pseudomonas aeruginosa algr represses the rhl quorum

JOURNAL OF BACTERIOLOGY, Nov. 2007, p. 7752–7764 Vol. 189, No. 210021-9193/07/$08.00�0 doi:10.1128/JB.01797-06Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Pseudomonas aeruginosa AlgR Represses the Rhl Quorum-SensingSystem in a Biofilm-Specific Manner�†

Lisa A. Morici,1 Alexander J. Carterson,1 Victoria E. Wagner,2 Anders Frisk,1 Jill R. Schurr,3Kerstin Honer zu Bentrup,1 Daniel J. Hassett,4 Barbara H. Iglewski,2

Karin Sauer,5 and Michael J. Schurr6*Department of Microbiology and Immunology, Program in Molecular Pathogenesis and Immunity, Tulane University Health Sciences

Center, New Orleans, Louisiana 701121; Department of Microbiology and Immunology, University of Rochester, Rochester,New York 146422; Department of Genetics, Louisiana State University Health Sciences Center, New Orleans, Louisiana 701123;

University of Cincinnati College of Medicine, Department of Molecular Genetics, Biochemistry, and Microbiology,Cincinnati, Ohio 452674; Department of Biological Sciences, State University of New York at Binghamton,

Binghamton, New York 139025; and University of Colorado at Denver and Health Sciences Center,Department of Microbiology, Aurora, Colorado 800456

Received 28 November 2006/Accepted 22 August 2007

AlgR controls numerous virulence factors in Pseudomonas aeruginosa, including alginate, hydrogen cyanideproduction, and type IV pilus-mediated twitching motility. In this study, the role of AlgR in biofilms was examinedin continuous-flow and static biofilm assays. Strain PSL317 (�algR) produced one-third the biofilm biomass ofwild-type strain PAO1. Complementation with algR, but not fimTU-pilVWXY1Y2E, restored PSL317 to the wild-typebiofilm phenotype. Comparisons of the transcriptional profiles of biofilm-grown PAO1 and PSL317 revealed that anumber of quorum-sensing genes were upregulated in the algR deletion strain. Measurement of rhlA::lacZ andrhlI::lacZ promoter fusions confirmed the transcriptional profiling data when PSL317 was grown as a biofilm, butnot planktonically. Increased amounts of rhamnolipids and N-butyryl homoserine lactone were detected in thebiofilm effluent but not the planktonic supernatants of the algR mutant. Additionally, AlgR specifically bound to therhlA and rhlI promoters in mobility shift assays. Moreover, PAO1 containing a chromosomal mutated AlgR bindingsite in its rhlI promoter formed biofilms and produced increased amounts of rhamnolipids similarly to the algRdeletion strain. These observations indicate that AlgR specifically represses the Rhl quorum-sensing system duringbiofilm growth and that such repression is necessary for normal biofilm development. These data also suggest thatAlgR may control transcription in a contact-dependent or biofilm-specific manner.

The opportunistic pathogen Pseudomonas aeruginosa is themajor cause of morbidity and mortality in patients with cysticfibrosis (CF) (28). The factors that enable P. aeruginosa topredominate and persist in the CF lung despite aggressiveantimicrobial therapy are numerous and include alginate pro-duction (27), antimicrobial resistance mechanisms (20, 66),and secreted factors (41, 56). Furthermore, several studiessuggest that P. aeruginosa persists in the CF lung as organizedcommunities known as biofilms (14, 75). Biofilms are com-posed of many individual bacteria in various stages of devel-opment and contain self-generating diversity to produce insur-ance effects (4, 37). Bacterial biofilms are encased in anextracellular polymeric substance (40) and are intrinsicallymore resistant than planktonic organisms to innate immunedefense mechanisms and antimicrobial therapy (8, 20, 46).

To date, three exopolysaccharides associated with P. aerugi-nosa biofilms, alginate (12), the product of psl genes (85), andthe product of pel genes (25), have been identified. Biofilmsformed by mucoid P. aeruginosa contain significant amounts of

alginate, and alginate production in mucoid strains influencesbiofilm architecture (29, 54). However, others have shown thatalginate is not the predominant polysaccharide present in non-mucoid P. aeruginosa biofilms cultured in vitro (85) and is notrequired for biofilm development (76). Evidence from the ex-isting literature indicates that alginate is most likely an exopo-lysaccharide produced under stress by P. aeruginosa (5, 79, 84).The conversion of nonmucoid P. aeruginosa to the alginate-overproducing mucoid phenotype is a critical step in the patho-genesis of CF disease and coincides with a worsening prognosisfor the CF patient (28). Thus, the activation of the alginatebiosynthetic pathway and biofilm development in P. aeruginosaboth represent a critical juncture in CF pathology.

One of the molecular mechanisms for the constitutive ex-pression of the exopolysaccharide alginate has been discoveredand involves the alternative sigma factor, AlgU (47, 48) (alsoknown as AlgT [24]). Upon activation through mutations ac-quired in mucA (48), alginate is produced in copious amountsby transcriptional activation of the regulatory protein AlgRand its subsequent upregulation of the 12 alginate biosyntheticgenes (algD through algA) (28, 49, 68–70). The transcriptionalregulator AlgR is required for algD transcription by binding tothree sites within the algD promoter (RB1, RB2, and RB3)(51–53). Mucoid P. aeruginosa strains in which algR is dis-rupted are no longer able to produce alginate (18).

AlgR has been shown to regulate several other P. aeruginosaprocesses, including hydrogen cyanide (HCN) production (7)

* Corresponding author. Mailing address: University of Colorado atDenver and Health Sciences Center, Department of Microbiology,12800 E. 19th Avenue, Aurora, CO 80045. Phone: (303) 724-4224. Fax:(303) 724-4226. E-mail: [email protected].

† Supplemental material for this article may be found at http://jb.asm.org/.

� Published ahead of print on 31 August 2007.

7752

on January 31, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

and twitching motility (44, 82, 83), suggesting a more globalrole for AlgR in P. aeruginosa pathogenesis. In support of this,AlgR is required for full virulence in both the acute septicemiaand pneumonia murine infection models (43). However, thegenes involved in the global affects observed in the virulencestudies have not yet been identified.

In this study, the AlgR regulon of the nonmucoid laboratorystrain PAO1 was examined during biofilm growth using flowchamber and static biofilm technology. These findings expandthe role of AlgR as a regulator of virulence in P. aeruginosa bydemonstrating that AlgR directly represses the Rhl quorum-sensing circuit in a biofilm-specific manner. Furthermore,these findings support the hypothesis that AlgR may utilizecontact-dependent or biofilm-specific mechanisms of gene reg-ulation that may account for its differential regulation of al-ginate production, twitching motility, and biofilm maturation.

MATERIALS AND METHODS

Bacterial strains and plasmids. The bacterial strains and plasmids used in thisstudy are listed in Table 1. Plasmid CTXlacZ490ScaI was constructed usingoligonucleotides lacZhinD and CTXXho (Table 2) to amplify the first 490 nu-cleotides of lacZ from plasmid pRS415 (74). The PCR product was digested withHinDIII and XhoI and ligated into plasmid mini-CTX-1 (34) digested with thesame restriction enzymes. The resulting plasmid, CTXlacZ490, was subjected tosite-directed mutagenesis using the Stratagene Quick Change II protocol witholigonucleotides lacZScaF’ and lacZScaR’ (Table 2) to introduce an in-frameScaI restriction endonuclease site into the lacZ open reading frame to createtranslational fusions. Plasmid pCR2.1 rhlI was constructed by ligation of thePCR product of oligonucleotides rhlIgsF and rhlIgsR (Table 2) into Invitrogen’s

pCR2.1 vector. Plasmid pCR2.1 rhlA was constructed by cloning the PCR prod-uct of oligonucleotides rhlAgsF and rhlAgsR into pCR2.1.

Continuous culture biofilm growth. Flowthrough biofilms were grown in aone-flowthrough model using Pseudomonas putida minimal medium supple-mented with glutamate (1.6 mM) as sole carbon source as described previously(67). Briefly, 3 ml of an overnight culture of the same medium used for thebiofilm was inoculated into a flowthrough biofilm system with a flow rate ofapproximately 0.4 ml/min and grown for 6 days in minimal medium at roomtemperature (�26°C). The resulting biofilm was collected in RNALater (Am-bion) for RNA isolation.

Swarming motility assay. P. aeruginosa strains were grown in FAB (73) with1.6 mM glucose, glutamate, or succinate medium solidified with 0.5% Nobleagar. Plates were inoculated by using a sterilized platinum wire with log-phasecells (optical density at 600 nm [OD600] of 0.6) grown in the respective carbonsource overnight and incubated at 30°C for 24 h. The zones of migration from thepoint of inoculation were measured in triplicate for each condition.

