Rr

XXa

Ab

a

ARRAA

KRCRV

1

vfa1a>dsd

veti

tC

u

0h

Vaccine 30 (2012) 5067–5072

Contents lists available at SciVerse ScienceDirect

Vaccine

journa l homepage: www.e lsev ier .com/ locate /vacc ine

ecombinant canine distemper virus serves as bivalent live vaccine againstabies and canine distemper

ijun Wanga,1, Na Fengb,1, Jinying Gea, Lei Shuaia, Liyan Penga, Yuwei Gaob, Songtao Yangb,ianzhu Xiab,∗, Zhigao Bua,∗∗

Key Laboratory of Veterinary Public Health of Ministry of Agriculture, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy ofgricultural Sciences, Harbin 150001, ChinaInstitute of Military Veterinary, Academy of Military Medical Sciences, Changchun 130122, China

r t i c l e i n f o

rticle history:eceived 22 March 2012eceived in revised form 26 May 2012ccepted 1 June 2012vailable online 12 June 2012

a b s t r a c t

Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has beenwidely used to protect carnivores from canine distemper. In this study, we generated a recombinantcanine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG)by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to thoseof vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and

eywords:abiesanine distemperecombinant canine distemper virusaccine

dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs ofdisease and developed a strong rabies virus (RABV) neutralizing antibody response, which completelyprotected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccinationwith rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV.This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent livevaccine against rabies and canine distemper in animals.

. Introduction

Rabies is a widespread zoonotic disease caused by the rabiesirus (RABV) [1], which is a member of the genus Lyssavirus of theamily Rhabdoviridae [2]. RABV infects a wide range of mammalsnd causes acute, progressive, and fatal encephalitis with almost00% fatality [3]. It is estimated that the rabies is responsible forpproximately 55,000 human deaths per year worldwide [4,5], and95% of human deaths occur in Asia and Africa [6]. Exposure to rabidogs is the main cause of human deaths [4,7]. The most efficienttrategy for preventing human rabies is to eliminate the disease inogs through vaccination [8].

Canine distemper is a widespread infectious disease in carni-ores and caused by canine distemper virus (CDV), which is an

nveloped nonsegmented negative-strand RNA virus, and belongso the Morbillivirus genus of Paramyxoviridae family [9–12]. CDVs highly infectious and causes systemic and often fatal disease in

∗ Corresponding author at: Institute of Military Veterinary, Academy of Mili-ary Medical Sciences, No. 666, Liuying Xilu, Jingyue Economic Development Zone,hangchun 130122, China. Tel.: +86 431 86985808; fax: +86 431 86985828.

∗∗ Corresponding author at: Harbin Veterinary Research Institute, CAAS, 427 Mad-an Street, Harbin 150001, China. Tel.: +86 451 51997173; fax: +86 451 51997166.

E-mail addresses: xia xzh@yahoo.com.cn (X. Xia), zgbu@yahoo.com (Z. Bu).1 Xijun Wang and Na Feng contributed equally to this paper.

264-410X/$ – see front matter © 2012 Elsevier Ltd. All rights reserved.ttp://dx.doi.org/10.1016/j.vaccine.2012.06.001

© 2012 Elsevier Ltd. All rights reserved.

dogs and other terrestrial carnivores [10]. Mortality rates due toCDV infection vary among susceptible species and range from 0%for domestic cats to 100% for ferrets [12]. For domestic dogs, mor-tality rates are approximately 50% [13]. Currently, attenuated CDVstrains are routinely used worldwide as live vaccines against CDVinfection in dogs, minks, and other carnivores.

The development of reverse genetics has provided a power-ful tool to create recombinant nonsegmented negative-strand RNAvirus-based bivalent vaccine [14,15]. In this study, we generated arecombinant CDV attenuated vaccine strain expressing RABV glyco-protein (RVG); the major antigen for protective immune responsesagainst RABV infection [16,17]. The feasibility of this recombinantCDV to serve as a bivalent vaccine against rabies and canine dis-temper was evaluated.

