Gene 538 (2014) 182–187

Contents lists available at ScienceDirect

Gene

j ourna l homepage: www.e lsev ie r .com/ locate /gene

Protein modeling of cathepsin C mutations found inPapillon–Lefèvre syndrome

Morteza Moghaddasian a,b,1, Hamidreza Arab c,1, Ezzat Dadkhah a,d, Hamidreza Boostani b,Azam Rezaei Babak b, Mohammad Reza Abbaszadegan a,b,⁎a Human Genetics Division, Immunology Research Center, Avicenna Research Institute, Mashhad University of Medical Sciences (MUMS), Mashhad, Iranb Medical Genetics Research Center, Medical School, MUMS, Mashhad, Iranc Dental Research Center, School of Dentistry, MUMS, Mashhad, Irand School of Systems Biology, George Mason University, Manassass, VA, USA

Abbreviations: A, adenine; C, cytosine; ctsc, cathepprotein; del, deletion; DNA, deoxyribonucleic acid; G, guaPapillon–Lefèvre syndrome; Q, glutamine; R, arginine; RFpolymorphism; SNP, single nucleotide polymorphism; T, t⁎ Corresponding author at: Adjunct Professor, Arizona

Genetics Research Center, Avicenna Research Institute, MSciences, Mashhad 9196773117, Iran. Tel./fax: +98 511 71

E-mail address: abbaszadeganmr@mums.ac.ir (M.R. A1 These authors contributed equally.

0378-1119/$ – see front matter © 2014 Elsevier B.V. All rhttp://dx.doi.org/10.1016/j.gene.2013.11.079

a b s t r a c t

a r t i c l e i n f o

Article history:

Accepted 30 November 2013Available online 26 December 2013

Keywords:Papillon–Lefèvre syndromeCathepsin C mutationPre-pubertal periodontitisPalmoplantar hyperkeratosisEnergy minimizationTertiary structure

Background: Papillon–Lefèvre syndrome (PLS) is a rare autosomal recessive disorder characterized by hyper-keratosis involving the palms, soles, elbows, and knees followed by periodontitis, destruction of alveolarbone, and loss of primary and permanent teeth. Mutations of the lysosomal protease cathepsin C gene (CTSC)have been shown to be the genetic cause of PLS. This study analyzed CTSC mutations in five Iranian familieswith PLS and modeled the protein for mutations found in two of them.Methods: DNA analysis was performed by direct automated sequencing of genomic DNA amplified from exonicregions and associated splice intron site junctions of CTSC. RFLP analyses were performed to investigate thepresence of previously unidentified mutation(s) in control groups. Protein homology modeling of the deducednovel mutations (P35 delL and R272P) was performed using the online Swiss-Prot server for automatedmodeling and analyzed and tested with special bioinformatics tools to better understand the structural effects

caused by mutations in cathepsin C protein (CTSC).Results: Six Iranian patients with PLS experienced premature tooth loss and palm plantar hyperkeratosis.Sequence analysis of CTSC revealed a novel mutation (P35delL) in exon 1 of Patient 1, and four previously re-portedmutations; R210X in Patient 2, R272P in Patient 3, Q312R in two siblings of family 4 (Patients 4 and 5), andCS043636 in Patient 6. RFLP analyses revealed different restriction fragment patterns between 50 healthy con-trols and patients for the P35delL mutation. Modeling of the mutations found in CTSC, P35delL in Patient 1 andR272P in Patient 3 revealed structural effects, which caused the functional abnormalities of themutated proteins.Conclusions: The presence of this mutation in these patients provides evidence for founder CTSC mutations inPLS. This newly identified P35delL mutation leads to the loss of a leucine residue in the protein. The result ofthis study indicates that the phenotypes observed in these two patients are likely due to CTSC mutations.Also, structural analyses of the altered proteins identified changes in energy and stereochemistry that likelyalter protein function.

© 2014 Elsevier B.V. All rights reserved.

