PRIMA-1met Induces Apoptosis in Waldenström's

Macroglobulinemia Independent of p53, alone and in

Combination with Bortezomib

By:

Mona Sobhani

A thesis submitted in conformity with the requirements for the degree of

Masters of Science

Department of Laboratory Medicine and Pathobiology

University of Toronto

© Copyright by Mona Sobhani 2015

ii

PRIMA-1met Induces Apoptosis in Waldenström's

Macroglobulinemia Independent of p53, alone and in

Combination with BortezomibMona Sobhani

Master of Science

Department of Laboratory Medicine and Pathobiology

University of Toronto

2015

Abstract:

PRIMA-1met has shown promising preclinical activity in various cancer types. However, its

effect on Waldenström’s Macroglobulinemia (WM) as well as its exact mechanism of action is

still elusive. In this study, we evaluated the anti- tumor activity of PRIMA-1met alone and in

combination with dexamethasone or bortezomib in WM cell line and primary samples.

Treatment of WM cells with PRIMA-1met resulted in induction of apoptosis, inhibition of

migration and colony formation. Upon PRIMA-1met treatment, p73 was upregulated and Bcl-xL

was downregulated while no significant change in expression of p53 was observed. siRNA

knockdown of p53 in WM cell line did not influence the PRIMA-1met-induced apoptotic

response whereas silencing of p73 inhibited latter response in WM cells. Combined treatment

with PRIMA-1met and dexamethasone or bortezomib induced synergistic reduction in cell

survival in WM cells. Our study provides the rationale for PRIMA-1met’s clinical evaluation in

patients with WM.

iii

Acknowledgements

I would like to extend my sincerest thanks and regards to all those who supported and

encouraged me during my Master’s study.

First, I would like to express my special gratitude to my supervisors Dr. Hong Chang whose

expert guidance, support, patience and encouragement made my Master’s studies a productive

experience. I am grateful to have had the opportunity to train in a diverse learning environment

with admirable individuals, particularly Manujhandra Saha, Yijun Yang and Yan Chen, whose

proficiency and expertise in the lab have been immeasurably helpful to me. I would also like to

express my special thanks to my committee members Dr. Donald Branch and Dr Chen Wang for

their valuable and constructive comments.

My deep gratitude is expressed to my mother and father whose love, inspiration and endless

encouragement made my years of studies an enjoyable and unforgettable experience. They

deserve special and heartfelt thanks.

iv

Table of Contents

Abstract…………………………………………………………………………………………….i

Acknowledgments...........................................................................................................................ii

List of Tables ..................................................................................................................................v

List of Figures ................................................................................................................................vi

List of Abbreviations ................................................................................................................... vii

Chapter 1: Introduction ...............................................................................................................1

1.1. Waldenström's Macroglobulinemia..........................................................................................1

1.1.1Waldenström's Macroglobulinemia.................................................................................1

1.1.2. Incidences, Demographics, and Etiology........................................................................2

1.1.3.Diagnosis……...…………………...................................................................................3

1.1.4. Clinical Features………………………………………………………………...……...4

1.1.5. Laboratory and Pathological Findings……………………………………..…………...7

1.1.6. Molecular Pathology.......…………….............................................................................9

1.1.6.1. Genetics…………..…………………………………………………………....9

1.1.6.2. Epigenetics……………………...…………………………………………….13

1.1.6.3. Microenvironment…...………………………………………………………..14

1.1.7.WM Current Treatments………………….…………….……………………………...15

1.2. PRIMA-1met……………………………………………………………………………....21

1.2.1. P53 and Apoptosis……………………………………………………………………...21

1.2.2. PRIMA-1met………...………………………………………………………………...25

1.3. Rationale, Hypothesis, and Experimental Aims…………………………………………….30

v

Chapter 2: PRIMA-1met Induces Apoptosis in Waldenström’s Macroglobulinemia

Independent of p53:.……………………………………………………………………………32

2.2. Introduction ...........................................................................................................................32

2.3. Results …................................................................................................................................34

2.4. Discussion… ..........................................................................................................................42

2.5. Materials and Method……………………………………………………………………….44

2.6. References…………………………………………………………………………………...46

Chapter 3: Discussion……………….………………………………………………………….50

Chapter 4: Conclusions and Future Directions………………………………………………56

References .....................................................................................................................................61

vi

List of Table

Table 1: p53- activating small molecule drugs utilized in hematological malignancies………………………24

vii

List of Figures

Figure1: B cell maturation in WM……………………………………………………………...5

Figure2: Clinical features of WM……………………………………………………………….7

Figure3:MYD88L265 activation of NF-κB pathway…………………………………………11

Figure4: Mechanism of p53 driven intrinsic apoptotic pathway…………………………….22

Figure5: PRIMA-1met structure and mode of action……………………………………...28

Figure 6: Proposed mechanism linking PRIMA-1met induced P73 and ROS production..60

Paper Figures:

Figure1: The effect of PRIMA-1met on viability of WM cell lines and patient samples..…36

