RAPID DETECTION OF GENETICALLY MODIFIED ORGANISMS ?· RAPID DETECTION OF GENETICALLY MODIFIED ORGANISMS…

Download RAPID DETECTION OF GENETICALLY MODIFIED ORGANISMS ?· RAPID DETECTION OF GENETICALLY MODIFIED ORGANISMS…

Post on 28-Jul-2018

212 views

Category:

Documents

0 download

Embed Size (px)

TRANSCRIPT

  • 98

    Int. J. LifeSc. Bt & Pharm. Res. 2012 Abhijit V Sahasrabudhe and Vishwanath S Khadye, 2012

    RAPID DETECTION OF GENETICALLYMODIFIED ORGANISMS IN COTTON SEEDS

    BY REAL TIME PCRVishwanath S Khadye1 and Abhijit V Sahasrabudhe1*

    Research Paper

    The ability to detect presence or absence of foreign gene(s) relies on high yields of pure DNAsamples. Cotton seeds contain polyphenols, polysaccharides and other secondary metaboliteswhich often interfere during DNA isolation. Here we present optimization of DNA isolation andReal Time PCR conditions for the detection of GMO in cotton seeds (Gossypium spp.). Themodified CTAB protocol includes addition of sodium bisulfite in combination with higher CTABconcentration and precipitation of DNA with 5 M NaCl in combination with chilled ethanol increasedthe solubility of polysaccharides and polyphenols. This protocol is devoid of use of expensivechemicals such as Proteinase K and RNase etc. We also optimized Real Time PCR conditionssuch as annealing temperature and concentration of DNA for the detection of CaMV 35S targetgene. Four samples out of five were found to be GM positive with reference to target gene.

    Keywords: Cotton seeds, DNA isolation, GMO analysis, CaMV35S promoter, Real Time PCR

    *Corresponding Author: Abhijit V Sahasrabudhe,abhijitvs@gmail.com

    INTRODUCTIONGenetically modified organisms (GMOs) contain

    specific traits/ genes which are inserted in to

    organisms to improve their property which does

    not generally occur by natural mating (Anklam et

    al., 2002). Such genetically modified crops have

    made a vital contribution to food, feed and fibre

    security in todays world. By the end of year 2010,

    the global area of GM plants was 148 m ha which

    was just 1.7 m ha in 1996. Now a days around

    forty five GM crops are available of which soya,

    cotton, maize and potato are major GM crops.

    As far as India is concerned, GM cotton covers

    ISSN 2250-3137 www.ijlbpr.comVol. 1, No. 4, October 2012

    2012 IJLBPR. All Rights Reserved

    Int. J. LifeSc. Bt & Pharm. Res. 2012

    1 DSPMs K V Pendharkar College of Arts, Science and Commerce, MIDC, Dombivli (E), Thane, India.

    around 10.0 m ha of land and is the only dominant

    crop produced on commercial basis. BT cotton

    was the first introduced by a USA based company

    Monsanto in collaboration with Maharashtra

    Hybrid Seed Company (MHYCO) and was

    commercialized in 1990s at the global level and

    officially approved for sale in India in 2002. Cotton

    is an important crop for textile industry and is the

    food and feed source of many areas of the world.

    It was developed to reduce heavy resilience on

    pesticide; Bacillus thurengenesis naturally

    produces a chemical harmful to a small fraction

    to insects, larve of moths, butterflies, flies and

  • 99

    Int. J. LifeSc. Bt & Pharm. Res. 2012 Abhijit V Sahasrabudhe and Vishwanath S Khadye, 2012

    harmful to other forms of life. The gene coding

    for BT toxin has been inserted in to cotton, causing

    cotton to produce a natural insecticide in its

    tissues. Cotton contains gossypol, a toxin that

    makes it inedible. However scientists have

    silenced the gene that produces a toxin thereby

    making it a potential food crop.

    In genetically modified crops most common

    recombinant elements are Cauliflower Mosaic

    Virus (CaMV 35S promoter) and NOS terminator

    sequences (Lipp et al., 1999) both of which are

    transcription regulating sequences (Odell et al.,

    1985). As the demand to detect transgene is vastly

    increasing due to introduction of new GM crops,

    the development of rapid detection protocols have

    also become much more challenging and

    mandatory.