2. Materials and methods

2.1. Viruses and cells

BHK-21 and Vero cells were grown in Dulbecco’s ModifiedEagle’s Minimal Essential Medium (DMEM) supplemented with

10% fetal calf serum (FCS). The CDV vaccine strain CDV/R-20/8,Vero-adapted RABV Evelyn–Rokitnicki–Abelseth (ERA) strain andRABV CVS-11 strain came from the China Veterinary Culture Col-lection. CDV/R-20/8 and RABV ERA were propagated and titrated

5 ine 30

iviomb

2

gRpcsttbmosbwtp

f5TaiCwctg

sm0pi7flud

2

mccima(c(poZetV

068 X. Wang et al. / Vacc

n Vero cells, and RABV CVS-11 in BHK-21 cells. The RABV streetirus GX/09, isolated from the brain of a dog that died of rabiesn Guangxi Province, China in 2009, was propagated in the brainsf adult mice. Viral titration results were calculated by using theethod of Reed and Muench [18]. All viruses were stored at −70 ◦C

efore use.

.2. Plasmid construction and virus rescue

To generate a full-length genome cDNA of CDV/R-20/8, the viralenome RNA was extracted from CDV/R-20/8 and subjected toT-PCR with virus-specific primer pairs to generate nine overlap-ing PCR fragments of the entire viral genome. The assembledDNA containing the sequences of the hammerhead ribozymeequence (HamRz), the full-length (15,690 nucleotide) cDNA ofhe CDV/R-20/8 strain genome in the antigenomic orientation, andhe hepatitis delta virus ribozyme sequence (HdvRz) was insertedetween Nhe I and Not I sites of the plasmid pCI. The resultant plas-id was designated as pCI-CDV. The open reading frames (ORFs)

f the N, P and L genes were PCR amplified from pCI-CDV to con-truct helper plasmids. The amplified N and L genes were insertedetween Xho I and Sal I of the plasmid pCI, respectively, and P geneas inserted between Mlu I and Sma I of the plasmid pCI. The resul-

ant helper plasmids were designated as pCI-CDVN, pCI-CDVP andCI-CDVL, respectively.

The cDNA representing the ORF of the G gene was amplifiedrom the genome RNA of RABV ERA with the primer pair of′CGTCACGTTTAAACGCAATTATAAAAAACTTAGGACACAAGAGCC-AAGTCCTCTCCGCCACCATGGTTCCTCAGGCTCTCCTGTTTGTAC3′

nd 5′GCTTACGTTTAAACTTACAGTCTGGTCTCACCCCCACTCTTG3′,n which the gene end and gene start sequences (underlined) ofDV, the optimal Kozak sequence (italic) and the Pme I sites (bold)ere included. The G gene was introduced into the CDV genome

ontained in pCI-CDV through the introduction of a PmeI site inhe P–M noncoding region at nucleotide position 3363 of the CDVenome. The resultant plasmid was designated as pCI-CDV-RVG.

To generate virus from the plasmids, BHK-21 cells grown inix-well plates were transfected with 5 �g of the full-length plas-ids together with a set of helper plasmids (1 �g pCI-CDVN,

.8 �g pCI-CDVP, and 0.5 �g pCI-CDVL) by using the Calcium Phos-hate Transfection Kit (Invitrogen) according to the manufacturer’s

nstructions. At 48 h post-transfection, cells were transferred to a5-cm2 dish in which Vero cells had been seeded at 50–60% con-uence. The cells were maintained in DMEM containing 5% FCSntil syncytia were observed. The resultant recombinant virus wasesignated as rCDV or rCDV-RVG, respectively.

.3. Immunofluorescence

CDV infection of cultured cells was detected by IFA by usingouse serum against CDV as described previously [15]. The

onfocal assay was performed as described previously [6]. BHKells were plated on coverslips in 35-mm-diameter dishes andnfected with rCDV or rCDV-RVG. The primary antibodies used were

ouse serum against RABV or dog serum against CDV. Secondaryntibodies used were tetramethyl rhodamine isothiocyanateTRITC)-conjugated goat anti-mouse antibody (Sigma) or fluores-ein isothiocyanate (FITC)-conjugated rabbit anti-dog antibodySigma). After the nuclei stained with DAPI (4′,6′-diamidino-2-henylindole), cells were analyzed with a fluorescence microscoper confocal laser microscope. Images were acquired with a

eiss Axioskop microscope (Thornwood, NY, USA) equipped forpifluorescence with a Sensys charge-coupled device camera (Pho-ometrics, Tucson, AZ, USA) by using IPLab software (Scanalytics,ienna, VA, USA).