1. Introduction

Papillon–Lefèvre syndrome (PLS; OMIM245000) is a rare autosomal-recessive disorder characterized by early-onset periodontitis andpalmoplantar hyperkeratosis with an estimated incidence of 1–4 permillion (Gorlin et al., 1964), with males and females affected equally.

sin C gene; CTSC, cathepsin Cnine; L, leucine; P, proline; PLS,LP, restriction fragment lengthhymine; X, termination codon.State University, Head, Medicalashhad University of Medical

12343.bbaszadegan).

ights reserved.

PLS was first described by two Frenchmen (Papillon and Lefèvre,1924). The palmoplantar lesions are keratotic and sharply demarcated,and knees and elbows may be involved (Gorlin et al., 1964). PLS is alsoassociated with premature loss of deciduous and permanent teeth andsevere periodontitis. Gingival inflammation, pocket formation, andbleeding of the gums develop shortly after tooth eruption, but resolveafter exfoliation (Haneke, 1979). Other clinical features not often re-ported include increased susceptibility to infections, especially furuncu-losis and pyoderma, pyogenic liver abscesses, and dura calcification(Cury et al., 2002).

In 1999, the PLS gene was localized to chromosome 11q14 (Fischeret al., 1997; Laass et al., 1997). At the end of 1999, two groups recog-nized the candidate gene cathepsin C (CTSC), whose mutations canresult in PLS (Hart et al., 1999; Toomes et al., 1999). Hart's groupthen proposed that mutations in this gene could also cause prepubertal

Table 1Primers used to amplify the CTSC exon.

Region Primer sequence (5′ → 3′) Amplicon (bp)

Exon 1 F: TCTTCACCTCTTTTCTCAGC 337R: GGTCCCCGAATCCAGTCAAG

Exon 2 F: GACTGTGCTCAAACTGGGTAG 338R: CTACTAATCAGAAGAGGTTTCAG

Exon 3 F: GGGGCACATTTACTGTGAATG 285R: CGTATGTCTCATTTGTAGCAAC

Exon 4 F: GTACCACTTTCCACTTAGGCA 313R: GGAGGATGGTATTCAGCATTC

Exon 5 F: CCTAGCTAGTCTGGTAGCTG 305R: GTATCCCCGAAATCCATCACA

Exon 6 F: CTCTGTGAGGCTTCAGATGTC 244R: CAACAGCCAGCTGCACACAG

Exon 7 F: TAAGCAGAGATACAGAGAAG 574R: GTAGTGGAGGAAGTCATCATATAC

183M. Moghaddasian et al. / Gene 538 (2014) 182–187

periodontitis with no other PLS-type symptoms and Haim–Munk syn-drome (HMS,MIM245010). The latter is characterized byhanddeformi-ties such as arachnodactyly, acroosteolysis, and onychogryphosis,in addition to typical PLS symptoms (P.S. Hart et al., 2000; T.C. Hartet al., 2000).

CTSC encodes cathepsin C (CTSC), a lysosomal protease that plays animportant role in the activation of many serine proteinases of immuneand inflammatory cells (de Haar et al., 2004; Toomes et al., 1999).Disturbances in CTSC function can result in abnormalities, especiallywhere it is highly expressed, such as epithelial and immune cells(Meade et al., 2006). For example, natural killer cells and T lymphocytesrequire activated granzymes A and B to exert their cytolytic activities,and these granzymes are activated by the CTSC-mediated cleavage oftheir N-terminal peptides. Therefore, mutations in CTSC are expectedto result in increased frequency of infections (Meade et al., 2006;Nakajima et al., 2008; Smyth et al., 1995). Similarly in the skin, muta-tions in CTSCmight affect epithelial differentiation and lead tohyperker-atosis (Pilger et al., 2003).