Figure 2: The apoptotic effect of PRIMA-1met in WM cell line.............................................37

Figure3: The effect of PRIMA-1met on apoptotic signaling in BCWM-1 cells………………….37

Figure 4: Anti-tumor activities of PRIMA-1met in WM cells…………………………………………..38

Figure5: Effects of PRIMA-1met in combination with current WM therapeutics……………39

Figure 6: PRIMA-1met cytotoxicity is P53-independent……………………………………………………40

Figure7: PRIMA-1met effect on BCWM-1 survival is P73-dependent…….………………………..41

viii

List of Abbreviations

AML Acute Myeloid Leukemia

aCGH Array-based Genomic Hybridization

Apaf-1 Apoptotic protease activating factor 1

ASCT Autologous Stem Cell Transplants

AS-PCR Allele Specific Polymerase Chain Reaction

Bax Bcl-2 associated x protein

Bcl-xL B-cell lymphoma-extra Large

Bcl-2 B-cell lymphoma 2

BMNC Blood Mononuclear Cell

BMSC Bone Marrow Stromal Cells

BTK Bruton's Tyrosine Kinase

CAD Caspase-Activated DNase

CAN Chromosomal Numerical Abnormalities

CXCR4 C-X-C Receptor type 4

CR Complete Remission

GLS2 Glutaminase

G6PD Glucose-6-Phosphate Dehydrogenase

HSP70 Heat Shock Protein 70

IAP Inhibitors of Apoptosis Protein

Ig Immunoglobulin

IPSSWM

International Prognostic Staging System for Waldenstrom’s

Macroglobulinemia

IRAK Interleukin-1 Receptor-Associated Kinase

MDM2 Mouse Double Minute 2

MGUS Monoclonal Gammopathy of Undetermined Significance

MM Multiple Myeloma

MPT Mitochondrial Permeability Transition

MQ Methylene quinuclidinone

ix

MR Minor remission

MYD88 Myeloid Differentiation Primary response gene 88

NADPH Nicotinamide Adenine Dinucleotide Phosphate

ORR Overall Response Rate

PBMNC Peripheral Blood Mononuclear Cell

PRIMA-1 P53- dependent reactivation and induction of massive apoptosis

PRDM1 PR Domain Zinc Finger Protein 1

Puma P53 upregulated modulator of apoptosis

REAL Revised European-American Lymphoma

ROS Reactive Oxygen Species

SDF-1 Stromal Cell-Derived Factor-1

SCID Sever Combine Immunodeficient

Smac/DIABLO Second Mitochondria-derived Activator of Caspases/ Direct

IAP- Binding protein with Low PI

TNF Tumor Necrosis Factor

TNFAIP3 Tumor Necrosis Factor Alpha-Induced Protein 3

VGPR Very Good Partial Remissions

WM Waldenström's Macroglobulinemia

WHO World Health Organization

XBP1 X-box Binding Protein 1

1

Chapter 1

Introduction

1.1. Waldenström's Macroglobulinemia

1.1.1. What is Waldenström's Macroglobulinemia?

Waldenström's Macroglobulinemia (WM) is a chronic B-cell lymphoproliferative

malignancy (Gertz,2012).It was first described by Dr. Jan Gösta Waldenström, a

Swedish internist, in two patients who presented oronasal bleeding, anemia,

lymphadenopathy, hypergammaglobulinemia, an elevated sedimentation rate,

hyperviscosity, normal bone survey, cytopenias, and a predominantly lymphoid

involvement of the bone marrow (Shaheen et al. , 2012). Today, the World Health

Organization (WHO) defines WM as a lymphoplasmacytic lymphoma

characterized by plasmacytic infiltration of bone marrow and immunoglobulin M

(IgM) monoclonal gammopathy (Shaheen et al., 2012). Malignant cells in WM

are quite various cytologically ranging from small lymphocyte to plasmacytoid

lymphocytes and plasma cells (Naderi and Yang, 2013). These cells originate late

in B cell development after somatic hypermutation but before final differentiation

to plasma cells (Jenz, 2013). Common symptoms of WM includes: fatigue due to

anemia, thrombocytopenia, hyperviscosity symptoms and in more severe cases of

the disease; organomegaly, neuropathy and symptoms associated with Ig

deposition (Treon, 2013).