(2012) 5067–5072

2.4. Western blotting

BHK cells were infected with rCDV or rCDV-RVG at a multiplicityof infection (MOI) of 0.1 and incubated for 36 h. RVG expression wasconfirmed by using western blotting as described previously [19].Proteins from the lysates of infected cells were separated by usingSDS–10% PAGE under denaturing conditions for Western blot anal-yses with dog serum against CDV or rabbit serum against RVG. Dogor rabbit serum binding was detected with horseradish peroxidase(HRP)-conjugated rabbit anti-dog IgG (Sigma) or HRP-conjugatedgoat anti-rabbit IgG (Sigma).

2.5. Mouse study

To assess the pathogenicity of recombinant viruses in mice,groups of 10 3-week-old BALB/c mice were injected intracere-brally (i.c.) with 30 �L of the viruses containing 3 × 104 TCID50 orintramuscularly (i.m.) in the gastrocnemius muscle with 100 �Lof the viruses containing 105 TCID50. The mice were observeddaily for signs of disease, bodyweight changes or death for3 weeks.

The mice were bled at 3 weeks post-inoculation. Then themice were challenged i.m. with 100 �L street virus GX/09 con-taining 50 MLD50 (50% of the mouse lethal dose). Mice wereobserved for 4 weeks for clinical signs of rabies. Mice thatshowed definitive clinical signs of rabies, such as paralysis,tremors and spasms, were euthanized by CO2 intoxication. Sur-vival rates obtained with the different vaccination groups werecompared.

2.6. Immunization studies in dogs

For dog immunization, 3-month-old Beagle dogs were arrangedin three groups of five animals each. Two groups were inoculatedin the quadriceps muscle with 1 mL 106 TCID50 of rCDV or rCDV-RVG, respectively. The third group was inoculated with 1 mL PBS.At 3 and 70 weeks after initial vaccination, the dogs received asecond and third vaccine dose, respectively. All dogs were bledfrom the vein of the front leg prior to vaccination and at differ-ent times post-vaccination for serological assessment. All dogsused in this study had no record of prior vaccination for rabiesor CD.

2.7. Serological tests

Animal sera were tested for RABV neutralizing antibodies (NAs)by using the rapid fluorescent focus inhibition test as described pre-viously [20], and titers of RABV NAs were expressed in IU/mL with aWHO standard as a reference. For serum CDV NA assessment, dou-ble dilutions of serum samples were preincubated with 100 TCID50rCDV for 1 h and then added to 105 Vero cells in 96-well plates. Thetiters of CDV NAs were calculated by using the method of Reed andMuench [18].

2.8. Laboratory facility

All experiments related to the rabies virus GX/09 were con-ducted in a biosafety level 3 (BSL-3) facility at the Harbin Veterinary

Research Institute of the Chinese Academy of Agricultural Sciences.All animal studies were conducted in compliance with the AnimalCare and Ethics Committee of Harbin Veterinary Research Institute,Chinese Academy of Agricultural Sciences.