It is likely that changes in coding sequences of CTSC may negativelyaffect protein function. According to the human genome mutationdatabank, 73 mutations in CTSC have been identified and 69 of theseare associated with PLS. In the present study CTSC genes from fiveIranian families with PLS from unrelated consanguineous nuclear pedi-grees were analyzed; as a part of the in-silico study the deduced proteinproducts of the novel mutations (P35delL) and a missense mutation(R272P) were modeled using online Swiss-Prot server for automatedmodeling and improved by recent bioinformatics software and tech-niques and also by the help of the solved structures of CTSC, 1K3Baand 1K3Bb, to predict the tertiary structure and possible altered func-tions of the mutated proteins.

2. Materials & methods

2.1. Patients

The study was performed under the protocol approved by MashhadUniversity Health Science Center's Ethical Committee, under institu-tional approval and in adherence to the Declaration of Helsinki princi-ples. The six patients with PLS were diagnosed at Mashhad UniversitySchool of Dentistry, Periodontology Department, based on clinicalexaminations. All affected patients presented symptoms typical of PLSwith no evidence of hand deformities or other symptoms reported inHMS. The patients were otherwise healthy.

Patientswere fromconsanguineous nuclear pedigrees. The50healthycontrols with no evidence of aggressive periodontitis and palmoplantarhyperkeratosis were also included in this study after providing informedconsent.

2.2. PCR amplification and mutation analysis

Peripheral blood samples were collected from patients and controlsby standard venipuncture into EDTA-containing tubes. Genomic DNAwas isolated from leukocytes using conventional salting-out method.All exons of CTSC with adjacent sequences of exon and intron borderswere amplified by PCR with the primers shown in Table 1 (Nakanoet al., 2002; Toomes et al., 1999). Amplifications were carried out in20 μL volumes containing 50 ng sample DNA, 0.2 mM dNTP (GenetBio,Korea), 500 nM of each primer, 2 μL of 10× buffer, 1.6 mmol/L MgCl2,and 1 U Taq DNA Polymerase (GenetBio, Korea). After an initial dena-turation step at 95 °C for 3 min, 35 cycles of amplification was per-formed consisting of 30 s at 95 °C, 30 s at the optimal annealingtemperatures of 58 °C for exons 1, 2, and 6, and 56 °C for exons 3, 4, 5,and 7, and a 5 min terminal elongation step, in a TechGene thermalcycler (Germany). The amplified products were visualized by electro-phoresis in an ethidium bromide-stained 2% agarose gel.

2.3. Sequencing

The PCR products were directly sequenced in an ABI Prism 310 Auto-mated Sequencer (Big Dye Terminator Cycle Sequencing Ready ReactionKit, Applied Bio systems, and Foster City, CA, USA). To identifymutations,data were analyzed with the sequencing program Sequencher 4.10.1.DNA sequences were compared to published CTSC sequences [Refsequences: NG_007952 (NCBI), C-001 ENST00000227266 (ensemble)].

2.4. RFLP

RFLP was used to identify previously unreported CTSC variantsin 100 alleles of controls and compare them to patients' sequences.Ten microliters of PCR product was digested with 1 U of BseY1 (NewEngland Biolabs, USA) in 0.2 mL 10× reaction buffer at 37 °C for 12 h.The BseY1 restriction fragments were visualized by electrophoresis in15% polyacrylamide gel.

2.5. Structural analyses

To model the newly-identified P35delL and previously character-ized R272P mutations, the mutated CTSC deduced amino acid se-quences were compared to template databases using the onlineserver Swiss-Prot Template Identification tool (Arnold et al., 2006;http://swissmodel.expasy.org).

The template most similar to the target mutated proteins, with 99%sequence identity to each, was human cathepsin C, which has beensolved to 2.15 Å 1K3Ba and 1k3Bb (Zdobnov and Apweiler, 2001) that1K3Ba includes the amino acids of the first chain of the protein and1K3Bb includes the second chain respectively.