Historically, any type of lymphoma with high levels of Igs was associated with

WM; therefore, it was popular to consider WM as a clinical syndrome that is

associated with various lymphoma types instead of a separate disease (Shaheen et

al., 2012). Until a few years ago, differential diagnosis of WM was quite difficult

for hematopathologists both due to inefficient definitions of the disease and lack

of proper diagnostic tools. In 1994, the Revised European-American Lymphoma

(REAL) classification defined Lymphoplasmacytic Lymphoma (LPL) as “a

2

diffuse proliferation of small lymphocytes, plasmacytoid lymphocytes and plasma

cells, with or without Dutcher bodies” (Harris et al., 1994). This definition

included most cases of WM but most hematopathologists considered it to be too

broad and not helping with differentiating LPL from the newly recognized

marginal zone B-cell lymphoma. WHO’s 2001 definition of WM was even more

confusing since it categorized it as a “neoplasm of small B cells, plasmacytoid

lymphocytes, and plasma cells, usually involving the bone marrow, lymph nodes,

and spleen, and commonly associated with hyperviscosity symptoms and with Ig

levels beyond 3g/dL” (Berger et al. 2001). This definition allowed the monoclonal

protein to be IgG and IgA as well as IgM and did not address the issue of low

levels of Ig in initial stages of WM or the fact that diagnosis based on Ig levels

makes differentiation of WM from non malignant Monoclonal Gammopathy of

Undetermined Significance (MGUS) impossible (Shaheen et al., 2012). Based on

the work done by clinicians at the second international workshop on WM, the

most recent definition of the disease published by WHO in 2008 is: “an LPL

involving the bone marrow and associated with any level of IgM which involves

the bone marrow in an intertrabecular pattern and typically has a mature B-cell

immunophenotype therefore lacking CD5 and CD10 on the cell surface”(

Swerdlow et al. 2008). New technological advances in genetic testing such as

Allele Specific Polymerase Chain Reaction (AS-PCR) in combination with recent

findings linking Myeloid Differentiation Primary response gene 88 (MYD88)

mutations and WM, which we will be more fully discussed later on in this

chapter, have helped with a more accurate means to diagnose WM patients today.

1.1.2. Incidences, Demographics, and Etiology

WM is a rare incurable disease with 1500 new cases per year in USA which is

equal to 3-5 persons per million per year ( Swerdlow et al. , 2008). It accounts for

1% to 2% of all non-Hodgkins lymphomas ( Fonesca and Hayman, 2007). The

median age of incidence is late sixties to early seventies and is more common

among males than females with a ratio of 1.2 up to 2 reported in different studies

(Swerdlow et al. , 2008; Fonesca and Hayman, 2007) . Caucasians seem to be

3

more prone to WM compared to their African-American counterparts (Swerdlow

et al., 2008). Reports indicate an increase in WM incidence in the past two

decades (Wang et al., 2012). The annual percentage-change for this population is

1.01% per year. However, significant annual percentage-change increases were

seen in the group aged 70 – 79 at 1.24% per year (Wang et al., 2012). WM overall

survival was initially reported to be 5 years but the more accurate representative

of WM population is the disease-specific survival which is 11 years (Dimopoulos

et al., 1999; Ghobrial et al., 2006).

The etiology of WM is largely unknown. Although some studies reported

autoimmunity and hepatitis C viral infections to increase the incidence of WM,

others have rejected these claims; therefore, no definite links between any

environmental or habit-related factors and WM have been drawn so far

(Kristinsson et al., 2009; Pozzato et al., 1994). Most cases of WM are sporadic

and only 20% of the cases are familial. Patients with MGUS have 200-fold higher

chances of developing WM; hence, MGUS is considered a precursor for WM

(Kyle et al., 2011; Treon et al., 2006)

1.1.3. Diagnosis

To establish the diagnosis of WM, both high levels of IgM and histological

evidence for lymphoplasmacytic involvement of the bone marrow is required

(Buske et al., 2013). Therefore, detection of IgM without the histopathological

evidence or vice versa does not fulfill the criteria for WM. Presence of IgM

hyperviscosity is confirmed by immunofixation and its level is measured either by

densitometry or serum nephelometry (Ansell et al. 2010). Lymphoplasmacytic

cells should be documented through bone marrow aspirations and

immunophenotyped for presence of CD19, CD20, CD22 and CD79a (Gertz,

2012). Detection of MYD88 L265P mutation is also an additional tool to

differentiate WM from rare cases of IgM multiple myeloma, MGUS, and splenic

marginal zone lymphoma (Treon and Hunter, 2013).

4

1.1.4. Clinical Features

The clinical features of WM are quite variable. Around 30% of WM population

have what is called “smoldering WM”, meaning, they do not have any signs or

clinical symptoms (Figure 1) (Treon, 2013). This group does have higher than

normal IgM levels and bone marrow neoplastic involvement but neither of these

lead to any organ damage or symptoms. The remaining 70% are symptomatic

patients but their symptoms ranges quite variously (Figure 2). Some only have

non-specific symptoms such as weight loss, fatigue and or anorexia. The rest will

have symptoms resulting from one of the following four mechanisms: 1) tissue

infiltration by lymphoma, 2) serum hyperviscosity, 3) autoantibodies, and 4) IgM

deposition in tissues (Shaheen et al, 2012).