RNA isolation and preparation for Affymetrix GeneChip analysis. P. aerugi-nosa strains PAO1 and PSL317 were grown as biofilms using the flowthroughmodel described above. RNA was isolated using a CsCl gradient as previouslydescribed (71) and analyzed with an Agilent 2100 Bioanalyzer to determine theRNA integrity (see Fig. S1 in the supplemental material). Ten micrograms oftotal RNA was used for cDNA synthesis, fragmentation, and labeling accordingto the Affymetrix GeneChip P. aeruginosa genome array expression protocol.Briefly, random hexamers (Invitrogen) were added to 10 �g of RNA along within vitro-transcribed Bacillus subtilis control spikes. cDNA was synthesized usingSuperscript III (Invitrogen) and the following conditions: 25°C for 10 min, 37°Cfor 60 min, and 70°C for 10 min. RNA was removed by alkaline treatment andsubsequent neutralization. The cDNA was purified by using a QIAquick PCRpurification kit (QIAGEN) and eluted in 40 �l of elution buffer (QIAGEN). ThecDNA was then fragmented by using 0.6 U DNase I (Amersham) per �g cDNAat 37°C for 10 min. The fragmented cDNA was end labeled with biotin-ddUTPby using a BioArray terminal labeling kit (Enzo) per the manufacturer’s instruc-tions. A gel shift mobility assay was performed using NeutrAvadin (Pierce) on a

TABLE 1. List of strains and plasmids used in this study

Strain or plasmid Relevant properties Reference or origin

P. aeruginosa strainsPAO1 Wild type 35PSL317 PAO1 �algR 44PAO1rhlImut AlgR binding site mutated in rhlI promoter from CCGTTCATCC to

TTACTCGTCCThis study

PAO1 rhlI::lacZ rhlA::lacZ promoter fusion in attB site of PAO1 chromosome D. Hassett;this study

PSL317 rhlI::lacZ rhlA::lacZ promoter fusion in attB site of PSL317 (�algR) chromosome This studyPAO1 rhlA::lacZ rhlI::lacZ promoter fusion in attB site of PAO1 chromosome This studyPSL317 rhlA::lacZ rhlI::lacZ promoter fusion in attB site of PSL317 (�algR) chromosome This study

E. coli strainsDH5� �80�lacZ�M15 �(lacZYA-argF)U169 recA1 endA1 hsdR17(rK

� mK�) phoA

supE44 �� thi-1 gyrA96 relA1Invitrogen

SM10 thi-1 thr leu tonA lacY supE recA::RP4-2-Tc::Mu 17

PlasmidspRK2013 tra functions 22Mini-CTX1 Self-proficient integration vector with tet, -FRT-attP-MCS, ori, int, and oriT 34CTXlacZ490 Mini-CTX1; promoterless lacZ cloned between HindIII and XhoI This studyCTXlacZ490ScaI Mini-CTX1lacZ with ScaI site inserted at 5 end of lacZ This studyCTXrhlA-lacZ Translational fusion containing �1864 to �9 of rhlA gene This studypFLP2 Source of Flp recombinase 33pVDZ’2R pVDZ’2 algR 44pVDtacPIL pVDtac39 fimTU pilVWXY1Y2E 44pCRrhlA pCR2.1 rhlA wild-type promoter (�850 to �1032) This studypCRrhlI pCR2.1 rhlI wild-type promoter (�19 to �196) This studypCRrhlARB1M pCR2.1 rhlA promoter containing CCGT to TTAC mutation in RB1 This studypCRrhlARB2M pCR2.1 rhlA promoter containing CCGT to TTAC mutation in RB2 This studypCRrhlARB1&2M pCR2.1 rhlA promoter containing CCGT to TTAC mutation in RB1 and RB2 This studypCRrhlIRB1M pCR2.1 rhlI promoter containing CCGT to TTAC mutation in RB1 This studypCVD442 ori RSK mob sacB Apr 19pCVDrhlImut pCVD442 rhlI promoter containing CCGT to TTAC mutation in RB1 This study

VOL. 189, 2007 AlgR REGULATES QUORUM SENSING IN P. AERUGINOSA BIOFILMS 7753


.org/D

ownloaded from

http://jb.asm.org/

5% polyacrylamide gel stained with SYBR green (Roche) to ensure completefragmentation and labeling. Samples were hybridized, washed, stained, andscanned as described in the Affymetrix GeneChip P. aeruginosa genome arrayexpression analysis protocol.

Microarray data analysis. The absolute expression transcript levels were nor-malized for each chip by globally scaling all probe sets to a target signal intensityof 500. Three statistical algorithms (detection, change call, and signal log ratio)were used to identify differential gene expression in experimental and controlsamples. The decision of a present, absent, or marginal identification for eachgene was determined by using MicroArray Suite software (version 5.0; Af-fymetrix). Those transcripts that received an “absent” designation were removedfrom further analysis. A t test was used to isolate those genes whose transcrip-tional profile was statistically significant (P � 0.05) between the control andexperimental conditions. Pair-wise comparisons between the individual experi-mental and control chips were done by batch analyses using MicroArray Suite togenerate a change call and signal log ratio for each transcript. A positive changewas defined as a call whereby more than 50% of the transcripts increased ormarginally increased for up-regulated genes or decreased or marginally de-creased for down-regulated genes. Lastly, the median value of the signal logratios for each comparison was calculated and only transcripts that had a valuegreater than or equal to 1 for up-regulated and less than or equal to 1 fordown-regulated genes were placed on the final list of transcripts whose profilehad changed. The signal-log ratio was converted and expressed as the change(n-fold).

Biofilm imaging. P. aeruginosa PAO1, PSL317, PSL317 (pVDtacPIL), PSL317(pVDZ’2R), and PAO1rhlImut were grown in a flowthrough biofilm as describedabove and imaged with the aid of an image chamber (Stovall, Inc.). An overnightculture of 3 ml of the individual strains grown in Pseudomonas minimal medium(see above) was inoculated into a flowthrough biofilm system with a flow rate ofapproximately 0.4 ml/min. The biofilms were grown for 1, 3, or 6 days in minimalmedium supplemented with 130 mg/liter of glutamate as a carbon source. Thebacteria were stained with LIVE/DEAD BacLight (Molecular Probes). Z-sectionimages were collected on a Zeiss Axioplan II microscope (step size, 0.1 to 0.2�m; magnification, �630) using Slidebook 4.0 as the imaging software (Intelli-gent Imaging Inc., Denver, CO). Postacquisition images were processed usingVolocity software (Improvision, Ltd., Lexington, MA). Quantitative analysis ofthe flow cell-grown biofilms was performed with the COMSTAT image analysissoftware package (31).

Ninety-six-well-plate biofilm assay. The 96-well biofilm assay was performedas previously described (23) with the following modifications. Briefly, biofilmformation was assayed by the ability of cells to adhere to the wells of 96-wellmicrotiter plates (Becton Dickinson Labware). Overnight cultures grown in the

minimal medium supplemented with glutamate (1.6 mM) used for the continu-ous-flow biofilm of PAO1, PSL317, PSL317 (pVDtacPIL), and PSL317(pVDZ’2R) were diluted 1:100 in fresh minimal medium and inoculated into the96-well plate. The plates were incubated at 25°C for 24 h to allow for biofilmformation. After 24 h, the plates were washed once in ddH2O and then a solutionof 1% crystal violet was added to stain the cells. The plates were set aside for 10min and washed three times to remove any residual crystal violet. A solution of33% acetic acid was added to each well to lyse the bacterial cells and solubilizethe crystal violet. The absorbance was determined at 580 nm in a �Quantmicrotiter plate reader (Biotek Instruments, Inc.). The assays were performed intriplicate with five technical replicates (wells) for each replicate.

Promoter fusion assays. A PCR product generated using oligonucleotidesrhlAF1 and rhlAR1 (Table 2) encompassing �1864 to �9 bp relative to thetranslational start of rhlA was amplified with SmaI and SacI restriction sites anddirectionally cloned into CTXscaI-lacZ to generate a translational fusion. Thefinal construct, CTXrhlA::lacZ, was sequenced before use in P. aeruginosa. Esch-erichia coli DH5� harboring the plasmid CTXrhlA::lacZ was used in triparentalconjugations with either PAO1, PSL317, or PSL317 (pVDZ’2R) and the helperstrain, DH5� pRK2013 (22). Conjugants were screened by PCR for each pro-moter and the plasmid backbone was removed by pFlp2-mediated excision (33).Integration at the attB site was confirmed by PCR using attB-specific primers andSouthern blotting. PAO1 containing the rhlI::lacZ chromosomal fusions wasgenerously provided by Daniel Hassett. The deletion of algR in PAO1 containingthe chromosomal fusion genes was performed as previously described (44) andconfirmed by Southern blotting.

-Galactosidase assays were performed as described by Miller (50), with slightmodification. All assays were performed on P. aeruginosa strains grown for 6 daysas continuous culture biofilms in the flow cell model or to stationary phase in P.putida minimal medium broth at room temperature at 250 rpm. After the indi-cated incubation period, bacteria were removed by scraping and resuspended in200 �l phosphate-buffered saline. An amount of 800 �l Z-buffer (60mMNa2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, and 50 mM -mercaptoethanol) was added, and the OD600 of each suspension was mea-sured. Amounts of 20 �l chloroform and 20 �l 0.1% sodium dodecyl sulfate wereadded to each tube and vortexed for 10 s. An amount of 200 �l of orthonitro-phenyl galactoside (4 mg/ml in H2O) was added, and the reaction was allowed toproceed for 1 to 3 min (determined empirically for each promoter). The reactionwas stopped by the addition of 250 �l 1 M NaHCO4. Samples were centrifugedto pellet the cells and chloroform, and the supernatant was measured at 420 nm.P. aeruginosa strains harboring a promoterless lacZ gene in the attB site wereused as negative controls in every experiment to determine background -galac-tosidase activity.

TABLE 2. Oligonucleotides used in this study

Usea Name Oligonucleotide sequence (5 to 3) Gene Location (strand)