1K3Ba and 1K3Bb were submitted for the homology modeling usingthe online Swiss-Prot server for automated modeling (Arnold et al.,2006; Guex and Peitsch, 1997; Schwede et al., 2003; http://swissmodel.expasy.org). The result was set for the energy minimization job usingZMM software. The ZMM uses the Amber all-atom force field (Weineret al., 1984) with a cut-off distance of 10 Å to minimize conformationalenergy in the space of generalized coordinates including torsion andbond angles. Low-energy conformation was reached by the MonteCarlo minimization method (Li and Scheraga, 1987).

The energy minimization was terminated after 100 sequential min-imizations failed to improve the lowest-energy conformation.

The essential accuracy and correctness of the model were evaluatedusing the PROCHECK (laskowski et al., 1993) and WHAT-IF (Vriend,1990) programs from the online server http://nihserver.mbi.ucla.edu/SAVES/.

The electrostatic potential of the molecule was computed usingCoulomb's law and the Swiss-PdbViewer 4.02 (Guex and Peitsch, 1997),as well as the graphical representations presented here.

Fig. 1. Clinical finding of Patient 2. Hyperkeratosis of hands and foot (A & B). Dental status (C).

184 M. Moghaddasian et al. / Gene 538 (2014) 182–187

3. Results

Six patients from five consanguine families were diagnosedwith PLSaccording to previously established criteria (Gorlin et al., 1964; Haneke,1979). All patients had histories of early-onset periodontitis at the ageof 2–3 years.

Intra-oral examination of patients indicated red, swollen gums withmost teeth missing.

Patient 1 was a six-year-old female. Sequencing of exons and spliceintron sites of CTSC showed a three-base-pair CTG deletion in exon 1(P35delL,), which led to a deletion of the amino acid leucine in the pro-tein. None of the 50 controls had this deletion. We also found rs217116SNP in exon 5 of Patient 1 (Table 2). This mutation was hereditary be-cause samples from the mother and sister showed heterozygosity forthis mutation.

Patient 2 was a 17-year-old male; his palm plantar hyperkeratosiswasmoderate,withfissures on the soles of his feet (Fig. 1). Patient 2 car-ried a nonsense mutation in exon 4 (R210X) and polymorphisms inexon 5 (rs217116) (Table 2). Both parents and a 25-year old brotherof Patient 2 were heterozygous for this mutation. Patient 3 was aneight-year-old male of a consanguine marriage who carried an R272Pmutation in exon 6. Both parents were heterozygous for the mutation.Fig. 3 shows the mutation in the patients and their available relatives.

Patients 4 and 5, a 21-year-old male and a 16-year-old female,respectively, were siblings. Both carried a Q312R mutation in exon 7(Fig. 7).

Patient 6 had lost most of her teeth, and the remaining teeth wereseverely damaged. She had severe, extensive hyperkeratotic lesions inher knees, and palm plantar hyperkeratosis. The clinical manifestationsof PLS in Patient 6 are shown in Fig. 1. A GNT mutation was identified inexon 3 splice acceptor site of Patient 6.

Pedigrees from the five families revealed an autosomal recessivepattern of inheritance (Fig. 2). The consanguineous parents were

Fig. 2. Clinical and radiographic findings of Patient 6 with PLS. Hyperkeratosis of the hand (Ageneralized alveolar bone loss in mandibular and maxillary arch (C).

also examined. Neither aggressive periodontitis nor palm plantar hy-perkeratosis was identified in the parents, nor did they know of any rel-atives or antecedents with the disease in their families.

The three-dimensional structures of the normal and mutated CTSCare shown for each mutation in Figs. 4, 5, and 6 for the 1K3Ba (The 3dstructure of the chain one of the CTSC protein) structure and Figs. 7, 8,and 9 for the 1K3Bb (the 3d structure of the second chain of the CTSCprotein) structure. The models were analyzed in terms of stereochemi-cal and geometrical parameters such asG-Factor, bond length, and bondangles, for which all the results satisfied the discussed criteria. Inaddition, most of the residues were inside the favorable regions of theRamachandran map in both models. The overall energies of the modelsafter energy minimization were −521.2 kcal/mol for the 1K3Ba struc-ture and −1233.2 kcal/mol for the 1K3Bb structure.