Symptoms resulting from tissue invasion by tumor cells are diverse and based on

the affected tissue. The bone marrow is always involved by lymphoplasmacytic

cells. In 50% of cases WM cells contain Dutcher bodies and usually invade the

bone marrow in an interstitial/nodular pattern without causing any lytic bone

lesions (Buske et al., 2013). Tumor infiltration in the bone marrow generally

results in anemia. Other factors such as deregulated interleukin-6 (IL-6) and

increased plasma volume are also involved in causing normocytic and

normochromatic anemia (Ansell et al., 2010). In few cases thrombocytopenia or

leucopenia also occur as a result of extensive bone marrow take over by WM.

15% to 20% of WM patients develop lymphadenopathy with paracortical and

hilar infiltrations as well as moderate involvement of marginal sinuses (Shahin et

al., 2014). Hepatomegaly and splenomegaly occur in approximately 10% of

patients; and a very small subset of patients develop other extranodal sites of

disease such as lungs, bowels and stomach (Treon et al., 2014b). At the time of

relapse, organomegalies such as lymphadenopathy and hepatosplenomegaly

become very common, in up to 50% of WM patients (Shaheen et al., 2012)

5

Figure1: B cell maturation in WM. WM cells originate late in B cell

development after somatic hypermutation but before final differentiation to

plasma cells.

About 10% of patients show symptoms of hyperviscosity (Lin and Medeiros,

2005). IgM pentamers are secreted by WM cells in to the blood and these

macromolecules block the small vasculature leading to the rupture in unsupported

veins and vascular infarcts (Shaheen et- al., 2012). Symptoms of hyperviscosity

occur at serum viscosity above 3cp and its clinical presentation includes mucosal

bleeding, loss of visual acuity due to retinal bleeding, and cerebrovascular

accidents (Gertz, 2013). Owing to the unique physicochemical characteristics of

paraproteins, patients with the same IgM levels can have remarkably different

viscosities and symptoms; consequently, serum viscosity is not an accurate

predictor of the severity of the disease (Shaheen et al., 2012)

IgM paraprotein can also act as an autoantibody leading to severe anemia and

neurological manifestations. IgM paraprotein can bind to a number of neuronal

antigens such as myelin-associated proteins and cell surface glycolipids and

glycoproteins (Janz, 2013). Approximately, 50% of patients develop peripheral

6

neuropathy that is sensory and distal, while 10% develop autoantibody related

encephalopathy (Janz, 2013). IgM paraprotein can also bind to red blood cells

causing hemolytic anemia. Another reason for mucosal bleeding in WM is the

excess IgM attacking the platelets and von Willebrand factor that are involved in

coagulation process (Dimopoulos et al., 2000). IgM paraprotein can rarely bind to

basement membranes resulting in glomerulonephritis and retinitis leading to renal

failure and loss of vision acuity. There have been also reports of peptic ulcer or

protein losing enteropathy in WM patients which is believed to be due to

paraprotein binding to gastric parietal cells (Fonesca and Hayman, 2007).

Cryoglobulins and cold agglutinin disease in WM patients are two other

symptoms resulting from paraprotein binding to self (Stone, 2011)

Figure2: Clinical features of WM. WM patients are quite various in their

clinical presentation. Some are asymptomatic and the rest have a range of

different symptoms resulting from tissue infiltration by lymphoma, serum

hyperviscosity, autoantibodies, and IgM deposition in tissues. (Adapted from

Treon, 2013)

7

IgM deposition in tissue is the least common indication of WM. Amyloidosis,

skin plaques, diarrhea and proteinuria are only some of the consequences of IgM

deposits (Shaheen et al., 2012).

1.1.5. Laboratory and Pathological Findings

Characterizing the paraprotein is quite essential in the lab workup of WM

patients. A serum protein electrophoresis should visualize an M spike in

gammaglobulin region (Gertz, 2012). As mentioned before, serum IgM level

above 5g/dl as well as viscosity beyond 3cp are required for the diagnosis of WM

(Ansell et al., 2010). Up to 80% of patients with WM have monoclonal

immunoglobulin light chains (Bence-Jones proteins) in their urine (Morel and

Merlini, 2012). Laboratory evaluations should also include β2 microglobulin

measurements since its increased level has been associated with poor prognosis

(Anagnostopoulos et al., 2006). In general, the following features are proposed to

be adversely affecting prognosis in WM patients: age >65 years, hemoglobin

7 g/dL (Morel et al., 2009). These factors are usually

considered for risk stratification of the patients and treatment planning.

Complete blood count in WM patients usually indicates leukocytosis,

thrombocytopenia, and anemia (Treon, 2014b). In addition to cytopenia, WM

patients’ blood smear usually exhibit a purplish blue background due to the excess

paraprotein in serum taking up the Giemsa staining. Erythrocytes also form

clusters as the result of their sticky surfaces due to their surfaces being coated by

the paraprotein (Shaheen et al., 2012). Bone marrow smears on the other hand can

be either normal in respect to number of cells or overly crowded with virtually all

nucleated cells being lymphocytes (Shahin et al., 2014). As mentioned earlier,

bone marrow invasion patterns by neoplastic cells is either intertrabecular or

interstitial. Both cytoplasmic (Russell bodies) and nuclear (Dutcher) inclusions

are commonly detected in these neoplastic cells. Lymphocytes can present a range

of cytological variations in WM, ranging from small lymphocytes to plasmacytoid

8

lymphocytes or even cells resembling mature plasma cells (Remstein etal., 2003).