EMSA rhlAgsF CACGTCGTAGCCGTAGCTGGACAC rhlA �873 to �850 (�)EMSA rhlAgsR GATTCGCGATCATTTTTCGCAGCT rhlA �1032 to �1008 (�)EMSA rhlIgsF GCTGGGTCTCATCTGAAGCGCAGG rhlI �196 to �172 (�)EMSA rhlIgsR ATGACCAAGTCCCCGTGTCGTGCC rhlI �19 to �2 (�)EMSA algDgsF ACGGCTATTACTTCAGCGCCGAGC algD �976 to �952 (�)EMSA algDgsR TGAGTAGGCCTATTCGCCACAAGG algD �763 to �787 (�)SDM of RB1 and RB2 rhlaNBFor CTGGCGCTCGACGAGTAACTCGATCATGTTACGCTCCTGAGCCAT rhlA �912 to �955 (�)SDM of RB1 and RB2 rhlaNBRev ATGGCTCAGGAGCGTAACATGATCGAGTTACTCGTCGAGCGCCAG rhlA �955 to �912 (�)SDM rhlINBFor GGCAGGTTGCCTGTTACTCATCCTCCTTTAGTC rhlI �143 to �110 (�)SDM rhlINBRev GACTAAAGGAGGATGAGTAACAGGCAACCTGCC rhlI �110 to �143 (�)PAO1rhlImut rhlImutP5 TTTAGTACTGATCATGACCAAGTCCCCGTGT rhlI �634 to �610 (�)PAO1rhlImut rhlImutP4 TTTTCTAGATAGCGCGAAAGCTCCCAGACC rhlI �390 to �500 (�)PAO1rhlImut rhlImutP3 AGATCTGGCAGGTTGCCTGTTACTCATb rhlI �149 to �122 (�)PAO1rhlImut rhlImutP2 GTAACAGGCAACCTGCCAGATCTGGTb rhlI �126 to �151 (�)PAO1rhlImut rhlImutP1 TTTGAGCTCGGAAATGGTCTGGAGCGACAG rhlI �634 to �610 (�)Plasmid CTXrhlA::lacZ rhlAF1 CCCGGGGCGCCGCATTTCACACCTCCc rhlA �9 to �11 (�)Plasmid CTXrhlA::lacZ rhlAR1 GAGCTCAAGGGCGGCGTCGGCAAGTCd rhlA �1864 to �1844 (�)Plasmid CTXlacZ490 lacZhinD CCCAAGCTTCTTTATCACACAGGAAACAGCTATGACe lacZPlasmid CTXlacZ490 CTXXho CCCCTCGAGGTTGCACCACAGATGAAf lacZPlasmid CTXlacZ490ScaI lacZScaF’ GCTATGACCATGATTAGTACTGATTCACTGGCCGTCg lacZPlasmid CTXlacZ490ScaI lacZScaR’ GACGGCCAGTGAATCAGTACTAATCATGGTCATAGCg lacZ

a EMSA, electrophoretic mobility shift assay; SDM, site-directed mutagenesis; PAO1rhlImut, PAO1rhlImut strain construction; plasmid, complementation or fusionconstruction.

b Underlined bases changed to alter AlgR binding site in rhlI promoter.c SmaI restriction site underlined.d XbaI restriction site underlined.e HindIII restriction site underlined.f XhoI restriction site underlined.g ScaI restriction site underlined.

7754 MORICI ET AL. J. BACTERIOL.


.org/D

ownloaded from

http://jb.asm.org/

Autoinducer quantitation. The concentrations of N-3-oxododecanoyl-L-homo-serine lactone (3-oxo-C12-HSL) and N-butyryl homoserine lactone (C4-HSL)were assayed in each sample in triplicate using previously described bioassays(60, 64).

Rhamnolipid quantitation. The concentrations of rhamnolipids in the efflu-ents of biofilm-grown or supernatants of broth-cultured P. aeruginosa PAO1,PSL317 (�algR), or PSL317 harboring pVDZ’2R were determined by the orcinolmethod (78). Briefly, 500 �l of three independently grown biofilm or brothcultures was extracted twice with 1 ml of diethyl ether. The ether fractions werepooled and evaporated to dryness. One milliliter of a 0.19% orcinol (in 53%H2SO4) solution was added to each sample. The samples were heated to 80°C for30 min and cooled at room temperature for 15 min, and the absorption wasmeasured at 421 nm by UV spectrophotometer. The concentration of rhamno-lipids was calculated by comparing the data with 0 to 50 �g/ml rhamnose stan-dards. Standards, blanks, and unknowns were analyzed in triplicate from threeindependent experiments.

AlgR gel mobility shift assay. The binding of AlgR to the rhlA and rhlIpromoter regions was examined by using recombinant AlgR, expressed as pre-viously described (51). A 175-bp DNA fragment of the rhlA promoter (�847 to�1022 in relation to the translational start site) was excised from pCRrhlA byusing EcoRI and gel purified. A 174-bp DNA fragment of the rhlI promoter (�19to �196 in relation to the translational start site) was excised from pCRrhlI byusing EcoRI and gel purified. The RB1 promoter fragment of algD (52) wasutilized as a positive control. The fragments were end labeled with [�-32P]ATP(6,000 Ci/mmol; NEN Dupont) using T4 polynucleotide kinase (Invitrogen,Carlsbad, CA). The probes were purified by being passed through a G-25 Seph-adex microspin column (Amersham Pharmacia Biotech, Inc., Piscataway, NJ).Binding reactions were carried out as described previously, with some modifica-tions (51). Briefly, the probes were mixed with 200 pmol of purified AlgRcontaining 25 mM Tris-HCl (pH 8.0), 0.5 mM dithiothreitol, 20 mM KCl, 0.5 mMEDTA, 5% glycerol, 10 �g salmon sperm DNA, and an additional 0.25 �g ofpoly(dI-dC) per ml as nonspecific competitor DNA. Competition assays wereperformed by the addition of 1, 5, and 10 �g of unlabeled rhlA or rhlI fragmentsor 10 �g of poly(dI-dC) to determine the specificity of AlgR. In addition,mutagenesis of the AlgR consensus sequence (CCGTTCGTCC) in rhlA RB1(�920 to �939 relative to the translational start), rhlA RB2 (�936 to �955), andrhlI RB1 (�134 to �115) was performed according to Mohr et al. (52) using aQuikChange II mutagenesis system (Stratagene) and oligonucleotides rhlaNBForand rhlaNBRev (Table 2) for rhlA and rhlINBFor and rhlINBRev (Table 2) forrhlI to generate plasmids pCRrhlARB1M, pCRrhlARB2M, pCRrhlARB1&2M,and pCRrhlIRB1M (Table 1). The mutation of the rhlA AlgR consensus se-quence CCGTTCGTCC to TTACTCGTCC was confirmed by DNA sequencingof the gel shift fragments. After incubation for 10 min at room temperature, thesamples were separated by electrophoresis on a 5% native polyacrylamide gelwith Sharp’s buffer (6.7 mM Tris-HCl [pH 8.0], 3.3 mM sodium acetate, 1.0 mMEDTA) used as running buffer for approximately 1.5 h at 30 mA. Subsequently,the gel was dried and bands were visualized by autoradiography.

Mutagenesis of the rhlI promoter. The construct for mutation of the rhlIchromosomal AlgR binding site was constructed in vitro by crossover PCR (32).Two initial PCRs were performed, the first using forward primer RP1 andreverse primer RP2 and the second using forward primer RP3 and reverseprimer RP4 (Table 2). The products of these reactions have complementarysequences (the 5 end of primer RP2 is complementary to primer RP3) andcontain the desired mutation TTAC. These products were used as the templatefor a subsequent crossover PCR using primers RP1 and RP4. This resultingproduct was digested with SacI and XbaI and cloned directionally into the suicidevector pCVD442 (19) to create plasmid pCVD442rhlImut. The plasmidpCVD442rhlImut was introduced into PAO1 by triparental conjugation. Singlerecombinants were selected by screening for carbenicillin resistance. The allelicexchange (second) recombination event was induced by selection for sucroseresistance. Several clones were selected for DNA sequencing to confirm thedesired mutation.

Statistical analyses. Statistics on the lacZ reporter assays, autoinducer quan-titations, rhamnolipid determinations, and elastolytic assays were performedwith one-way analysis of variance (ANOVA) with Tukey’s correction. Statisticson biofilm key variables were done with COMSTAT (31).

RESULTS

Biofilm maturation is dependent on AlgR. Previous workindicated that an algR mutant was deficient in biofilm forma-tion in a static biofilm model up to the 8-h time point (83). Inorder to further examine this phenotype, wild-type PAO1 andits isogenic algR deletion strain PSL317 (Table 1) were grownfor 6 days in a continuous-flow system and the biofilm devel-opment was imaged at days 1, 3, and 6. In the flow chamberbiofilm system, P. aeruginosa was grown under hydrodynamicconditions with a continuous nutrient supply and glutamate asthe carbon source (31, 38, 83). As shown in Fig. 1A and B,wild-type PAO1 and the algR mutant strain (PSL317) formedsimilar biofilms after 24 h of culture. However, by day 3, thePSL317 biofilm was greatly reduced in biomass and thicknesscompared to those of wild-type PAO1 (Fig. 1C, D, E, and F) asmeasured by COMSTAT (Table 3). By day 6, PAO1 formedthe characteristic column-like macrocolonies surrounded byfluid-filled channels (Fig. 2A and B). In contrast, the algRmutant contained sparsely distributed microcolonies (Fig. 2Cand D). Furthermore, day 3 and day 6 �algR biofilms weresignificantly decreased in total biomass (P � 0.001), average

FIG. 1. Effects of algR deletion on 1- and 3-day continuous-flowbiofilms. Three-dimensional reconstructions of Z-section images takenat 1 day (A and B) or 3 days (C to F). PAO1 and PSL317 (�algR) weregrown in an imaging flow chamber as continuous-culture biofilms.Postacquisition deconvolution and three-dimensional rendering wereperformed with Volocity (Improvision, Lexington, MA). XY, top view(A to D); XZ, side view (E to F); magnification, �630. The biofilmswere stained with LIVE/DEAD BacLight (Molecular Probes) for vi-sualization.

TABLE 3. COMSTAT analyses of P. aeruginosa strains grown ascontinuous-flow biofilmsa

Strain andno. of daysof growth

Totalbiomass

(�m3/�m2)

Averagethickness

(�m)

Maximumthickness

(�m)

Coefficient ofroughness

PAO13 11.74 � 0.92 12.18 � 1.1 14.9 � 0.86 0.31 � 0.036 15.35 � 1.76 15.08 � 1.96 28.20 � 1.75 0.70 � 0.12

PSL3173 5.32 � 0.99b 6.28 � 1.01b 10.9 � 0.95 0.78 � 0.03b

6 4.44 � 1.01b 6.43 � 1.06b 11.39 � 1.05b 0.67 � 0.05

PSL317 pil6 4.24 � 0.58b 5.44 � 1.51b 10.62 � 1.67b 0.95 � 0.15

PSL317 algR6 14.41 � 1.69 14.93 � 1.70 24.08 � 3.62 0.74 � 0.04

PAO1rhlImut6 1.50 � 0.11b 1.60 � 0.24b 9.0 � 0.86b 1.40 � 0.18b

a All values are means � standard deviations.b P � 0.001; one-way ANOVA with Tukey-Kramer posttest.



.org/D

ownloaded from

http://jb.asm.org/

thickness (P � 0.001), and maximum thickness (P � 0.001; day6 only) compared to those of PAO1 biofilms as determined byCOMSTAT analysis (Table 3).