4. Discussion

We analyzed six patients from five Iranian families with PLS, andfound one novel and four previously-characterized mutations. All sixpatients carried rs217116 SNP, which is caused by a T to C substitutionin exon 5. Three patients showed another SNP, rs580808, which iscaused by a C to T substitution in exon 1. The CTG mutation in Patient1 deleted all the functional domains of the protein, which seriouslyaffected CTSC function. The P35delL was not present in 100 normalalleles, suggesting it is not a CTSC polymorphism. Missense and non-sense mutations are the most frequently-reported mutations in PLS,but small deletions, insertions, and splice site mutations have alsobeen reported (Selvaraju et al., 2003).

Sequence analysis of CTSC exon 4 in Patient 2 confirmed the previ-ously reported CNT 28595 mutation in populations studied by Toomeset al. in 1999, leading to exon 4 628C→T R210X arginine to stop, CNT28595.

). Psoriasiform lesions were present over the elbows and knees (B). Panoramic showing

Fig. 3. CTSC mutation analyses in families with PLS.

185M. Moghaddasian et al. / Gene 538 (2014) 182–187

Mutations in CTSChave been reported in three closely-related condi-tions, i.e. PLS, Haim–Munk syndrome, and prepubertal periodontitis(Selvaraju et al., 2003). A common clinical manifestation of the threediseases is severe early-onset periodontal destruction. Each of theseconditions is known to exhibit autosomal recessive inheritance, andthe complete absence of CTSC activity is required to develop the clinicalphenotype of PLS (Toomes et al., 1999). To date, 73mutations includingmissense, nonsense, insertions, and deletions in CTSC have beenreported in PLS patients (Pallos et al., 2010). Of the 73 mutationsreported for CTSC in HGMD, 12 are small deletions and 52 aremissense/nonsense mutations. The 12 deletion mutations of CTSC inPLS have been reported in different ethnic groups and cause differentchanges in the structure of the protein (Table 2). Of the six patientsanalyzed in this study, four carried nonsense/missense mutations,one had a splicing mutation, and one had a CTG deletion that wasnot previously reported.

In this study, the mutated residue, P35delL, plays an important roledue to its location in the exclusion domain, SSF75001, accessed byInterproScan (Zdobnov and Apweiler, 2001) of CTSC, which startsat amino acid 25 and ends at amino acid 141 of 463 amino acids

Table 2Variations found in six patients with PLS [ref sequences: NG_007952 (NCBI), C-001 ENST00000

Patient Consanguinity Mutation site Nucleotide of mutation Effect of mutat

1 + Exon 1 c.103-105delCTG P 35delL2 + Exon 4 c.628CNT R210X3 + Exon 6 c.815GNC R272P

4 + Exon 7 c.935ANG Q312R

5 + Exon 7 c.935ANG Q312R

6 + Exon 3 c.318-1GNT Altered splicin

in the protein. This domain is identical to the X-ray structure of1K3Ba (Turk et al., 2001), which was used as the template to modelthe mutated protein in this study. The second mutation (R272P),which was modeled using the 1k3Bb (Turk et al., 2001) structurehas the same priority as the first due to its location in the importantdomain indicated as PF00112 accessed by InterproScan (Zdobnovand Apweiler, 2001). Structural analyses also revealed changes in thetertiary structures of the mutated proteins and the special domainsdiscussed previously. Because a relationship exists between proteintertiary structure and function, these structurally abnormal proteinsmay also be functionally abnormal.