X. Wang et al. / Vaccine 30 (2012) 5067–5072 5069

Fig. 1. Construction and generation of recombinant CDV expressing the RVG gene. (A) Schematic representation of the construction of full-length cDNA clone of CDV/R-20/8 strain. Nine cDNA fragments were reverse transcribed and amplified from CDV/R-20/8 RNA and subcloned stepwise into the pCI vector. HamRz was introducedupstream of the CDV/R-20/8 genome, and HdvRz was introduced downstream of the viral genome. (B) Genome structures of rescued recombinant CDV expressing the RVGgene. Schematic diagrams of the genome of the CDV vector (top), with insertion sites indicated by arrows (second) and CDV vectors containing a transcription cassetteencoding RVG (bottom), respectively. (C) Immunofluorescence analysis of RVG protein expression. Confluent BHK-21 cells were infected with rCDV or rCDV-RVG at an MOIof 0.01. The infected cells were fixed and probed with dog serum against CDV and mouse serum against RABV and then incubated with a TRITC-conjugated goat anti-mouseantibody or an FITC-conjugated rabbit anti-dog antibody. Cell nuclei were stained with DAPI. Cells were analyzed by using a confocal laser microscope. (D) Western blotanalyses of recombinant CDV expressing RVG. Lysates of BHK cells infected with rCDV or rCDV-RVG were incubated with dog serum against CDV, rabbit serum against RVG,or an anti-�-actin monoclonal antibody. Binding was visualized with 3,3-diaminobenzidine reagent after incubation with peroxidase-conjugated secondary antibodies. Thelocations of marker proteins are indicated on the left and the antiserum or antibody used is indicated on the right.

2

wa

3

3

ibrtsis

.9. Statistical analysis

Student’s t test was used for statistical analysis. All P-valuesere two-tailed and considered statistically significant when the

ssociated probability was less than 0.05.

. Results

.1. Generation of recombinant CDV expressing RVG gene

We constructed an infectious clone of CDV/R-20/8 as describedn Section 2 (Fig. 1A). The G gene of RABV ERA was insertedetween the P and M genes of the CDV cDNA (Fig. 1B). The resultantecombinant virus, rCDV-RVG, was rescued from the cDNA, and

he presence of the RVG gene was confirmed by RT-PCR. Expres-ion of the RVG by rCDV-RVG was confirmed by immunostainingnfected BHK cells. As expected, cells infected with rCDV were nottained by mouse serum against RABV, but they were positive for

immunostaining using dog serum against CDV (Fig. 1C). Cellsinfected with rCDV-RVG were stained by mouse serum againstRABV as well as dog serum against CDV (Fig. 1C). RABV G expressionby the recombinant virus was also confirmed by western blottinganalysis with rabbit serum against RVG (Fig. 1D).

3.2. Biological characterization of recombinant virus

The growth properties of rCDV and rCDV-RVG in Vero cells wereexamined. As shown in Fig. 2, rCDV-RVG and rCDV grew to similarlevels and reached peak titers of 6.25 log TCID50/mL at 72 h post-infection. This titer was approximately one-quarter of a log lowerthan that of rCDV. To investigate the genetic stability of the recom-

binant virus, rCDV-RVG was serially passaged 10 times in Verocells. The presence and expression of the RVG gene in the recom-binant virus at the 10th passage were confirmed by RT-PCR andimmunofluorescence (data not shown).

5070 X. Wang et al. / Vaccine 30

Fig. 2. Multistep growth kinetics of the recombinant viruses in Vero cells. Cellmonolayers were infected with the rCDV or rCDV-RVG at an input MOI of 0.01 TCID50

pwl

3v

brTaPr

Foi3ss

er cell. Viruses were harvested at 24-h intervals and flash frozen, and virus titersere determined in Vero cells and expressed as TCID50/mL. Mean values from trip-

icate samples are shown.

.3. RVG expression does not increase the virulence of the CDVector in mice

To investigate the replication and pathogenicity of the recom-inant virus, mice were inoculated i.c. and i.m. with rCDV orCDV-RVG, respectively. All of the mice survived after inoculation.here was no significant difference in the body weight changes

mong the three groups inoculated i.m. with rCDV-RVG, rCDV andBS (Fig. 3A) or the three groups inoculated i.c. with rCDV-RVG,CDV and PBS (Fig. 3B). No rCDV or rCDV-RVG could be recovered

ig. 3. Pathogenicity evaluation of recombinant CDV in mice. Weight changesf mice inoculated with rCDV and rCDV-RVG. Groups of 10 3-week-old mice werenoculated i.m. (A) with 105 TCID50 (in 100 �L) or i.c. (B) with 3 × 104 TCID50 (in0 �L) rCDV or rCDV-RVG, and observed and weighed daily for 21 days. All miceurvived the duration of the experiment. Body weight changes for each group arehown as ratios of the body weight at day 0, which was set as 100.