It has been previously demonstrated that algR mutants aredefective in type IV pilus-mediated twitching motility (82, 83)and that AlgR activates twitching motility via the fimTU-pilVWXY1Y2E operon (44). In order to determine if the defectin twitching motility in the algR mutant could account for thedefects observed in biofilm formation, we complementedPSL317 in trans with the fimTU-pilVWXY1Y2E operon whichrestored twitching motility (44). It has also been shown thattwitching and flagellar motility are required for swarming mo-tility (39) and proper biofilm formation (73). The �algR mu-tant is defective for swarming motility, and complementationwith the plasmid pVDtacPIL harboring the fimTU andpilVWXY1Y2E genes restored normal swarming activity (Table4). However, complementation with pVDtacPIL did not re-store the �algR static or flowthrough biofilms to the wild-typephenotype (Fig. 2E and F and 3; Table 3), whereas com-plementation with algR did (Fig. 2G and H and 3A and B;Table 3). It has also been shown that biofilm phenotypes are af-fected by the composition of nutrients used to grow the biofilm (38,58, 73). However, at least for the static biofilm assay, the samephenotype for the algR biofilm was observed in LB as in minimalmedium with glutamate (Fig. 3B). This suggests that AlgR controlsgenes in addition to those involved in twitching motility and alginate

production which may be responsible for the defects in biofilm for-mation in algR-deficient strains.

Transcriptional profile of the AlgR regulon during contin-uous culture biofilm growth. In order to determine whichAlgR-dependent genes were responsible for the defective bio-film phenotype observed, global transcriptional analyses wereperformed on wild-type (PAO1) and algR deletion (PSL317)strains in the day 6 biofilms. Microarray analysis of PAO1 andPSL317 grown as continuous culture biofilms identified 765genes that were differentially regulated by at least twofold andwhose differences were statistically significant (P � 0.05; seethe supplemental material). The most highly up-regulatedgenes in the �algR biofilm were classified as phage/transposongenes (42 genes), putative enzymes (33 genes), and secretedfactors (24 genes). In contrast, genes involved in motility andattachment (18 genes) and transcriptional regulation (36genes) were largely down-regulated (Fig. 4). Interestingly, ofthe 76 genes represented in the quorum-sensing regulon by

FIG. 2. Effects of algR deletion on 6-day continuous-flow biofilm. Three-dimensional reconstructions of Z-section images taken at 6 days.PAO1, PSL317, PSL317 (pVDtacPIL), and PSL317 (pVDZ’2R) were grown in an imaging flow chamber as continuous-culture biofilms.Postacquisition deconvolution and three-dimensional rendering were performed with Volocity (Improvision, Lexington, MA). The biofilms werestained as described in the Fig. 1 legend. (A, C, E, and G) Side view. (B, D, F, and H) Top view. Magnification, �630. pVDtacPIL, plasmidpVDtac39 containing the genes fimTU and pilVWXY1Y2E; pVDZ’2R, plasmid pVDZ’2 with algR.

FIG. 3. Effects of algR deletion on static biofilm formation. Staticbiofilm assay in minimal medium supplemented with 1.6 mM gluta-mate (A) or LB (B) of PAO1, PSL317, PSL317 (pVDtacPIL), PSL317(pVDZ’2R), and PAO1 mutrhlI cultured for 24 h. The assays wereperformed in triplicate with five technical replicates (wells) for eachreplicate. *, P � 0.001 (one-way ANOVA with Tukey’s correction).Error bars show the standard errors of the means.

TABLE 4. Swarming motility assays on various carbon sources

StrainZone of migration ona:

Glucose Glutamate Succinate

PAO1 3.8 � 0.03 3.5 � 0.2 3.4 � 0.1PSL317(�algR) 1.0 � 0.1b 0.9 � 0.03b 0.9 � 0.0b

PSL317 pVDtacPIL 3.4 � 0.1 2.4 � 0.1 2.3 � 0.1PSL317 pVDZ’2R 3.7 � 0.1 3.1 � 0.4 3.7 � 0.1PAO1rhlImut 2.5 � 0.3 2.5 � 0.3 2.4 � 0.1

a The concentration of the carbon source in the swarming plates was 1.6 mM.b P � 0.05 compared to the results for PAO1; one-way ANOVA with Tukey-

Kramer posttest.



.org/D

ownloaded from

http://jb.asm.org/

three independent studies (30, 72, 81), 44 (58%) were regu-lated by AlgR during biofilm growth (Fig. 5 and Table 5).Moreover, with the exception of three genes, the quorum-sensing genes identified in the �algR biofilm transcriptionalprofile were not present in three separate AlgR-profiling ex-periments that utilized planktonic growth conditions (44), sug-gesting that AlgR regulation of these quorum-sensing genesmay be biofilm specific (Fig. 5). Most of the genes belonging tothe AlgR and quorum-sensing regulons remain to be charac-terized, while 23 of the genes have been well described (Table5)—for example, the two most highly regulated quorum-sens-ing genes identified, rhlA and rhlB, which were up-regulated111- and 79-fold, respectively, in the algR deletion strain andare tightly regulated by the RhlR-RhlI tandem (55). The LasR-LasI-dependent genes lasA and lasB (80) were also signifi-cantly elevated in PSL317 (4- and 10-fold, respectively). Inaddition, the HCN synthesis genes hcnABC (65) were signifi-cantly upregulated (three-, seven-, and fourfold, respectively)in the �algR strain. rsaL, the negative regulator of lasI (15),was significantly down-regulated, by fivefold, in the algR dele-tion mutant (Table 5). The vast number of quorum-sensinggenes that were differentially regulated in the �algR biofilm, butnot in algR mutants grown planktonically, indicated that AlgRmay regulate quorum sensing in a biofilm-specific manner.

Quorum sensing is regulated by AlgR. Table 5 lists 44 genesidentified in the array analysis that also belong to the quorum-sensing regulon according to three independent analyses (30,72, 81). Of the 23 genes that are well characterized, three genes(pqsA, rsaL, and phzB) and two operons (hcnABC and rhlAB)contain putative AlgR binding sites in their promoter regions.Interestingly, the genes involved in rhamnolipid biosynthesis(rhlA and rhlB) demonstrated the highest severalfold changesin the transcriptome analysis (111- and 79-fold, respectively).Several studies have demonstrated that the levels of rhamno-

lipids can influence biofilm architecture and composition (3,10, 36). Therefore, it was hypothesized that AlgR repression ofrhlAB may be required for normal biofilm development in thecontinuous-culture model. In order to confirm the array data,an rhlA::lacZ translational fusion was constructed and inte-grated as a single copy on the chromosome of the �algR andwild-type strains. No difference in -galactosidase activity wasobserved when PAO1 and PSL317 were grown in minimalmedium broth (Fig. 6A). However, rhlA expression was signif-icantly increased in PSL317 compared to its expression inPAO1 when the strains were cultured for 6 days in continuousculture biofilms (P � 0.05) (Fig. 6A). Both LasR-3-oxo-C12-HSL and RhlR-C4-HSL can regulate rhlAB expression. There-fore, the ability of AlgR to regulate either of these regulatorygenes was also explored. Although rhlI was not identified in thetranscriptome analysis, its promoter region contains a perfectAlgR consensus sequence located at �133 to �117 relative tothe translational start site (Fig. 7E). Therefore, the expressionof a rhlI::lacZ transcriptional fusion (as well as lasI::lacZ ex-pression, for comparison) in PAO1 and PSL317 was examinedto determine the effect of AlgR on the autoinducer synthases.The expression of rhlI in PSL317 was significantly increased(P � 0.01) under biofilm growth conditions but not in broth(Fig. 6B). In contrast, no difference between PAO1 andPSL317 in lasI transcription was observed when grown as abiofilm or planktonically (data not shown). These data suggestthat AlgR represses Rhl but not Las quorum sensing in abiofilm-specific manner.

Production of C4-HSL is repressed by AlgR in a biofilm. Inorder to confirm the results of the lacZ promoter fusion ex-pression studies, the levels of C4-HSL and 3-oxo-C12-HSL pro-duced by PAO1 and PSL317 grown in aerobically shaken min-imal medium broth and in continuous-flow biofilms werecompared. The amount of C4-HSL was increased nearly five-

FIG. 4. Functional classification analysis of P. aeruginosa PSL317 versus PAO1 biofilm Affymetrix transcriptional profiling. Functional classi-fication was performed on genes that had twofold or higher expression in the PSL317 (�algR) than PAO1 continuous-flow biofilm culture grownfor 6 days. All genes that had a significant difference in expression (P � 0.05, as determined by one-way ANOVA) were included. Functional classeswere determined using the Pseudomonas Genome Project website (www.pseudomonas.com).



.org/D

ownloaded from

http://jb.asm.org/

fold (P � 0.01) in PSL317 compared to the amount in PAO1in 6-day biofilm effluents (Fig. 6D). These differences were lessapparent in planktonically grown P. aeruginosa. PSL317 pro-duced approximately twofold more C4-HSL (P � 0.05) thanPAO1 in minimal medium broth. No significant difference in3-oxo-C12-HSL levels was observed between strains PAO1 andPSL317 during biofilm or planktonic growth (data not shown).These results indicate that AlgR represses the production ofthe Rhl autoinducer C4-HSL, but not 3-oxo-C12-HSL, duringbiofilm growth.

Rhamnolipid production was repressed by AlgR in a bio-film. Since rhlA and rhlB were the most significantly increasedquorum-sensing genes in �algR biofilms, the concentrations ofrhamnolipids in day 6 biofilm effluents and in supernatants ofbroth-grown P. aeruginosa were measured. Rhamnolipid con-

centrations were significantly higher (P � 0.001) in PSL317than in PAO1 when grown as biofilms. In contrast, no differ-ences in rhamnolipid production were observed when PAO1and PSL317 were cultured in minimal medium broth (Fig. 6C).These results were in agreement with the elevated levels ofC4-HSL observed in �algR biofilms and indicate that AlgR

FIG. 5. AlgR regulates quorum-sensing (QS) genes in a biofilm.Venn diagram of differentially expressed (at least twofold; P � 0.05)genes in an �algR (PSL317; lightest gray) biofilm. The transcriptomesof three previous quorum-sensing analyses (30, 72, 81) contained 76genes in common. The PSL317 biofilm global transcriptional analysesshowed that 44 of these genes were within the AlgR regulon. Previousanalyses of the AlgR regulon using planktonic growth conditions iden-tified only two QS genes when PSL317 was grown to mid-log phase(A), one QS gene when grown to stationary phase (B), and two QSgenes when AlgR was overexpressed (C) (44).