CTSC, also known as dipeptidyl amino peptidase I, a lysosomalproteinase of the papain type, which removes dipeptides from theamino termini of its substrates (Nakajima et al., 2008) and activatesother serine proteases such as elastase, cathepsin G, and proteinase3, also activates both the innate and adaptive immune systems(Lundgren and Renvert, 2004). The protein is composed of four iden-tical units, each consisting of three different polypeptide chains: theheavy and light chains and the exclusion domain (Molgaard et al.,2007). The exclusion domain is non-covalently attached to the heavy

227266 (ensembl)].

ion HGMD accession number Polymorphism Nucleotide of polymorphism

– rs217116 g.42281TNCCM993131 rs217116 g.42281TNCCM993134 rs217116

rs580808g.42281TNCg.5379GNA

CM40410 rs217116rs580808

g.42281TNCg.5379GNA

CM40410 rs217116rs580808

g.42281TNCg.5379GNA

g

Fig. 4. The whole view (normal view) of the 1K3Ba structure with ASP34, LEU35, andLEU36 highlighted.

Fig. 6. A close up of the 1K3Ba with the P35del L mutation shown.

Fig. 7. The whole view (normal view) of the 1K3Bb structure with ILE271, ARG272, andILE273 highlighted.

186 M. Moghaddasian et al. / Gene 538 (2014) 182–187

and light chains, forming a heterotrimeric structure (Olsen et al., 2001).The clinical manifestations of PLS and high level of CTSC in skin showthe possible role of CTSC in the processing of keratin or differentiationin epithelial cells (Nuckolls and Slavkin, 1999; Toomes et al., 1999).

PLS usually manifests in the first two years of life. Themost commoninitial symptom is palmoplantar hyperkeratosis (Canger et al., 2008).The eruption of the primary teeth is uneventful, however, followingeruption of primary teeth, the inflammation of the gingival tissue starts,leading to complete loss of the primary teeth (Canger et al., 2008; Dalgicet al., 2011; Lundgren and Renvert, 2004). After the loss of the primaryteeth, the gingival tissue returns to normal until about age 15 when thecycle repeats and results in the loss of the permanent teeth (Cangeret al., 2008; Fardal et al., 1998). Rapid development of periodontitis inPLS patients can cause severe loss of alveolar bone which has been ob-served in radiographic examination of advanced cases (Dhanrajani,2009; Kleinfelder et al., 1996).

Early diagnosis and antibiotic therapy are important if the remainingteeth are to be saved. Scaling and root planing are employed for long-term maintenance and to prevent or delay tooth loss. In our casestudy, immediately after diagnosis the treatment plan included extrac-tion of the remaining teeth that were mobile and had insufficientbone support. Oral hygiene instruction and use of anti-microbial rinseswere recommended. Full dentures to improvemastication and esthetics

Fig. 5. Awhole view (mutant) of the 1K3Ba structure with the P. 35del L mutation shown.

were constructed until the patient's skeletal growth was complete,which is the appropriate time for dental implants. Etoz et al. (2010)demonstrated that patients can be successfully treated with dentalimplants.

Fig. 8. A whole view (mutant) of the 1K3Bb structure with the R272P mutation shown.

Fig. 9. A close up of the 1k3Bb structure with the R272P mutation shown.

187M. Moghaddasian et al. / Gene 538 (2014) 182–187

Our results extend the mutation spectrum of CTSC and may be usedfor mutation screening of PLS in the Iranian population.

Conflict of interests

The authors have no conflicts of interests.

Acknowledgments

This studywas supported by grants offered by theMUMS (#86343 &900370). Part of this study was a thesis of specialty degree of DentistrySchool. We appreciate the patients and their family members forparticipating in this study. Authors appreciate Professor MahmoudNaghibzadeh and Dr. Saeed Abrishami, Department of Computer Engi-neering, Ferdowsi University, Mashhad, Iran, for their assistance inproviding the necessary facility for the modeling part of this project.

References

Arnold, K., Bordoli, L., Kopp, J., Schwede, T., 2006. The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics 22 (2),195–201.

Canger, E.M., Celenk, P., Devrim, I., Yenisey, M., Gunhan, O., 2008. Intraoral findings ofPapillon–Lefèvre syndrome. J. Dent. Child. (Chic) 75 (1), 99–103.