(2012) 5067–5072

from brain, lung, liver, spleen, kidney, and heart, which were col-lected at 3, 5 and 7 days after inoculation (data not shown). Thesedata suggest that both rCDV and rCDV-RVG have limited and tem-porary replication ability in mice.

3.4. Recombinant virus is immunogenic and effective againstrabies in mice

Groups of mice were inoculated i.c. or i.m. with rCDV, rCDV-RVG and PBS, respectively, as described in Section 2. Three weeksafter inoculation, sera were collected for CDV and RABV NA assays.Meanwhile, the mice were challenged with 50 MLD50 GX/09. CDVNA was detected in mice inoculated with rCDV or rCDV-RVG(Fig. 4A), but RABV NA was detected only in the blood of miceinoculated with rCDV-RVG, and not rCDV (Fig. 4B). Titers of CDVNA showed no significant difference in mice inoculated with rCDVor rCDV-RVG. The mean titers of RABV NA for i.c. and i.m. groupswere 4.2 and 1.3 IU, respectively (Fig. 4B). As shown in Fig. 4C and D,all mice inoculated with rCDV-RVG survived challenge with RABVGX/09, and showed no signs of rabies disease. All mice inoculatedwith rCDV and PBS died within 13 days of exposure to RABV GX/09.These mice showed signs of severe neurological disease and move-ment disorder. RABV antigens were detected in the brains of all ofthe mice that died during the challenge (data not shown). Theseresults demonstrate that rCDV-RVG is immunogenic and effectiveagainst rabies in mice.

3.5. Immunogenicity of recombinant virus in dogs

The immunogenicity of the recombinant virus rCDV-RVG wasfurther assessed in dogs by using the immunization schedulesdescribed in Section 2. At one week after the first dose, RABV NAwas detected in the blood of dogs inoculated with rCDV-RVG, butnot rCDV (Fig. 5A). The mean titer of RABV NA was 1.48 IU at 1 weekafter the first dose and rose to 32.11 IU (5.92, 23.38, 53.30, 70.15 and7.79 individually) at 3 weeks after the first dose. At 2 weeks after thesecond dose, the mean titer of RABV NA for the group was 96.71 IU(70.15, 70.15, 40.5, 210.44 and 92.32 individually). After that, RABVNA gradually declined to 1.96 IU at 20 weeks post-vaccination, and0.82 IU at 52 weeks post-vaccination. At 70 weeks post-vaccination,the mean titer of RABV NA was 0.51 IU (0.52, 0.22, 0.5, 0.66 and0.66 individually). After receiving the third dose of rCDV-RVG at70 weeks post-vaccination, the dogs showed substantial re-boostresponses. The mean titer of RABV NA for the group increased to281.4 IU (281.5, 159.9, 364.5, 479.71 and 121.5 individually) at 1week after the third dose. (Fig. 5A)

Meanwhile, CDV NA was detected in all dogs that received rCDVand rCDV-RVG at 3 weeks after the first dose (Fig. 5B). The meantiters were 4.3 log2 (3.5, 5, 3.75, 4.5 and 4.75 individually) and3.5 log2 (3.5, 3, 4, 3.5 and 3.5 individually) in rCDV group and rCDV-RVG group, respectively. One week after the second dose, the meantiter for the two groups reached a peak of 8.2 log2 (8.5, 8, 8.75, 8.75and 7 individually) and 8 log2 (9.5, 7.75, 8, 7.5 and 7.25 individu-ally), respectively. There was no significant difference in CDV NAtiters between the two groups. From this point, CDV NA gradu-ally declined. At 70 weeks after the first dose, the mean titers ofCDV NA for the two groups were 2.6 log2 (4, 2, 4, 0 and 3 indi-vidually) and 0.5 log2 (0, 0, 0, 2.5 and 0 individually), respectively.After receiving the third dose at 70 weeks post-vaccination, all therCDV-vaccinated and rCDV-RVG-vaccinated dogs showed substan-tial re-boost responses. At one week after the third dose, the meantiters of CDV NA for the two groups rose sharply to 9.4 log2 (10, 9.5,

9.75, 9.5 and 8.25 individually) and 9.38 log2 (9.5, 9.25, 9, 9.75 and9.4 individually), respectively (Fig. 5B). These results demonstratethat rCDV-RVG is an immunogenic bivalent live vaccine candidatefor CD and rabies in dogs.