    A series of analytical tools based on detecting

    DNA, RNA and Protein are available to

    differentiate between GM and non GM crops.

    Among DNA based methods, Polymerase Chain

    Reaction (PCR) is the most widely used method

    in research as well as in commercial laboratories

    because of its high sensitivity and specificity

    (Anklam et al., 2002 and Ahmed, 2002). Real Time

    PCR is preferred over conventional PCR as it

    allows monitoring of reaction in real time through

    fluorescence (Heid et al., 1996) plus no post

    agarose gel detection is required in Real Time

    PCR which used SYBR green dye I chemistry.

    This has a high affinity towards all double stranded

    DNA (Morrison et al., 1998) and a melting curve

    is generated at the end of reaction allowing post

    PCR identification in expected target as well as

    in closely related targets. Another advantage is

    that it is cost effective as no dye labeled

    oligonucleotide probes is required (Terry and

    Harris, 2001).

    Cotton (Gossypium spp.) being a tree is a verydifficult plant for DNA isolation from leaves or fromseeds due to presence of phenolic compoundsthat generally interfere with quality and quantityof DNA by making it unstable for downstreamprocesses such as RFLP, RAPD and PCR etc.There are many protocols available for isolationof genomic DNA from cotton seeds, but all theseare laborious, time consuming and costly. Forcommercial basis a rapid and pure isolation ofgenomic DNA is a prerequisite. Taking this intoaccount, it was decided to standardize a rapidand cost effective method for isolation of genomicDNA from cotton seeds and optimizing Real TimePCR conditions for qualitative detection of target

    gene (CaMV 35S promoter) in cotton seeds.

    MATERIALS AND METHODSSample Collection

    Five cotton seed samples were collected from

    different regions of Maharashtra.

    Chemicals and Other Reagents

    Extraction buffer containing 2.5% CTAB, 1.8M

    NaCl, 0.1M Tris-HCl (pH-8.0), 0.02M EDTA.2H20

    (pH-8.2), 0.35 M Sodium bisulfite and 0.1%

    -mercaptoethanol (added just before the use)

    Phenol: Chloroform: isoamyl alcohol (25:24:1).

    5M NaCl

    Chilled distilled ethanol

    0.1X TE buffer containing 10mM Tris (pH-8)

    and 1 mM EDTA. 2H20 (pH-8)

    Primer Information

    Primers were synthesized from Sigma Aldrich,

    USA. All primers were diluted to the working

    concentrations 10pmol/l with sterile deionized

    water. The sequences of the primers are given in

    Table 1.

  • 100

    Int. J. LifeSc. Bt & Pharm. Res. 2012 Abhijit V Sahasrabudhe and Vishwanath S Khadye, 2012

    DNA Isolation

    GMO CRL Protocol

    1. Take 6 gms of cotton seed powder and add 25

    ml of CTAB extraction buffer containing 0.5ml of

    -mercaptoethanol and 0.25ml of Proteinase K.Mix the content by inversion. 2. Incubate at 550C

    for 60 mins with intermittent shaking. Cool the

    tube after incubation. 3. Add 20 ml of Phenol:

    Chloroform: Isoamylalchohol (25:24:1) and mix

    gently by inversion. 4. Centrifuge at 13,000 g for

    10 mins at room temperature. 5. Collect the

    aqueous layer and repeat step 3 and 4 twice.

    6. To the collected aqueous layer add 2 volumes

    of chilled isopropanol and gently mix by inversion.

    7. Allow the DNA threads to appear. 8 Spin the

    DNA at 5000 rpm for 10 mins at 40C. 9. Remove

    the supernatant and allow the pellet to dry

    overnight 10. Next day dissolve the pellet in 2ml

    of TE buffer and store at -200C. 11. Add 50l of

    RNase and incubate at 370C for 30 min. 12. To

    extract DNA, add 4 ml of Chloroform:

    Isoamylalchohol (24:1) and mix the content

    vigorously. 13. Centrifuge at 10000 rpm for 10

    min at room temperature. 14. To the upper layer,

    add half volumes of 7.5M ammonium acetate and

    add 2 volumes of 100% ethanol. 15. Allow the

    DNA to appear again and spin the content at 40C

    for 10 min at 5000 rpm. 16. Throw the supernatant

    and allow the pellet to dry and next day add TE

    buffer.

