3621–3625
30. Yin, ZC, Wu, Li Fang, Mao HZ, Qiu CX (2010) Jatropha curcas
curcin genes, tissue-specific promoters and generation of curcin-
deficient transgenic Jatropha plants. WIPO Patent Application
WO/2010/140981, 2010
31. Huang M-X, Hou P, Wei Q, Xu Y, Chen F (2008) A ribosome-
inactivating protein (curcin 2) induced from Jatropha curcas can
reduce viral and fungal infection in transgenic tobacco. Plant
Growth Regul 54:115–123
32. Palle SR, Campbell LM, Pandeya D, Puckhaber L, Tollack LK,
Marcel S, Sundaram S, Stipanovic RD, Wedegaertner TC, Hinze
L, Rathore KS (2013) RNAi-Mediated ultra-low gossypol cot-
tonseed trait: performance of transgenic lines under field condi-
tions. Plant Biotechnol J 11:296–304
33. Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu
Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA, Robinson
SP, Gleave AP, Green AG, Waterhouse PM (2001) Construct
design for efficient, effective and highthroughput gene silencing
in plants. Plant J 27:581–590
Mol Biol Rep
123