X. Wang et al. / Vaccine 30 (2012) 5067–5072 5071

Fig. 4. Immunogenicity and protective efficacy in mice. (I) Immunization assay.Groups of 10 3-week-old mice were injected i.m. with 105 TCID50 (in 100 �L) or i.c.with 3 × 104 TCID50 (in 30 �L) rCDV or rCDV-RVG. Three weeks after vaccination,blood samples were collected to detect NA to CDV (A) and RABV (B). NAs to RABVwere detected and normalized to international units (IU) by using the WHO stan-dard. Significant differences between groups were assessed by using the t test, **P < 0.01; * P < 0.05. (II) Mouse challenge. Mice were challenged i.m. with 50 MLD50 ofthe RABV street virus GX/09 at 3 weeks post-vaccination and observed for 4 weeks.Percentage survival of i.m. (C) and i.c. (D) groups at different days post-challengewas recorded.

Fig. 5. Immunogenic efficacy in dogs. Two groups of five 3-month-old Beagle dogswere inoculated i.m. with 1 mL 106 TCID50 rCDV or rCDV-RVG. At 3 and 70 weeksafter initial vaccination, the dogs received a second and third dose, respectively. Theserum samples from dogs were collected prior to vaccination and at different timesafter vaccination and the RABV NA titers (A) and CDV NA titers (B) were detected.

NAs to RABV were determined and normalized to IU by using the WHO standard.Statistically significant differences were determined by using the t test, ** P < 0.01;* P < 0.05.

No abnormal clinical signs were observed during the course ofthe study, which suggests that the recombinant virus rCDV-RVG issafe for dogs.

4. Discussion

In the present study, we generated a recombinant CDV, rCDV-RVG, expressing RVG, by using reverse genetics and evaluated itspotential as a bivalent vaccine against rabies and CD in animals.Animal studies demonstrated that rCDV-RVG was safe in mice anddogs. Mice inoculated i.c. or i.m. with rCDV-RVG showed no appar-ent signs of disease and developed a strong RABV NA response,which completely protected mice from challenge with a lethal doseof street virus GX/09. Dog studies showed that vaccination withrCDV-RVG induced strong and long-lasting NA responses to RABVand CDV. This is the first study to demonstrate that recombinantCDV has the potential to serve as a bivalent live vaccine againstrabies and CD.

For recombinant vaccine viruses, one concern that requiresinvestigation is that the introduction of the foreign gene does notincrease the virulence of the vector virus [15]. RVG is not onlya protective antigen, but also an important virulence factor forRABV [19,21]. Our results demonstrated that RVG expression didnot increase the virulence of the CDV vector. In fact, animal studies

confirmed that rCDV-RVG is safe in mice and dogs, even at a veryhigh dose. However, whether the introduction and expression ofRVG alters the tropism of vector CDV and make it more neurotropiclike as RABV ERA vaccine strain remains further investigation.

5 ine 30

liNRv

vvacravososcrobo

mtAgbpotyaRoad

A

(cc

R

[

[[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[topical respiratory tract immunization of primates against Ebola virus. J Virol

072 X. Wang et al. / Vacc

The recombinant virus rCDV-RVG induced significant long-asting VNAs. At 52 weeks post-vaccination, the titers of NA to RABVn all five rCDV-RVG-vaccinated dogs were >0.5 IU; the minimumA titer required to protect animals from challenge with streetABV [6,19]. This result suggested that rCDV-RVG vaccination pro-ides effective protection for >1 year in dogs.