Cury, V.F., Costa, J.E., Gomez, R.S., Boson, W.L., Loures, C.G., De, M.L., 2002. A novel muta-tion of the cathepsin C gene in Papillon–Lefèvre syndrome. J. Periodontol. 73 (3),307–312.

Dalgic, B., Bukulmez, A., Sari, S., 2011. Eponym, Papillon–Lefèvre syndrome. Eur. J. Pediatr.170 (6), 689–691.

de Haar, S.F., Jansen, D.C., Schoenmaker, T., De Vree, H., Everts, V., Beertsen, W., 2004.Loss-of-function mutations in cathepsin C in two families with Papillon–Lefèvresyndrome are associated with deficiency of serine proteinases in PMNs. Hum.Mutat. 23 (5), 524.

Dhanrajani, P.J., 2009. Papillon–Lefèvre syndrome: clinical presentation and a briefreview. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 108 (1), e1–e7.

Etoz, O.A., Ulu, M., Kesim, B., 2010. Treatment of patient with Papillon–Lefèvre syn-drome with short dental implants: a case report. Implant. Dent. 19 (5), 394–399.http://dx.doi.org/10.1097/ID.0b013e3181ed0798 (00008505-201010000-00009 [pii]).

Fardal, O., Drangsholt, E., Olsen, I., 1998. Palmar plantar keratosis and unusual periodontalfindings. Observations from a family of 4 members. J. Clin. Periodontol. 25 (2),181–184.

Fischer, J., et al., 1997. Mapping of Papillon–Lefèvre syndrome to the chromosome 11q14region. Eur. J. Hum. Genet. 5 (3), 156–160.

Gorlin, R.J., Sedano, H., Anderson, V.E., 1964. The syndrome of palmar–plantar hyperkera-tosis and premature periodontal destruction of the teeth. A clinical and genetic analy-sis of the Papillon–Lefèvre syndrome. J. Pediatr. 65, 895–908.

Guex, N., Peitsch, M.C., 1997. SWISS-MODEL and the Swiss-PdbViewer: an environmentfor comparative protein modeling. Electrophoresis 18 (15), 2714–2723.

Haneke, E., 1979. The Papillon–Lefèvre syndrome: keratosis palmoplantaris withperiodontopathy. Report of a case and review of the cases in the literature. Hum.Genet. 51 (1), 1–35.

Hart, T.C., et al., 1999. Mutations of the cathepsin C gene are responsible for Papillon–Lefèvre syndrome. J. Med. Genet. 36 (12), 881–887.

Hart, P.S., et al., 2000a. Identification of cathepsin C mutations in ethnically diversePapillon–Lefèvre syndrome patients. J. Med. Genet. 37 (12), 927–932.

Hart, T.C., et al., 2000b. Haim–Munk syndrome and Papillon–Lefèvre syndrome are allelicmutations in cathepsin C. J. Med. Genet. 37 (2), 88–94.

Kleinfelder, J.W., Topoll, H.H., Preus, H.R., Muller, R.F., Lange, D.E., Bocker, W., 1996.Microbiological and immunohistological findings in a patient with Papillon–Lefèvresyndrome. J. Clin. Periodontol. 23 (11), 1032–1038.

Laass, M.W., et al., 1997. Localisation of a gene for Papillon–Lefèvre syndrome to chromo-some 11q14–q21 by homozygosity mapping. Hum. Genet. 101 (3), 376–382.

Laskowski, R.A., MacArthur, M.W., Moss, D.S., Thornton, J.M., 1993. PROCHECK — a pro-gram to check the stereochemical quality of protein structures. J. Appl. Cryst. 26,283–291.

Li, Z., Scheraga, H.A., 1987. Monte Carlo-minimization approach to the multiple-minimaproblem in protein folding. Proc. Natl. Acad. Sci. U. S. A. 84 (19), 6611–6615.