    Standardized Protocol

    1. Weigh 30 mg of finely grinded cotton seed

    powder in a 2 ml microcentrifuge tube. 2. Add

    250 l of extraction buffer and mix well with gentle

    inversion. 3. Incubate the content at 600C for one

    hour with intermittent shaking after 10 min. 4.

    Centrifuge at 12,000 rpm for 20 min at 250C. 5.

    Collect the aqueous layer and add equal volume

    of phenol: chloroform: isoamylalchol (25:24:1)

    and mix well by gentle inversion. 6. Centrifuge at

    12,000 rpm for 20 mins at 250C. 7. Repeat steps

    5 and 6 twice. 8. To the aqueous layer, 0.5

    volumes of 5 M NaCl was added followed by 2

    volumes chilled distilled ethanol and mix by gentle

    inversion. 9. Allow the DNA threads to appear. 10.

    Spin the content at 40C for 10 min at 5000 rpm.

    11. Throw the supernatant and allow the pellet to

    dry overnight. 12. To the pellet, add 150 l of 0.1X

    TE buffer and store at 200C till use.

    Agarose Gel Electrophoresis and DNAPurity

    The genomic DNA was resolved on 0.8% agarose

    gel in 1X TAE buffer with internal ethidium bromide

    staining and electrophoresis was carried out at

    65V for 2 hrs and visualized under UV

    transilluminator. DNA purity was checked by

    measuring the absorbance at 260 nm and 280

    nm.

    Real Time PCR

    In order to check whether the extracted was

    Table 1: Primers used for Real Time PCR study

    Oligo Name Sequence GC%

    CaMV forward GCTCCTACAAATGCCATCA 47%

    CaMV reverse GATAGTGGGATTGTGCGTCA 50%

    Sah 7 forward AGTTTGTAGTTTTGATGTTACATTGAG 32%

    Sah 7 reverse GCATCTTTGAACCGCCTACTG 52%

  • 101

    Int. J. LifeSc. Bt & Pharm. Res. 2012 Abhijit V Sahasrabudhe and Vishwanath S Khadye, 2012

    suitable for GMO detection, Real Time PCR was

    performed using SYBR Green Master Mix. Real

    Time PCR analysis was carried out in 7300 Real

    Time PCR System (Applied Biosystems, USA).

    All the amplification reactions were performed in

    96 well plates. Individual reactions contains 12.5

    l of 2.5X SYBR Green Master mix, 5 l of template

    DNA, 1 l of each forward and reverse primer

    and finally volumised to 25 l using sterile Mili-Q

    water. Negative template control was also run

    along with DNA samples to avoid the detection of

    false positive and false negative. For positive

    control we used standard cotton seed powder

    DNA (0.1%) (ERM-BF413b) purchased from

    European Union (EU) Joint Research Center,

    Fluka. PCR conditions involved an initial

    denaturation for 5 min at 950C, followed by 40

    cycles of 950C for 15 sec, 600C for 1 min and

    720C for 2 min. Finally reactions were held at 720C

    for 5 min. The amplification products were

    electrophoresed on 2% agarose gel for 1 hr at

    100 volts with internal ethidium bromide staining

    to confirm the desired product.

    RESULTS AND DISCUSSIONIsolation of good quality of genomic DNA from

    cotton seeds was very difficult due to presence

    of phenolic compounds. During tissue

    homogenization, these compounds oxidize and

    thus irreversibly bind with proteins and other

    nucleic acids. This irreversible binding produces

    a gelatinous pellet with brownish color which is

    hard to separate from organelles and thereby

    making DNA unstable for downstream processes.

    Most procedures for DNA isolation from plant

    species containing high levels of phenolic

    compounds are modified versions of standard

    protocols. In our study, GMO-CRL method

    reported earlier for isolation of genomic DNA from

    modified cotton seeds did not work well. Though

    we could able to isolate DNA but the pellet was

    brownish having gel like appearance made it

    difficult to dissolve in 0.1X TE buffer. Electro-

    phoresis pattern showed presence of RNA along

    with proteins and other impurities (Figure 1, lane

    3 and 4). We also noticed that yield was very less

    though starting material was around 3 gms.