The development of an immune response against one particularector would probably make that vector ineffective for subsequentaccination in the same individual. The prevalence of immunity tovector, such as vaccinia virus or adenovirus type 5 vector virus,

ould restrict the replication of the recombinant virus vaccine,esulting in a reduced immune response to the expressed foreignntigen [22–25]. This does not seem to be a problem for the CDVector vaccine in this study. Our results here showed that a sec-nd dose of rCDV-RVG, received 3 weeks after the first, inducedignificant booster responses to NA of RABV and CDV in dogs. More-ver, the third dose, received 70 weeks later, induced even moreignificant re-boost responses to NA of RVG and CDV, again indi-ating that the immunity to the CDV vector is not strong enough toestrict the replication of recombinant viruses after the first doser 1 year later. In fact, the second or third dose induced sizeableooster immune responses, as has been documented with severalther virus-vectored vaccines [15,26–29].

Although the rCDV-RVG induced significant NA to CDV with aean titer comparable to that of rCDV, however, the NA to CDV in

he rCDV-RVG group decreased faster than that in the rCDV group.fter 5–6 months, the mean titer of NA to CDV in the rCDV-RVGroup was significantly lower than that in the rCDV group. Theooster vaccination may be necessary to ensure that animals arerotected against infection by virulent CDV. In fact, the vaccinationf CDV live vaccine is usually given as two doses for naïve dogs andhe booster vaccination is routinely given each 6 months or eachear. Therefore, rCDV-RVG is a feasible bivalent vaccine against CDnd rabies. Compare with existing and other vector vaccine, rCDV-VG can prevent two important infectious disease, CD and rabies,f dogs. Therefore, its utilization will contribute to simplify vaccinedministration and reduce vaccination cost of rabies vaccine in theeveloping countries.

cknowledgments

This work was supported by Chinese National S&T Plan2012ZX10004214), by a grant from the Chinese Ministry of Agri-ulture (201103032), and by a Fundamental Researching Funds forentral public welfare research institutes (03020120004).

eferences

[1] Ming P, Du J, Tang Q, Yan J, Nadin-Davis SA, Li H, et al. Molecular characterizationof the complete genome of a street rabies virus isolated in China. Virus Res2009;143(1):6–14.

[2] Jackson AC, Wunner WH. Rabies. 2nd ed. Amsterdam/Boston: Else-vier/Academic Press; 2007.

[3] Osinubi MO, Wu X, Franka R, Niezgoda M, Nok AJ, Ogunkoya AB, et al. Enhanc-ing comparative rabies DNA vaccine effectiveness through glycoprotein gene

modifications. Vaccine 2009;27(51):7214–8.

[4] World Health Organization. WHO expert consultation on rabies: first report.Geneva: World Health Organization; 2005.

[5] Martinez L. Global infectious disease surveillance. Int J Infect Dis2000;4(4):222–8.

[

(2012) 5067–5072

[6] Ge J, Wang X, Tao L, Wen Z, Feng N, Yang S, et al. Newcastle disease virus-vectored rabies vaccine is safe, highly immunogenic, and provides long-lastingprotection in dogs and cats. J Virol 2011;85(16):8241–52.

[7] Fu ZF. Rabies and rabies research: past, present and future. Vaccine1997;15(Suppl):S20–4.

[8] Lembo T, Hampson K, Kaare MT, Ernest E, Knobel D, Kazwala RR, et al. Thefeasibility of canine rabies elimination in Africa: dispelling doubts with data.PLoS Negl Trop Dis 2010;4(2):e626.

[9] Brown AL, Vitamvas JA, Merry Jr DL, Beckenhauer WH. Immune response ofpups to modified live-virus canine distemper-measles vaccine. Am J Vet Res1972;33(7):1447–56.

10] Cherpillod P, Tipold A, Griot-Wenk M, Cardozo C, Schmid I, Fatzer R,et al. DNA vaccine encoding nucleocapsid and surface proteins of wild typecanine distemper virus protects its natural host against distemper. Vaccine2000;18(26):2927–36.

11] Appel MJ. Pathogenesis of canine distemper. Am J Vet Res 1969;30(7):1167–82.12] Silin D, Lyubomska O, Ludlow M, Duprex WP, Rima BK. Develop-

ment of a challenge-protective vaccine concept by modification of theviral RNA-dependent RNA polymerase of canine distemper virus. J Virol2007;81(24):13649–58.