TABLE 5. Quorum-sensing genes regulated during biofilmgrowth by AlgR

PseudomonasGenome Database

accession no.Gene Planktonic fold change

(relevant condition)aBiofilm fold

changeb

PA0122 NC 11PA0997 pqsB NC 3PA0998 pqsC NC 5PA0999 pqsD NC 4PA1130 rhlC NC 7PA1131 NC 7PA1246 aprD NC 2PA1431 rsaL 2 (SP), 5 (OE) �5PA1657 3 (ML) 5PA1871 lasA NC 4PA1901 phzC2 NC 19

PA1902 phzD2 NC 26PA1903 phzE2 NC 22PA1904 phzF2 NC 20PA1905 phzG2 NC 13PA2068 NC 19PA2069 NC 27PA2193 hcnA NC 3PA2194 hcnB �3 (ML) 7PA2195 hcnC NC 4PA2300 chiC NC 6PA2302 NC 4

PA2303 NC 3PA2564 NC 2PA2570 pa1L NC 19PA3326 NC 3PA3328 NC 19PA3329 NC 16PA3330 NC 17PA3331 NC 14PA3332 NC 23PA3333 fabH2 NC 26PA3334 NC 17

PA3335 NC 24PA3361 lecB NC 13PA3478 rhlB NC 79PA3479 rhlA NC 111PA3724 lasB �3 (OE) 10PA4129 NC 2PA4133 NC 3PA4134 NC 3PA4141 NC 4PA4175 prpL NC 2PA5220 NC 4

a NC, no change in gene expression. Change (n-fold) was determined bycomparing the transcription of the algR deletion strain PSL317 to that of wild-type PAO1 during planktonic growth to either mid-logarithmic phase (ML;OD600 � 0.4) or stationary phase (SP; OD600 � 0.6) or by comparing PAO1overexpressing (OE) AlgR from the plasmid pCMR7 to wild-type PAO1 grownto mid-log phase (OD600 � 0.4) (Lizewski et al. �44�).

b Change (n-fold) was determined by comparing the transcription of the algRdeletion strain PSL317 to that of wild-type PAO1 during continuous culturebiofilm growth for 6 days (this study).



.org/D

ownloaded from

http://jb.asm.org/

represses the Rhl quorum-sensing cascade in continuous-cul-ture biofilms.

The gene encoding elastase, lasB, was also upregulated (10-fold) in the �algR mutant in a biofilm. This suggested thatAlgR either directly or indirectly (i.e., via Rhl) regulated elas-tase production. Therefore, the amounts of elastolytic activityin effluents from PAO1 and PSL317 continuous-culture bio-films were measured after 6 days of growth. Elastolytic activitywas twofold higher in the �algR mutant (P � 0.001; data notshown). The elastolytic activity was also tested in the superna-tants of PAO1 and PSL317 grown in minimal medium brothovernight. Supernatants from planktonic PSL317 had 1.5-fold-higher elastolytic activity than the wild-type or complementedstrains, but the differences were less significant than those frombiofilms (P � 0.01; data not shown). These results suggest thatAlgR represses lasB gene transcription and downstream elas-tase production, possibly via its repression of the Rhl quorum-sensing circuit (62).

AlgR binds to the rhlA and rhlI promoters. Since rhlA andrhlI transcription was repressed by AlgR in the biofilms, thepromoter regions of each gene were examined for putativeAlgR binding sites. The rhlI promoter region contains a nearlyperfect AlgR recognition sequence located at �129 to �120relative to the translational start site (Fig. 7E). The rhlA pro-moter region contains two putative overlapping AlgR binding

sites, RB1 located at �925 to �934 and RB2 at �940 to �949relative to the translational start. Therefore, the ability of AlgRto bind each of these sites in an in vitro gel mobility shift assaywas tested. As shown in Fig. 7A and B, specific complexes wereformed when AlgR was added to the radioactive rhlA and rhlIDNA fragments. The addition of nonradioactive specific com-petitor reduced the amount of probe shifted by AlgR in adose-dependent manner (Fig. 7A and B; lanes 2 to 4), indicat-ing the specificity of AlgR for both the rhlA and rhlI promoterregion. Furthermore, mutation of the AlgR consensus se-quence of conserved nucleotides CCGT (52) to TTAC withinthe rhlI promoter completely abolished AlgR binding (Fig.7D). When the same site-directed mutagenesis was performedon the two putative AlgR binding sites in the rhlA promoter,mutation of RB1 but not RB2 resulted in a loss of mobilityshift (Fig. 7C). These results provide in vitro evidence thatAlgR binds specifically to the rhlI and rhlA promoters and lendsupport to the hypothesis that AlgR directly controls rhlA andrhlI expression.

Mutation of the rhlI promoter AlgR binding site on thePAO1 chromosome inhibits biofilm formation. In order todetermine if AlgR repression of the Rhl quorum-sensing sys-tem was required for normal biofilm development under theconditions examined, the AlgR binding site within the rhlIpromoter was mutated in vitro and allelic exchange was used

FIG. 6. AlgR represses Rhl quorum sensing in a biofilm. -Galactosidase assay of rhlA-lacZ (A) and rhlI-lacZ (B) single-copy chromosomalpromoter fusions in PAO1, PSL317, and PSL317 (pVDZ’2R) cultured in broth or as biofilms. Measurement of rhamnolipids (C) and autoinducerC4-HSL (D) in biofilm effluent and broth supernatants of PAO1, PSL317, and PSL317 (pVDZ’2R). The assays were all performed in triplicate.*, P � 0.05; **, P � 0.01; ***, P � 0.001 (one-way ANOVA with Tukey’s correction). Error bars show the standard errors of the means.



.org/D

ownloaded from

http://jb.asm.org/

to place it on the chromosome of PAO1. Mutation of thewild-type sequence CCGT to TTCA was confirmed by DNAsequencing. Gel mobility shift assays confirmed that AlgRdid not bind this mutated sequence (Fig. 7D), and therefore,AlgR repression of rhlI should be abolished in the mutatedstrain. When PAO1 containing the mutated rhlI promoter(PAO1rhlImut) was grown for 6 days as a continuous-cul-ture biofilm, the resulting phenotype was similar to that ofthe algR mutant strain. PAO1rhlImut biofilms were signifi-cantly reduced in total biomass, average thickness, and max-imum thickness and were significantly rougher than wild-type biofilms (Fig. 8 and Table 3). In addition, this strainproduced elevated amounts of rhamnolipids compared tothe levels in PAO1, similar to the algR mutant (Fig. 6C).These results demonstrate that AlgR regulation of rhlI isdirect and confirm that AlgR repression of the Rhl quorum-sensing circuit during biofilm growth is essential for properbiofilm maturation.

DISCUSSION

In this report, evidence is presented demonstrating that theP. aeruginosa virulence regulator AlgR controls biofilm matu-ration by repressing the Rhl quorum-sensing system in P.aeruginosa PAO1. An indication that AlgR may be required for

biofilm initiation in the static biofilm model was previouslydemonstrated when an algR mutant formed one-third the bio-mass of wild-type P. aeruginosa after 8 h of static culture (83).In contrast to the reported observations in the 8-h static bio-

FIG. 7. AlgR binds to the rhlA and the rhlI promoters. (A and B) Gel mobility shift assays with 200 pmol of recombinant AlgR incubated with labeledrhlA (A) and rhlI (B) promoter fragments containing putative AlgR binding sites (sequences shown in panel E). �, probe alone; �, probe plus AlgR.Lane 1, 10 �g nonspecific competitor; lanes 2 to 4, 1, 5, and 10 �g specific competitor; lane 5, cell extract of empty vector. (C and D) Gel mobility shiftassay of rhlA wild-type (RB1&2) and rhlA mutant promoter fragments (RB1M, RB2M, and RB1&2M) (C) and rhlI wild-type (RB1) and rhlI mutant(RB1M) (D) promoter fragments. Lane 1, probe alone; lane 2, 200 pmol of purified AlgR; lane 3, 200 pmol of empty vector extract. (E) Alignment ofthe AlgR binding sites within the algD, algC, hcnA, rhlA, and rhlI promoters. Numbering is from the translational start of each gene.

FIG. 8. Effect of mutation of the AlgR binding site in the rhlIpromoter of PAO1. Three-dimensional reconstructions of Z-sectionimages taken at 6 days. PAO1 and PAO1rhlImut were grown in animaging flow chamber as continuous-culture biofilms. Postacquisitiondeconvolution and three-dimensional rendering were performed wthVolocity (Improvision, Lexington, MA). (A and C) Top view. (B andD) Side view. Magnification, �630. The biofilms were stained as de-scribed in the Fig. 1 legend.



.org/D

ownloaded from

http://jb.asm.org/

film system (83), we report that the P. aeruginosa algR deletionmutant displayed adherence and initial colonization of theflowthrough cell similar to that of the wild type up to 24 h,but abnormal biofilm formation was observed after 3 days ofculture.