    A260/280

    ratio was 2.4 with GMO-CRL protocol

    indicating interference of RNA. Hence we have

    devised a simpler procedure that used sodium

    bisulfite as a reducing agent and extraction buffer

    based on the CTAB method. We observed that

    addition of 0.35 M sodium bisulfite to extraction

    buffer drastically improved the DNA quantity and

    quality, avoiding contamination and browning of

    the pellet by phenolic compounds. The purity

    decreased when we used lower concentration

    (0.15 M) of sodium bisulfite and with higher

    concentration (1M) the yield was less probably

    because 1M sodium bisulfite fulfills a role of

    osmoprotectant. In our case we just used 50 mg

    of cotton seed powder as the starting material

    which was very less as compared to GMO-CRL

    method. During precipitation of DNA, we used

    chilled ethanol which improved the yield. It has

    been reported that higher concentrations of NaCl

    along with ethanol increases the solubility of

    polysaccharides and phenolic compounds (Fang

    et al., 1992; Sahasrabudhe and Deodhar, 2010).

    Thus we could able to isolate DNA free of RNA

    and protein contamination (Figure 1, lane 2)

    (depicted with black arrow). The freer the DNA is

    from contaminants easier it is to resuspend the

    pellet. Disadvantage in GMO-CRL protocol was

    we need to re precipitate DNA again after RNase

    treatment which makes it time consuming plus

    there are chances of shearing of DNA on the other

    hand, our standardized method is fast, reliable

    and cost effective as no expensive chemicals

    such as RNase and Proteinase K are required.

  • 102

    Int. J. LifeSc. Bt & Pharm. Res. 2012 Abhijit V Sahasrabudhe and Vishwanath S Khadye, 2012

    Another advantage is that very less starting

    material is required for isolation of DNA (DNA yield

    was 1.015 g with 30 mg of cotton seed powder.

    Real Time PCR Analysis

    Initially we tried amplification pattern of DNA

    samples isolated from GMO-CRL protocol using

    Real Time PCR. We observed quenching in the

    amplification curve (Figure 2). The reason could

    be because of inhibition of Taq DNA polymerase

    due to the inhibitory components in the reaction

    mixture, proteins, RNA or polyphenolics

    contaminants present in the DNA sample. Also a

    small amplification curve was seen in the target

    gene of NTC. This might be because of the cross

    contamination in the adjacent wells or may be

    due to primer-dimmer formation. To overcome

    these difficulties, we then standardized our DNA

    extraction method to get pure and sufficient

    amount of genomic DNA. Our standardized

    method produced proper amplification curve

    (Figure 3). After standardizing DNA isolation

    protocol we then optimized various PCR cycle

    parameters such as annealing temperature and

    amount of DNA. We tried three annealing

    temperatures such as 55, 60 and 650C. At 550C

    there was a quenching seen in the amplification

    curve while at 650C there was no amplification

    but at 600C a proper curve was observed plus

    there was no amplification in NTC (Non template

    control) (Table 2, depicted with red arrow). For

    Real Time PCR analysis, we used 20, 40 and 80

    ng of DNA samples. We found that at 20 ng there

    was no amplification curve but at 40 and 80 ng a

    proper amplification curve seen. Hence for further

    experiments we used 40 ng of DNA.

    As mentioned earlier, we have tested five

    different cotton seed samples collected from five

    regions of Maharashtra. Interestingly among five

    samples, four samples were found to be GM

    positive since the amplification curve was

    observed in target as well as in endogenous gene

    (Figure 3). As we can see from the Table 2, Ct

    Figure 1: Genomic DNA of Cotton Seeds Resolved on 0.8% Agarose Gel

  • 103

    Int. J. LifeSc. Bt & Pharm. Res. 2012 Abhijit V Sahasrabudhe and Vishwanath S Khadye, 2012

    Figure 2: Quenched Amplification Curve

    values of four samples were earlier than that of

    the standard GM (0.1%) target gene confirming

    that there was early amplification of target gene

    as compared to that of standard CaMV gene.

    Only...