Lundgren, T., Renvert, S., 2004. Periodontal treatment of patients with Papillon–Lefèvresyndrome: a 3-year follow-up. J. Clin. Periodontol. 31 (11), 933–938.

Meade, J.L., et al., 2006. A familywith Papillon–Lefèvre syndrome reveals a requirement forcathepsin C in granzyme B activation and NK cell cytolytic activity. Blood 107 (9),3665–3668.

Molgaard, A., Arnau, J., Lauritzen, C., Larsen, S., Petersen, G., Pedersen, J., 2007. The crystalstructure of human dipeptidyl peptidase I (cathepsin C) in complexwith the inhibitorGly-Phe-CHN2. Biochem. J. 401 (3), 645–650.

Nakajima, K., et al., 2008. Papillon–Lefèvre syndrome and malignant melanoma. A highincidence of melanoma development in Japanese palmoplantar keratodermapatients. Dermatology 217 (1), 58–62.

Nakano, A., et al., 2002. Laminin 5 mutations in junctional epidermolysis bullosa: molec-ular basis of Herlitz vs. non-Herlitz phenotypes. Hum. Genet. 110 (1), 41–51.

Nuckolls, G.H., Slavkin, H.C., 1999. Paths of glorious proteases. Nat. Genet. 23 (4), 378–380.Olsen, J.G., Kadziola, A., Lauritzen, C., Pedersen, J., Larsen, S., Dahl, S.W., 2001. Tetrameric

dipeptidyl peptidase I directs substrate specificity by use of the residual pro-partdomain. FEBS Lett. 506 (3), 201–206.

Pallos, D., Acevedo, A.C., Mestrinho, H.D., Cordeiro, I., Hart, T.C., 2010. Novel cathepsin Cmutation in a Brazilian family with Papillon–Lefèvre syndrome: case report and mu-tation update. J. Dent. Child. (Chic) 77 (1), 36–41.

Papillon, M., Lefèvre, B., 1924. two cases of familial symmetric palmoplanter keratosis(Maleda's disease) in a brother and his sister. Alterations in both cases. Bull. Soc. Fr.Dermatol. Syphiligraphie 31, 81–84.

Pilger, U., Hennies, H.C., Truschnegg, A., Aberer, E., 2003. Late-onset Papillon–Lefèvresyndrome without alteration of the cathepsin C gene. J. Am. Acad. Dermatol. 49(5 Suppl.), S240–S243.

Schwede, T., Kopp, J., Guex, N., Peitsch, M.C., 2003. SWISS-MODEL: an automated proteinhomology-modeling server. Nucleic Acids Res. 31 (13), 3381–3385.

Selvaraju, V., et al., 2003. Mutation analysis of the cathepsin C gene in Indian families withPapillon–Lefèvre syndrome. BMC Med. Genet. 4, 5.

Smyth, M.J., McGuire, M.J., Thia, K.Y., 1995. Expression of recombinant human granzymeB. A processing and activation role for dipeptidyl peptidase I. J. Immunol. 154 (12),6299–6305.

Toomes, C., et al., 1999. Loss-of-function mutations in the cathepsin C gene result in peri-odontal disease and palmoplantar keratosis. Nat. Genet. 23 (4), 421–424.

Turk, D., et al., 2001. Structure of human dipeptidyl peptidase I (cathepsin C): exclusiondomain added to an endopeptidase framework creates the machine for activationof granular serine proteases. EMBO J. 20 (23), 6570–6582.

Vriend, G., 1990. WHAT IF: a molecular modeling and drug design program. J. Mol. Graph.8 (1), 52–56 (29).

Weiner, S.J.K.P., et al., 1984. A new force filed for molecular mechanical simulation ofnucleic acids and proteins. J. Am. Chem. Soc. 106, 765–784.

Zdobnov, E.M., Apweiler, R., 2001. InterProScan — an integration platform for thesignature-recognition methods in InterPro. Bioinformatics 17 (9), 847–848.