These plasma cell-like cells are usually few in number unless the disease is

transforming to a more aggressive form of lymphoma. As expected, a correlation

between IgM levels in the blood and neoplastic plasma cell numbers in the bone

marrow was observed in WM (Ansell et al., 2010). Various proportion of each of

these three types of B-cells has been reported by different pathologists and can

potentially be an indication of differences in disease aggressiveness; however, the

prognostic value of these differences has not yet been proven (Shaheen et al.,

2012)

In the lymph nodes, the pattern of involvement is quite variable but they never

show any evidence for marginal zone involvement. Cytologically, the neoplastic

cells in the lymph nodes show the same cytologic spectrum that is observed in the

bone marrow and Dutcher bodies can be numerous (Sewerdlow et al., 2008). The

patterns of invasion in extramedullary regions include around the portal tracts in

the liver and surrounding the white pulp nodules in the spleen. Extranodal regions

such as skin, gastrointestinal tract and lungs can also be involved and it is usually

an indication of disease progression or relapse (Lin et al., 2003)

1.1.6. Molecular Pathology

Despite recent efforts to clarify the molecular mechanism of WM pathogenesis,

the molecular basis of WM initiation and progression is not quite understood.

Attempts to illuminate the molecular pathology of WM can be categorized in 3

groups: genetics, epigenetic, and microenvironment.

1.1.6.1. Genetics

Historically, WM cells’ slow proliferating nature was one of the main challenges

for the scientific study of the genetic basis of the disease. This obstacle was

overcome through the technological advances of sequencing in the past century

(Binachi et al., 2013). Recent whole-genome sequencing techniques such as

Array-based Genomic Hybridization (aCGH) and massively parallel DNA

9

sequencing are two of the techniques used for high resolution analysis of WM

patients’ genome without the need for tumor cell division. In a recent array-based

comparative genomic hybridization study, 83% of newly diagnosed WM patients

showed altered genome with a median of 4 Chromosomal Numerical

Abnormalities (CNA) per case (Poulain et al., 2013a). Low prevalence of biallelic

deletions and high-level amplifications has allowed experts in the field to

categorize WM as a simple cancer that genetically is more closely related to

Chronic Lymphocytic Leukemia (CLL) than to Multiple Myeloma (MM) (Poulain

et al., 2013a; Chng et al., 2006). CNAs were found to be more frequent in

symptomatic WM patients in comparison to smoldering patients. Gain of 4q and

deletion of 13q are two abnormalities that were also more frequent in

symptomatic cases (Poulain et al., 2013a). Furthermore, a genome-wide linkage

analysis between WM and IgM MGUS patients identified a high linkage on 4q33-

q34, denoting both linkage and common susceptibility factors in both diseases

(Kyle et al., 2011). Based on the latest findings, two of the most frequently

mutated genes identified in WM are MYD88 and C-X-C Receptor type

4 (CXCR4) (Binachi et al., 2013).

Treon and colleagues initially reported MYD88 mutation in high frequency in 30

WM patients which was later confirmed by many groups around the globe (Treon

et al., 2012; Poulain et al., 2013a; Xu et al., 2013). In this study, next generation

sequencing detected a MYD88 mutation that was a single nucleotide change,

T→C, leading to a leucine to proline switch at amino acid 265. The frequency of

the MYD88 L265P mutation among familial and sporadic cases was 100% and

86% respectively. Only 4 patients had acquired homozygous mutations and the

rest were heterozygous with the mutation expressing in both CD19+ and CD138+

cells (Treon et al., 2012). Knockdown and inhibition studies of MYD88 L265P

associates it with cell survival promotion by spontaneous assembly of Interleukin-

1 Receptor-Associated Kinase (IRAK) 1 and 4, leading to IRAK1

phosphorylation by IRAK4 and activation of NF-κB (Figure3) (Yang et al., 2013).

Bruton's Tyrosine Kinase (BTK) is another downstream target of MYD88 L265P

10

which was shown to activate the NF-κB independent of IRAK pathway.

Simultaneous inhibition of BTK and IRAK led to a stronger inhibition of NF-κB

Figure3:MYD88 mutation in WM. More than 90% of WM cases bear MYD88

L265P mutation which results in IRAK1 phosphorylation by IRAK4 and

activation of NF-κB..Given the frequent mutation in various members of NF-κB

pathway, NF-κB is considered to be a key player in WM pathology.

and synergistic killing in WM cells (Yang et al., 2013). Although MYD88 L265P

mutation has been correlated with higher levels of IgM and bone marrow

involvement in WM patient, no significant difference in response rates to

treatment and overall survival was noted (Treon et al., 2014a). AS-PCR studies

have demonstrated MYD88 L265P in 50-80% IgM MGUS cases which suggests

an early oncogenic role in WM pathogenesis for this mutation and that other

genomic events are required for WM disease progression (Landgren and Staudt,

2012)

11

Sanger sequencing identified CXCR4 mutations in 32% of WM patients and

associated it with drug resistance caused by ERK1/2 and AKT overactivation.