Possible explanations for the altered biofilm phenotype ob-served for the algR mutant include a twitching motility defect,altered swarming motility, and increased rhamnolipid secre-tion. Type IV pilus-mediated twitching plays a role in biofilmdevelopment by enabling P. aeruginosa microcolonies to spreadover the substratum (38, 59). Mutants that were defective intwitching motility were not impaired in the early stages ofbiofilm development but eventually formed biofilms distin-guishable from those of wild-type organisms in a flow chambersystem like the one used in this study (31, 38, 59). AlgR con-trols twitching motility, and this control is likely dependentupon phosphorylation (82, 83). In addition, the expression ofthe fimTU-pilVWXY1Y2E operon alone can complement thealgR twitching motility defect, strongly indicating that AlgRcontrols this operon and that lack of its expression results inloss of twitching motility (1, 44). Under the conditions tested,the biofilm formed by the algR deletion strain displayed one-third less biomass and an inability to form the columnar architec-ture typical of mature wild-type biofilms (11). When twitchingmotility was restored by the introduction of the fimTU-pilVWXY1Y2E operon in trans, normal biofilm maturation wasnot restored after 6 days of culture. Therefore, twitching mo-tility likely did not play a significant role in the biofilm defectobserved for the algR mutant. It has also been shown thatquorum sensing affects biofilm formation in a nutritionallydependent fashion through swarming motility (73). Since thealgR biofilm phenotype was not dependent upon nutrition, asrich and minimal medium biofilms resulted in the same phe-notype (Fig. 3), and complementation of swarming motilitywith the fimTU-pilVWXY1Y2E operon (Table 4) did not com-plement the algR biofilm defect (Fig. 2E and F), the deletion ofalgR increased rhamnolipid production (Fig. 6C) which re-sulted in the altered biofilm phenotype observed.

Microarray analyses were utilized to determine which AlgR-controlled genes did affect biofilm formation, and a large num-ber of known quorum-sensing genes were identified. Basedupon these results, the possibility that coordinate regulation ofquorum-sensing circuits and the AlgR regulatory network isnecessary for successful biofilm development was explored.Interestingly, one previous report has indicated that there maybe a connection between AlgR and the Rhl quorum-sensingsystem, when the culturing of an rhlI mutant resulted in com-pensatory mutations in algR (2). P. aeruginosa currently hasthree identified types of quorum-sensing systems: (i) the Lassystem which produces 3-oxo-C12-HSL (60); (ii) the Rhl systemwhich produces C4-HSL (61); and (iii) the PQS system whichproduces 2-heptyl-3-hydroxy-4-quinolone (63). Disruption oralteration of the quorum-sensing regulatory cascade in P.aeruginosa has been shown to interfere with normal biofilmarchitecture and development (10, 14, 36). However, othershave reported no difference between wild-type biofilms andbiofilms defective in the Las quorum-sensing system (31, 77).These inconsistencies may be attributed to differences in P.aeruginosa strains and culture conditions. One recent reportindicates that the expression of the Las and Rhl quorum-

sensing systems is clearly dependent upon growth conditions(21). The Rhl quorum-sensing system has also been studiedextensively in biofilms (10, 42). Rhamnolipid surfactants underthe control of the Rhl quorum-sensing system are essential forproper maintenance of water channels and biofilm architecture(10), and there is evidence that rhamnolipid expression occursafter stalks have formed but before the capping in of themushroom-like structures (42).

The ability of AlgR to directly regulate Rhl quorum sensingmost likely explains the biological properties of the �algRstrain during biofilm growth. Such dysregulation of quorumsensing could also explain the attenuated phenotypes of bothalgR deletion and AlgR overexpression strains during murineinfection (43), as disruption of all three quorum-sensing sys-tems has resulted in loss of virulence (6, 16, 26). Interestingly,the overall atypical characteristics of �algR biofilms resembledthose of P. aeruginosa biofilms overexpressing rhamnolipids(10). AlgR regulation of rhamnolipid production has beenpreviously suggested by the involvement of AlgC in rhamno-lipid synthesis (57). The product of the algC gene, which isinvolved in alginate production through its phosphomanno-mutase activity (86, 87) and in lipopolysaccharide synthesisthrough its phosphoglucomutase activity (9), also participatesin rhamnolipid production (57). In addition, the overproduc-tion of rhamnolipids by P. aeruginosa, as observed in �algRbiofilms, inhibits the maintenance of the biofilm infrastructure(10). Furthermore, the addition of exogenous rhamnolipids toestablished P. aeruginosa and Burkholderia biofilms causes de-tachment and dispersion of bacteria from the biofilm (3, 36).Thus, numerous investigators have established that excess lev-els of rhamnolipids interfere with normal biofilm architecture.The inability of AlgR to repress rhlAB transcription or theupstream positive regulator rhlI can account for the increasedlevels of rhamnolipids observed in �algR biofilms. Moreover,the mutation of the chromosomal rhlI promoter AlgR bindingsite in strain PAO1rhlImut resulted in elevated rhamnolipidproduction and a biofilm phenotype identical to that of thealgR deletion strain. Taken together, these results stronglysupport the notion that dysregulation of the Rhl quorum-sensing system by deletion of algR leads to overproduction ofrhamnolipids and the altered biofilm phenotype. These studiesalso suggest that the signal to which AlgR responds in vivo maybe involved in the dispersion of the biofilm. It is relatively easyto imagine that some physiologically relevant molecule bindsto AlgR or AlgZ and causes the derepression of rhlI, resultingin increased rhamnolipid production and, hence, dispersion ofthe biofilm.

The regulatory mechanisms of AlgR are complex in thatboth phosphorylation-dependent and -independent mecha-nisms of activation have been demonstrated (45, 83). When thepredicted phosphorylated residue of AlgR, aspartate 54, wasmutated to asparagine, alginate production was still activated(45). However, the same mutation abolished AlgR activationof twitching motility (83). Furthermore, AlgR can switch froma repressor of HCN production in the nonmucoid backgroundto an activator of HCN production in mucoid strains (7). In thecurrent study, it appears that AlgR only controls the Rhl quo-rum-sensing system when it is attached in a biofilm, furthercomplicating the sensory input required for AlgR regulation. Asimilar contact dependence has been reported for another



.org/D

ownloaded from

http://jb.asm.org/

AlgR-controlled gene, algC, when Davies and Geesey (13)showed that bacterial attachment induces the transcription ofspecific genes, including algC. This would imply that attach-ment to a surface may provide a signal to the bacterium tostimulate the AlgR regulon. The signaling requirements forAlgR activation and repression of target genes such as thoseinvolved in alginate production, HCN production, and twitch-ing motility may parallel changes in the bacterium’s environ-mental state.

In addition to rhlAB and rhlI, a significant number of tran-scripts that encode secreted factors also appear to be repressedby AlgR in nonmucoid PAO1 biofilms (Fig. 4). In earlier work,17 proteins uniquely expressed in an algR mutant were iden-tified by two-dimensional sodium dodecyl sulfate-polyacryl-amide gel electrophoresis (43). Furthermore, AlgR represseshcnA in nonmucoid P. aeruginosa and activates its expressionin mucoid strains (7). Taken together, these findings furthersupport the idea that AlgR plays a previously unrecognizedrole as a repressor of gene expression in nonmucoid P. aerugi-nosa. In addition, the concept that AlgR switches from being arepressor to an activator of virulence products during mucoidyis intriguing and is under further investigation.

In conclusion, our results indicate that AlgR represses theRhl quorum-sensing system in nonmucoid P. aeruginosa duringcontinuous culture biofilm growth and that such repression isnecessary for proper biofilm maturation. Furthermore, theability of AlgR to repress rhlI and rhlAB during biofilm growth,but not during planktonic culture, suggests that AlgR mayutilize a contact-dependent or biofilm-specific mode of regu-lation. Further insight into the coordinate regulation of theAlgR- and Rhl-dependent pathways during biofilm growth willenhance our understanding of P. aeruginosa pathogenesis inCF disease.

ACKNOWLEDGMENTS

The work was supported by NIH grants RO1AI50812 to M.J.S. andR37AI37713 to B.H.I., NIH training grant 5T32AI07285 to V.E.W.,and NIH grant R01-40541 and a Cystic Fibrosis Foundation grant toD.J.H.

REFERENCES

1. Alm, R. A., and J. S. Mattick. 1995. Identification of a gene, pilV, requiredfor type 4 fimbrial biogenesis in Pseudomonas aeruginosa, whose productpossesses a pre-pilin-like leader sequence. Mol. Microbiol. 16:485–496.

2. Beatson, S. A., C. B. Whitchurch, A. B. Semmler, and J. S. Mattick. 2002.Quorum sensing is not required for twitching motility in Pseudomonasaeruginosa. J. Bacteriol. 184:3598–3604.

3. Boles, B. R., M. Thoendel, and P. K. Singh. 2005. Rhamnolipids mediatedetachment of Pseudomonas aeruginosa from biofilms. Mol. Microbiol. 57:1210–1223.

4. Boles, B. R., M. Thoendel, and P. K. Singh. 2004. Self-generated diversityproduces “insurance effects” in biofilm communities. Proc. Natl. Acad. Sci.USA 101:16630–16635.

5. Bragonzi, A., D. Worlitzsch, G. B. Pier, P. Timpert, M. Ulrich, M. Hentzer,J. B. Andersen, M. Givskov, M. Conese, and G. Doring. 2005. NonmucoidPseudomonas aeruginosa expresses alginate in the lungs of patients withcystic fibrosis and in a mouse model. J. Infect. Dis. 192:410–419.

6. Calfee, M. W., J. P. Coleman, and E. C. Pesci. 2001. Interference withPseudomonas quinolone signal synthesis inhibits virulence factor expressionby Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 98:11633–11637.

7. Carterson, A. J., L. A. Morici, D. W. Jackson, A. Frisk, S. E. Lizewski, R.Jupiter, K. Simpson, D. A. Kunz, S. H. Davis, J. R. Schurr, D. J. Hassett, andM. J. Schurr. 2004. The transcriptional regulator AlgR controls cyanideproduction in Pseudomonas aeruginosa. J. Bacteriol. 186:6837–6844.

8. Costerton, J. W., P. S. Stewart, and E. P. Greenberg. 1999. Bacterial biofilms:a common cause of persistent infections. Science 284:1318–1322.

9. Coyne, M. J., K. S. Russell, C. L. Coyle, and J. B. Goldberg. 1994. The

Pseudomonas aeruginosa algC gene encodes phosphoglucomutase, requiredfor the synthesis of a complete lipopolysaccharide core. J. Bacteriol. 176:3500–3507.

10. Davey, M. E., N. C. Caiazza, and G. A. O’Toole. 2003. Rhamnolipid surfac-tant production affects biofilm architecture in Pseudomonas aeruginosaPAO1. J. Bacteriol. 185:1027–1036.