13] Ek-Kommonen C, Rudbäck E, Anttila M, Aho M, Huovilainen A. Canine distem-per of vaccine origin in European mink, Mustela lutreola—a case report. VetMicrobiol 2003;92(3):289–93.

14] Ge J, Tian G, Zeng X, Jiang Y, Chen H, Bu Z. Generation and evaluation ofa Newcastle disease virus-based H9 avian influenza live vaccine. Avian Dis2010;54(Suppl 1):294–6.

15] Ge J, Deng G, Wen Z, Tian G, Wang Y, Shi J, et al. Newcastle disease virus-basedlive attenuated vaccine completely protects chickens and mice from lethal chal-lenge of homologous and heterologous H5N1 avian influenza viruses. J Virol2007;81(1):150–8.

16] Johnson N, Mansfield KL, Fooks AR. Canine vaccine recipients recognizean immunodominant region of the rabies virus glycoprotein. J Gen Virol2002;83(11):2663–9.

17] Dietzschold B, Li J, Faber M, Schnell M. Concepts in the pathogenesis of rabies.Future Virol 2008;3(5):481–90.

18] Reed L, Muench H. A simple method of estimating fifty percent endpoints. AmJ Hyg 1938;27:493–7.

19] Tao L, Ge J, Wang X, Zhai H, Hua T, Zhao B, et al. Molecular basis of neurovir-ulence of flury rabies virus vaccine strains: importance of the polymerase andthe glycoprotein R333Q mutation. J Virol 2010;84(17):8926–36.

20] Smith JS, Yager PA, Baer GM. A rapid reproducible test for determining rabiesneutralizing antibody. Bull World Health Organ 1973;48(5):535.

21] Faber M, Pulmanausahakul R, Nagao K, Prosniak M, Rice AB, Koprowski H, et al.Identification of viral genomic elements responsible for rabies virus neuroin-vasiveness. Proc Natl Acad Sci U S A 2004;101(46):16328–32.

22] Kanesa-thasan N, Smucny JJ, Hoke CH, Marks DH, Konishi E, Kurane I, et al.Safety and immunogenicity of NYVAC-JEV and ALVAC-JEV attenuated recom-binant Japanese encephalitis virus—poxvirus vaccines in vaccinia-nonimmuneand vaccinia-immune humans. Vaccine 2000;19(4–5):483–91.

23] Sharpe S, Polyanskaya N, Dennis M, Sutter G, Hanke T, Erfle V, et al.Induction of simian immunodeficiency virus (SIV)-specific CTL in rhesusmacaques by vaccination with modified vaccinia virus Ankara expressingSIV transgenes: influence of pre-existing anti-vector immunity. J Gen Virol2001;82(9):2215–23.

24] Yang ZY, Wyatt LS, Kong WP, Moodie Z, Moss B, Nabel GJ. Overcomingimmunity to a viral vaccine by DNA priming before vector boosting. J Virol2003;77(1):799–803.

25] McCoy K, Tatsis N, Korioth-Schmitz B, Lasaro MO, Hensley SE, Lin SW,et al. Effect of preexisting immunity to adenovirus human serotype 5antigens on the immune responses of nonhuman primates to vaccine reg-imens based on human- or chimpanzee-derived adenovirus vectors. J Virol2007;81(12):6594–604.

26] Weingartl HM, Berhane Y, Caswell JL, Loosmore S, Audonnet JC, Roth JA,et al. Recombinant Nipah virus vaccines protect pigs against challenge. J Virol2006;80(16):7929–38.

27] Gao W, Soloff AC, Lu X, Montecalvo A, Nguyen DC, Matsuoka Y, et al. Protectionof mice and poultry from lethal H5N1 avian influenza virus through adenovirus-based immunization. J Virol 2006;80(4):1959–64.

28] Bukreyev A, Rollin PE, Tate MK, Yang L, Zaki SR, Shieh WJ, et al. Successful

2007;81(12):6379–88.29] Chen W, Hu S, Qu L, Hu Q, Zhang Q, Zhi H, et al. A goat poxvirus-vectored peste-

des-petits-ruminants vaccine induces long-lasting neutralization antibody tohigh levels in goats and sheep. Vaccine 2010;28(30):4742–50.