98% of CXCR mutant patients also exhibited the MYD88L265P mutation (Hunter

et al., 2014). In a very recent epidemiological study by Treon et al., in 175 WM

patients, MYD88 and CXCR4 status were linked to patient’s clinical presentation

and response to treatment. Patients with MYD88 L265P/ CXCR4 mutant

displayed higher marrow burden, elevated levels of serum IgM, and were more

likely to have symptomatic disease requiring therapy at initial diagnosis (Treon et

al., 2014a)

Similar to many other hematological malignancies, deletion of various regions of

6q was reported in WM, in more than 42% of cases (Schop et al., 2002). PR

Domain Zinc Finger Protein 1 (PRDM1) and Tumor Necrosis Factor Alpha-

Induced Protein 3 (TNFAIP3) are two of the candidate genes of these regions.

PRDM1 has been implicated in repression of cell proliferation and down-

regulation of Paired box Protein 5 (PAX5) and ER stress protein X-box Binding

Protein 1 (XBP1) (Bianchi et al., 2013). TNFAIP3 is a suppressor of NF-κB

pathway. 38% of WM cases have monoallelic while 5% have biallelic inactivation

of TNFAIP3 (Mitsiades, 203). Given all the mutations mentioned so far that target

the NF-κB pathway proteins, NF-κB pathway is believed to be one of the major

players in WM pathology.

1.1.6.2.Epigenetics

miRNAs are small, non-coding, 18-24 nucleotide RNAs, described for the first

time in the nematode Caenorhabditis elegans (Lee et al., 1993) . They play major

roles in regulating mRNA targets involved in development, cell differentiation,

apoptosis, and cell proliferation (He and Hannon, 2004). WM has a specific

miRNA signature that is different from that of their normal counterpart. In a

recent study miRNA-363*, -206, -494, -155, -184, -542-3p demonstrated

increased expression while miRNA-9* was decreased in WM patients (Hodge et

al., 2011)

12

miRNA-155 has been shown both in-vitro and in-vivo to play a pivotal role in the

pathology of WM (Roccaro et al., 2009) . Knock down study of miRNA-155 in

WM illustrated its role as a regulator of cell cycle. miRNA-155 knocked-down

cells had decreased percentage of S phase cells as the result of cyclin inhibition

and p53 overexpression. miRNA-155 silenced cells also exhibited significant

inhibition of migration and adhesion to fibronectin compared to control in WM,

denoting the crucial role of miRNA-155 in migration and expansion of the

malignant cells in the bone marrow (Roccaro et al., 2009).

miRNAs also interfere with the epigenetic machinery by regulating the expression

of DNA methylation enzymes or histone modification complexes (Sato et al.,

2011). Primary WM cells are already characterized by increased expression of

Histone Deacetylase (HDAC)-2, -4, -5, -6, -8, -9, and significant decrease in

expression of Histone Acetyl Transferase-1 (HAT-1) (Roccaro et- al., 2010). WM

cells transfected with pre-miRNA-9*- and anti-miRNA-206 displayed an

upregulated acetyl histone-H3 and H4 as a result of HDAC regulation that led to

reduction in cell proliferation and increase in cell toxicity in WM (Roccaro et al.,

2010).

1.1.6.3.Microenvironment

Bone marrow is the main tissue involved by WM. Bone marrow’s structure is

quite complex in that it contains cells from various lineages (e.g. stromal, mast,

and epithelial cells) and blood vessels that support and maintain the hematopoietic

lineage (Nagasawa, 2006). This microenvironment plays a pivotal role in B-cell

homing and expansion (Ghobrial and Witzig, 2004 ). Various components of

bone marrow microenvironment have been implicated in WM tumor growth,

survival and drug resistance by several studies (Ngo et al., 2008; Poulain et al.,

2009; Tournilhac et al., 2006).

13

WM cells co-cultured with stromal cells leads to resistance to therapeutic agents

such as bortezomib and other proteasome inhibitors (Ngo et al., 2008). Tournhilac

et al. demonstrated that WM co-cultured with mast cells leads to cell proliferation

and expansion (Tournilhac et al., 2006). Furthermore, WM patients have a 30-

40% increase in bone marrow vascular density and primary WM endothelial cells

present a higher expression of ephrin-B2, an important regulator of cell motility,

suggesting an important role for endothelial cells in WM pathology (Terpos et al.,

2009).