11. Davey, M. E., and G. A. O’Toole. 2000. Microbial biofilms: from ecology tomolecular genetics. Microbiol. Mol. Biol. Rev. 64:847–867.

12. Davies, D. G., A. M. Chakrabarty, and G. G. Geesey. 1993. Exopolysaccha-ride production in biofilms: substratum activation of alginate gene expressionby Pseudomonas aeruginosa. Appl. Environ. Microbiol. 59:1181–1186.

13. Davies, D. G., and G. G. Geesey. 1995. Regulation of the alginate biosyn-thesis gene algC in Pseudomonas aeruginosa during biofilm development incontinuous culture. Appl. Environ. Microbiol. 61:860–867.

14. Davies, D. G., M. R. Parsek, J. P. Pearson, B. H. Iglewski, J. W. Costerton,and E. P. Greenberg. 1998. The involvement of cell-to-cell signals in thedevelopment of a bacterial biofilm. Science 280:295–298.

15. De Kievit, T., P. C. Seed, J. Nezezon, L. Passador, and B. H. Iglewski. 1999.RsaL, a novel repressor of virulence gene expression in Pseudomonas aerugi-nosa. J. Bacteriol. 181:2175–2184.

16. De Kievit, T. R., and B. H. Iglewski. 2000. Bacterial quorum sensing inpathogenic relationships. Infect. Immun. 68:4839–4849.

17. De Lorenzo, V., and K. N. Timmis. 1994. Analysis and construction of stablephenotypes in gram-negative bacteria with Tn5- and Tn10-derived minitrans-posons. Methods Enzymol. 235:386–405.

18. Deretic, V., R. Dikshit, W. M. Konyecsni, A. M. Chakrabarty, and T. K.Misra. 1989. The algR gene, which regulates mucoidy in Pseudomonas aerugi-nosa, belongs to a class of environmentally responsive genes. J. Bacteriol.171:1278–1283.

19. Donnesberg, M. S., and J. B. Kaper. 1991. Construction of an eae deletionmutant of enteropathogenic Escherichia coli by using a positive selectionsuicide vector. Infect. Immun. 59:4310–4317.

20. Drenkard, E., and F. M. Ausubel. 2002. Pseudomonas biofilm formation andantibiotic resistance are linked to phenotypic variation. Nature 416:740–743.

21. Duan, K., and M. G. Surette. 2007. Environmental regulation of Pseudomo-nas aeruginosa PAO1 Las and Rhl quorum-sensing systems. J. Bacteriol.189:4827–4836.

22. Figurski, D. H., and D. R. Helinski. 1979. Replication of an origin-containingderivative of plasmid RK2 dependent on a plasmid function provided intrans. Proc. Natl. Acad. Sci. USA 76:1648–1652.

23. Fletcher, M. 1977. The effects of culture concentration and age, time andtemperature on bacterial attachment to polystyrene. Can. J. Microbiol. 23:1–6.

24. Flynn, J. L., and D. E. Ohman. 1988. Use of a gene replacement cosmidvector for cloning alginate conversion genes from mucoid and nonmucoidPseudomonas aeruginosa strains: algS controls expression of algT. J. Bacte-riol. 170:3228–3236.

25. Friedman, L., and R. Kolter. 2004. Genes involved in matrix formation inPseudomonas aeruginosa PA14 biofilms. Mol. Microbiol. 51:675–690.

26. Fuqua, W. Q., S. C. Winans, and E. P. Greenberg. 1994. Quorum sensing inbacteria: the LuxR-LuxI family of cell density-responsive transcriptionalregulators. J. Bacteriol. 176:269–275.

27. Govan, J. R. 1989. Alginate and antibiotics. Antibiot. Chemother. 42:88–96.28. Govan, J. R., and V. Deretic. 1996. Microbial pathogenesis in cystic fibrosis:

mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol. Rev.60:539–574.

29. Hentzer, M., G. M. Teitzel, G. J. Balzer, A. Heydorn, S. Molin, M. Givskov,and M. R. Parsek. 2001. Alginate overproduction affects Pseudomonasaeruginosa biofilm structure and function. J. Bacteriol. 183:5395–5401.

30. Hentzer, M., H. Wu, J. B. Andersen, K. Riedel, T. B. Rasmussen, N. Bagge,N. Kumar, M. A. Schembri, Z. Song, P. Kristoffersen, M. Manefield, J. W.Costerton, S. Molin, L. Eberl, P. Steinberg, S. Kjelleberg, N. Hoiby, and M.Givskov. 2003. Attenuation of Pseudomonas aeruginosa virulence by quorumsensing inhibitors. EMBO. J. 22:3803–3815.

31. Heydorn, A., B. Ersboll, J. Kato, M. Hentzer, M. R. Parsek, T. Tolker-Nielsen, M. Givskov, and S. Molin. 2002. Statistical analysis of Pseudomonasaeruginosa biofilm development: impact of mutations in genes involved intwitching motility, cell-to-cell signaling, and stationary-phase sigma factorexpression. Appl. Environ. Microbiol. 68:2008–2017.

32. Higuchi, R. 1989. Using PCR to engineer DNA, p. 61–70. In H. A. Erlich(ed.), PCR technology: principles and applications for DNA amplification.Stockton Press, New York, NY.

33. Hoang, T. T., R. R. Karkhoff-Schweizer, A. J. Kutchma, and H. P. Schweizer.1998. A broad-host-range Flp-FRT recombination system for site-specificexcision of chromosomally-located DNA sequences: application for isolationof unmarked Pseudomonas aeruginosa mutants. Gene 212:77–86.

34. Hoang, T. T., A. J. Kutchma, A. Becher, and H. P. Schweizer. 2000. Integra-tion-proficient plasmids for Pseudomonas aeruginosa: site-specific integrationand use for engineering of reporter and expression strains. Plasmid 43:59–72.

35. Holloway, B. W. 1955. Genetic recombination in Pseudomonas aeruginosa.J. Gen. Microbiol. 13:572–581.

36. Irie, Y., G. A. O’Toole, and M. H. Yuk. 2005. Pseudomonas aeruginosa



.org/D

ownloaded from

http://jb.asm.org/

rhamnolipids disperse Bordetella bronchiseptica biofilms. FEMS Microbiol.Lett. 250:237–243.

37. Kirisits, M. J., L. Prost, M. Starkey, and M. R. Parsek. 2005. Characteriza-tion of colony morphology variants isolated from Pseudomonas aeruginosabiofilms. Appl. Environ. Microbiol. 71:4809–4821.

38. Klausen, M., A. Heydorn, P. Ragas, L. Lambertsen, A. Aaes-Jorgensen, S.Molin, and T. Tolker-Nielsen. 2003. Biofilm formation by Pseudomonasaeruginosa wild type, flagella and type IV pili mutants. Mol. Microbiol.48:1511–1524.

39. Kohler, T., L. K. Curty, F. Barja, C. van Delden, and J. C. Pechere. 2000.Swarming of Pseudomonas aeruginosa is dependent on cell-to-cell signalingand requires flagella and pili. J. Bacteriol. 182:5990–5996.

40. Lam, J., R. Chan, K. Lam, and J. W. Costerton. 1980. Production of mucoidmicrocolonies by Pseudomonas aeruginosa within infected lungs in cysticfibrosis. Infect. Immun. 28:546–556.

41. Lamont, I. L., P. A. Beare, U. Ochsner, A. I. Vasil, and M. L. Vasil. 2002.Siderophore-mediated signaling regulates virulence factor production inPseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 99:7072–7077.

42. Lequette, Y., and E. P. Greenberg. 2005. Timing and localization of rham-nolipid synthesis gene expression in Pseudomonas aeruginosa biofilms. J.Bacteriol. 187:37–44.

43. Lizewski, S. E., D. S. Lundberg, and M. J. Schurr. 2002. The transcriptionalregulator AlgR is essential for Pseudomonas aeruginosa pathogenesis. Infect.Immun. 70:6083–6093.

44. Lizewski, S. E., J. R. Schurr, D. W. Jackson, A. Frisk, A. J. Carterson, andM. J. Schurr. 2004. Identification of AlgR-regulated genes in Pseudomonasaeruginosa by use of microarray analysis. J. Bacteriol. 186:5672–5684.

45. Ma, S., U. Selvaraj, D. E. Ohman, R. Quarless, D. J. Hassett, and D. J.Wozniak. 1998. Phosphorylation-independent activity of the response regu-lators AlgB and AlgR in promoting alginate biosynthesis in mucoid Pseudo-monas aeruginosa. J. Bacteriol. 180:956–968.

46. Mah, T. F., and G. A. O’Toole. 2001. Mechanisms of biofilm resistance toantimicrobial agents. Trends Microbiol. 9:34–39.

47. Martin, D. W., B. W. Holloway, and V. Deretic. 1993. Characterization of alocus determining the mucoid status of Pseudomonas aeruginosa: AlgUshows sequence similarities with a Bacillus sigma factor. J. Bacteriol. 175:1153–1164.

48. Martin, D. W., M. J. Schurr, M. H. Mudd, J. R. Govan, B. W. Holloway, andV. Deretic. 1993. Mechanism of conversion to mucoidy in Pseudomonasaeruginosa infecting cystic fibrosis patients. Proc. Natl. Acad. Sci. USA 90:8377–8381.

49. Martin, D. W., M. J. Schurr, H. Yu, and V. Deretic. 1994. Analysis ofpromoters controlled by the putative sigma factor AlgU regulating conver-sion to mucoidy in Pseudomonas aeruginosa: relationship to stress response.J. Bacteriol. 176:6688–6696.

50. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring HarborLaboratory, Cold Spring Harbor, NY.

51. Mohr, C. D., N. S. Hibler, and V. Deretic. 1991. AlgR, a response regulatorcontrolling mucoidy in Pseudomonas aeruginosa, binds to the FUS sites ofthe algD promoter located unusually far upstream from the mRNA start site.J. Bacteriol. 173:5136–5143.