On the other hand, WM cells themselves have been shown to express high levels

of chemokines and adhesion receptors such as CXCR4. CXCR4 is essential for

the migration of WM cells and its knockdown leads to inhibition of migration,

transendothelial migration and adhesion of WM cells (Ngo et al., 2008). Stromal

Cell-Derived Factor-1 (SDF-1) is a CXCR4 ligand primarily produced by stromal

cells. The major biological effects of SDF-1 are related to the ability of this

chemokine to induce motility, adhesion, and secretion of angiopoietic factors

(Kucia et al., 2004). Similar to increased expression of CXCR4, SDF-1 levels in

the bone marrow of WM patients was significantly higher compared with that of

normal controls (Ngo et al., 2008). CXCR4/SDF-1 interaction promotes activation

of some very important signaling pathways such as focal adhesion kinases,

MAPK, ERK-1, PI3K, AKT, PKC, and NF-κB pathways (Kucia et al., 2004).

Proteomic studies have already demonstrated an increased Akt expression in WM

as well as elevated expression of ERK pathway proteins; taken together,

CXCR4/SDF-1 interaction seems to play a significant role in WM biology

(Mitsiades et al., 2003).

1.1.7.WM Current Treatments

The diversity in clinical presentations and lack of effective therapies for WM

patients has made planning the right treatment approach a challenging task for the

clinicians. Based on risk factors that we already discussed in section 1.1.5,

14

International Prognostic Staging System for Waldenström's Macroglobulinemia

(IPSSWM) categorizes WM patients in 3 groups with significantly different 5-

year survival rates: low risk (87%), mid risk (68%) and high risk (36%) (Morel et

al., 2009). These categorizations as well as the consideration of chronic nature of

the disease are helpful tools for deciding on the correct method of treatment.

Patients with smoldering WM are managed with a watch-and-wait approach and

do not require any therapies (Morel et al., 2009). In Garcia-Sanz et al. study, more

than 50% of smoldering cases did not require therapy for almost 3 years and 1 in

10 patients did not require therapy for 10 years (García-Sanz et al., 2001). Only

WM patients who show symptoms are administered treatments and in WM these

symptoms include : constitutional symptoms including fever, night sweats or

weight loss, lymphadenopathy or splenomegaly, hemoglobin

15

rituximab (FCR) regimen. The Overall Response Rate (ORR) associated with this

combination therapy was 79%, including 11.6% Complete Remission (CR) and

20.9% Very Good Partial Remissions (VGPR). Despite the favourable results,

myelosuppression in 45% of cases led to discontinuation of the treatment in most

patients (Tedeschi et al., 2012). Nucleoside-analogue treated WM cases have an

increased incidence of transformation to non-Hodgkin’s lymphomas and the

development of myelodysplasia which limits their use (Ansell et al., 2010). In

another combination therapy, combination s of dexamethasone, rituximab, and

cyclophosphamide (DRC) resulted in an ORR of 83% in previously untreated

WM patients, of which 7% were CR and only 9% of patients experienced grade 3

or 4 neutropenia (Dimopoulos et al., 2007). In a recent trial, 34 WM patients were

treated with rituximab, cyclophosphamide, doxorubicin hydrochloride,

vincristine sulfate, and prednisone (R-CHOP ) and 30 patients with CHOP with

no rituximab. Patients receiving R-CHOP exhibit a longer time of progression

compare to CHOP treated group and had a significantly higher ORR with no

major differences in general toxicity (Buske et al., 2009). There is a consensus

that an alternative rituximab and chemotherapy combination regimen should be

used if the relapse occurs within the first year, which means that if in the first

round rituximab was used in combination with a purine analogue, after the relapse

it should be used in combination with an alkylating agent or vise versa (Ansell et

al., 2010). Treon et al. reported an ORR of 83.3% in 30 relapsed WM patients

treated with bendamustine in combination with rituximab (BR). The only down

side of this combination was that it showed an increased myelosuppression in

patients who had previously been treated with nucleoside analogs as was expected

(Treon et al., 2011).

Bortezomib which is a first generation proteosome inhibitor is a novel WM

treatment that exerts its effect through inhibition of NF-κB pathway (Treon,

2013). As it was eluded to , NF-κB pathway plays an important role in WM

pathology, therefore, bortezomib single or combination treatments has been quite

effective in managing WM patients (Treon, 2013). In a clinical trial bortezomib,

16

dexamethasone, and rituximab (BDR) combination was administered to 23

previously untreated symptomatic WM patients, ORR was measured to be 96%

with 3 patients in CR, 2 near CR, 3 VGPR, 11 PR, and 3 MR. In this study, 30%

of patients exhibited grade 3 peripheral neuropathy (Treon et al., 2009b). A

separate study by Ghobrial et al. reported an ORR of 88% in a bortezomib and

rituximab (BR) combination on symptomatic WM. This study did not show any

grade 3 or 4 neuropathies and its most significant side effect was neutropenia

(Ghobrial et al., 2010a). In comparison to R-CHOP, BR treatment resulted in

fewer relapses, was better tolerated, and was associated with a longer progression

free survival, despite identical response rates. In another study, single agent

bortezomib in relapsed or refractory WM patients resulted in 78%-85% Minor

remission (MR) or greater in patients with relapsed or refractory WM (Chen et al.,

2009). The only down fall of bortezomib is its neurotoxicity which makes it

especially unsuitable for patients with pre-existing neuropathies making it an

unsuitable frontline treatment for low to mid risk WM patients ( Ansell et al.,

2010). Bortezomib is not myelotoxic, and long-term follow-up in Waldenström

patients did not show any risk of the disease developing to higher grade

malignancies as happens in nucleoside-based treatments (Treon, 2013).