52. Mohr, C. D., J. H. Leveau, D. P. Krieg, N. S. Hibler, and V. Deretic. 1992.AlgR-binding sites within the algD promoter make up a set of invertedrepeats separated by a large intervening segment of DNA. J. Bacteriol.174:6624–6633.

53. Mohr, C. D., D. W. Martin, W. M. Konyecsni, J. R. Govan, S. Lory, and V.Deretic. 1990. Role of the far-upstream sites of the algD promoter and thealgR and rpoN genes in environmental modulation of mucoidy in Pseudomo-nas aeruginosa. J. Bacteriol. 172:6576–6580.

54. Nivens, D. E., D. E. Ohman, J. Williams, and M. J. Franklin. 2001. Role ofalginate and its O acetylation in formation of Pseudomonas aeruginosa mi-crocolonies and biofilms. J. Bacteriol. 183:1047–1057.

55. Ochsner, U. A., A. K. Koch, A. Fiechter, and J. Reiser. 1994. Isolation andcharacterization of a regulatory gene affecting rhamnolipid biosurfactantsynthesis in Pseudomonas aeruginosa. J. Bacteriol. 176:2044–2054.

56. Ochsner, U. A., A. Snyder, A. I. Vasil, and M. L. Vasil. 2002. Effects of thetwin-arginine translocase on secretion of virulence factors, stress response,and pathogenesis. Proc. Natl. Acad. Sci. USA 99:8312–8317.

57. Olvera, C., J. B. Goldberg, R. Sanchez, and G. Soberon-Chavez. 1999. ThePseudomonas aeruginosa algC gene product participates in rhamnolipid bio-synthesis. FEMS Microbiol. Lett. 179:85–90.

58. O’Toole, G. A., K. A. Gibbs, P. W. Hager, P. V. Phibbs, Jr., and R. Kolter.2000. The global carbon metabolism regulator Crc is a component of a signaltransduction pathway required for biofilm development by Pseudomonasaeruginosa. J. Bacteriol. 182:425–431.

59. O’Toole, G. A., and R. Kolter. 1998. Flagellar and twitching motility arenecessary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol.30:295–304.

60. Pearson, J. P., K. M. Gray, L. Passador, K. D. Tucker, A. Eberhard, B. H.Iglewski, and E. P. Greenberg. 1994. Structure of the autoinducer requiredfor expression of Pseudomonas aeruginosa virulence genes. Proc. Natl. Acad.Sci. USA 91:197–201.

61. Pearson, J. P., L. Passador, B. H. Iglewski, and E. P. Greenberg. 1995. Asecond N-acylhomoserine lactone signal produced by Pseudomonas aerugi-nosa. Proc. Natl. Acad. Sci. USA 92:1490–1494.

62. Pearson, J. P., E. C. Pesci, and B. H. Iglewski. 1997. Roles of Pseudomonasaeruginosa las and rhl quorum-sensing systems in control of elastase andrhamnolipid biosynthesis genes. J. Bacteriol. 179:5756–5767.

63. Pesci, E. C., J. B. Milbank, J. P. Pearson, S. McKnight, A. S. Kende, E. P.Greenberg, and B. H. Iglewski. 1999. Quinolone signaling in the cell-to-cellcommunication system of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci.USA 96:11229–11234.

64. Pesci, E. C., J. P. Pearson, P. C. Seed, and B. H. Iglewski. 1997. Regulationof las and rhl quorum sensing in Pseudomonas aeruginosa. J. Bacteriol.179:3127–3132.

65. Pessi, G., and D. Haas. 2000. Transcriptional control of the hydrogen cya-nide biosynthetic genes hcnABC by the anaerobic regulator ANR and thequorum-sensing regulators LasR and RhlR in Pseudomonas aeruginosa. J.Bacteriol. 182:6940–6949.

66. Poole, K., K. Krebes, C. McNally, and S. Neshat. 1993. Multiple antibioticresistance in Pseudomonas aeruginosa: evidence for involvement of an effluxoperon. J. Bacteriol. 175:7363–7372.

67. Sauer, K., A. K. Camper, G. D. Ehrlich, J. W. Costerton, and D. G. Davies.2002. Pseudomonas aeruginosa displays multiple phenotypes during develop-ment as a biofilm. J. Bacteriol. 184:1140–1154.

68. Schurr, M. J., D. W. Martin, M. H. Mudd, and V. Deretic. 1994. Gene clustercontrolling conversion to alginate-overproducing phenotype in Pseudomonasaeruginosa: functional analysis in a heterologous host and role in the insta-bility of mucoidy. J. Bacteriol. 176:3375–3382.

69. Schurr, M. J., D. W. Martin, M. H. Mudd, N. S. Hibler, J. C. Boucher, andV. Deretic. 1993. The algD promoter: regulation of alginate production byPseudomonas aeruginosa in cystic fibrosis. Cell. Mol. Biol. Res. 39:371–376.

70. Schurr, M. J., H. Yu, J. C. Boucher, N. S. Hibler, and V. Deretic. 1995.Multiple promoters and induction by heat shock of the gene encoding thealternative sigma factor AlgU (sigma E) which controls mucoidy in cysticfibrosis isolates of Pseudomonas aeruginosa. J. Bacteriol. 177:5670–5679.

71. Schurr, M. J., H. Yu, J. M. Martinez-Salazar, N. S. Hibler, and V. Deretic.1995. Biochemical characterization and posttranslational modification ofAlgU, a regulator of stress response in Pseudomonas aeruginosa. Biochem.Biophys. Res. Commun. 216:874–880.

72. Schuster, M., C. P. Lostroh, T. Ogi, and E. P. Greenberg. 2003. Identifica-tion, timing, and signal specificity of Pseudomonas aeruginosa quorum-con-trolled genes: a transcriptome analysis. J. Bacteriol. 185:2066–2079.

73. Shrout, J. D., D. L. Chopp, C. L. Just, M. Hentzer, M. Givskov, and M. R.Parsek. 2006. The impact of quorum sensing and swarming motility onPseudomonas aeruginosa biofilm formation is nutritionally conditional. Mol.Microbiol. 62:1264–1277.

74. Simons, R. W., F. Houman, and N. Kleckner. 1987. Improved single andmulticopy lac-based cloning vectors for protein and operon fusions. Gene53:85–96.

75. Singh, P. K., A. L. Schaefer, M. R. Parsek, T. O. Moninger, M. J. Welsh, andE. P. Greenberg. 2000. Quorum-sensing signals indicate that cystic fibrosislungs are infected with bacterial biofilms. Nature 407:762–764.

76. Stapper, A. P., G. Narasimhan, D. E. Ohman, J. Barakat, M. Hentzer, S.Molin, A. Kharazmi, N. Hoiby, and K. Mathee. 2004. Alginate productionaffects Pseudomonas aeruginosa biofilm development and architecture, but isnot essential for biofilm formation. J. Med. Microbiol. 53:679–690.

77. Stoodley, P., F. Jorgensen, P. William, and H. M. Lappin-Scott. 1999. Therole of hydrodynamics and AHL signalling molecules as determinants of thestructure of Pseudomonas aeruginosa biofilms, p. 323–330. In R. Bayston, M.Brading, P. Gilbert, J. Walker, and J. W. T. Wimpenny (ed.), Biofilms: thegood, the bad, and the ugly. BioLine, Cardiff, United Kingdom.

78. Tahzibi, A., F. Kamal, and M. Assadi. 2004. Improved production of rham-nolipids by a Pseudomonas aeruginosa mutant. Iran. Biomed. J. 8:25–31.

79. Terry, J. M., S. E. Pina, and S. J. Mattingly. 1992. Role of energy metabo-lism in conversion of nonmucoid Pseudomonas aeruginosa to the mucoidphenotype. Infect. Immun. 60:1329–1335.

80. Toder, D. S., S. J. Ferrell, J. L. Nezezon, L. Rust, and B. H. Iglewski. 1994.lasA and lasB genes of P. aeruginosa: analysis of transcription and geneproduct activity. Infect. Immun. 62:1320–1327.

81. Wagner, V. E., D. Bushnell, L. Passador, A. I. Brooks, and B. H. Iglewski.2003. Microarray analysis of Pseudomonas aeruginosa quorum-sensing regu-lons: effects of growth phase and environment. J. Bacteriol. 185:2080–2095.

82. Whitchurch, C. B., R. A. Alm, and J. S. Mattick. 1996. The alginateregulator AlgR and an associated sensor FimS are required for twitchingmotility in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 93:9839–9843.

83. Whitchurch, C. B., T. E. Erova, J. A. Emery, J. L. Sargent, J. M. Harris,A. B. Semmler, M. D. Young, J. S. Mattick, and D. J. Wozniak. 2002.Phosphorylation of the Pseudomonas aeruginosa response regulator AlgRis essential for type IV fimbria-mediated twitching motility. J. Bacteriol.184:4544–4554.



.org/D

ownloaded from

http://jb.asm.org/

84. Wood, L. F., A. J. Leech, and D. E. Ohman. 2006. Cell wall-inhibitory antibioticsactivate the alginate biosynthesis operon in Pseudomonas aeruginosa: roles of sigma(AlgT) and the AlgW and Prc proteases. Mol. Microbiol. 62:412–426.

85. Wozniak, D. J., T. J. Wyckoff, M. Starkey, R. Keyser, P. Azadi, G. A. O’Toole,and M. R. Parsek. 2003. Alginate is not a significant component of theextracellular polysaccharide matrix of PA14 and PAO1 Pseudomonas aerugi-nosa biofilms. Proc. Natl. Acad. Sci. USA 100:7907–7912.

86. Zielinski, N. A., A. M. Chakrabarty, and A. Berry. 1991. Characterizationand regulation of the Pseudomonas aeruginosa algC gene encoding phospho-mannomutase. J. Biol. Chem. 266:9754–9763.

87. Zielinski, N. A., R. Maharaj, S. Roychoudhury, C. E. Danganan, W.Hendrickson, and A. M. Chakrabarty. 1992. Alginate synthesis in Pseudo-monas aeruginosa: environmental regulation of the algC promoter. J. Bacte-riol. 174:7680–7688.



.org/D

ownloaded from

http://jb.asm.org/

pseudomonas aeruginosa algr represses the rhl quorum

Documents