Autologous Stem Cell Transplants (ASCT) is another option for WM treatment

that is only used on younger patients with aggressive cases who had not been

previously treated with nucleoside-based treatments. In a retrospective analysis of

158 WM patients who underwent ASCT, the overall survival was 68.5% and

nearly 50% of the patients remained progression free after 5 years. Non-relapse

mortality rate for this group was as low as3.8%, making ASCT a viable option for

WM treatment (Kyriakou et al., 2010a). Unlike ASCT, Allograft Stem Cell

Transplantation (alloSCT) was discovered to be quite risky and 30% of these WM

patients experience non-relapse mortality; therefore, its use has been limited to

clinical trial settings (Kyriakou et al., 2010b).

17

In light of recent molecular findings about WM pathogenesis, many novel

therapeutics are either being tested in clinical trials or are on their way to a

clinical trial. Next generation monoclonal antibodies and proteosome inhibitors,

immunomodulators, mTOR inhibitors, Bruton tyrosine kinase inhibitors, and

HDAC inhibitors are some examples of these novel therapies (Leblebjian et al.,

2013).

Ofatumumab (OFA) is a monoclonal antibody against both the large and small

extracellular loops of CD20. In OFA trials as a single-agent in 37 relapsed WM

patients, an ORR of 59% with a lower incidence of IgM ‘flare’ as compared to

rituximab was achieved and developing infections was its only side effect (Gupta

and Jewell, 2012).

Carfilzomib is a second generation proteosome inhibitor which is proven to be

non-neurotoxic. In a recent phase II trial, a combination of carfilzomib, rituximab

and dexamethasone was administered to 20 mostly untreated WM patients. The

ORRs and major response rates were 75% and 50% respectively, with 1 VGPR, 9

PR, and 5 MR. All drug related toxicities were reversible and, except in one

patient with a grade 2 peripheral neuropathy, there were no neuropathological side

effects (Treon et al., 2014b).

Thalidomide and lenalidomide, two immunemodulators, have also been studied

on WM in hopes to potentiate rituximab-mediated cytotoxicity. Despite 50-75%

ORRs, combining rituximab with both thalidomide and lenalidomide were

accompanied by severe toxicities (Treon et al., 2008; Treon et al., 2009a). In the

case of lenalidomide, the trial was stopped after almost all the patients developed

significant anemia (Treon et al., 2009a). It is believed that optimization of the

dose and protocol used are required for its future use in WM; therefore, phase I

trials of lenalidomide are underway (Leblebjian et al., 2013).

.

18

Considering the elevated levels of several proteins from the Akt/mTOR pathway

and their role in tumor survival in various hematological malignancies,

everolimus, an mTOR inhibitor has also been studied in 50 patients with relapsed

or refractory WM (Mitsiades et al., 2003). Everolimus ORR in WM was 70%

with PR of 40% and MR of 30%. The most important adverse effects observed

were cytopenias and pulmonary infections (Ghobrial et al., 2010b). In another

study, the combination of everolimus, bortezomib and rituximab was investigated

in relapsed/refractory patients and showed an ORR of 74% with 5%CR, 30%PR,

and 39% MR. The major side effects included 24% anemia, 15%

thrombocytopenia and 15% neutropenia (Ghobrial et al., 2011).

Finally, given the very recent discovery of MYD88 and BTK’s role in WM

pathology, ibrutinib, a BTK inhibitor, has become the subject of several clinical

trials. Ibrutinib was initially found efficacious in managing hematological

malignancies in a trial investigating its effect on a variety of B-cell malignancies

including WM (Advani et al., 2013). In a more recent phase II trial on 63 relapsed

WM patients with average 2 previous treatments, ibrutinib was able to induce

81% ORR with PR or better of 57.1% and a fast response time. No neurological

toxicity was observed and two of the more frequent side effects of the treatment

were thrombocytopenia (14.3%) and neutropenia (19.1%) (Treon et al., 2013).

Despite the significant advances in regards to WM therapeutics, studies have not

demonstrated any improvement in the patients’ outcome over the last 25 years

(Kristinsson et al., 2013). WM remains an incurable disease with currently

available therapy, and the quest for finding a more effective therapeutic approach

continues.

1.2. PRIMA-1met

1.2.1. p53 and Apoptosis

p53 is a transcription factor which takes part in various cellular processes such as

cell-cycle arrest, senescence, apoptosis and metabolism. As a stress sensor, p53

19

plays a pivotal role in transmitting stress-induced signals in order to restrict the

cell proliferation in the wake of DNA damage, oncogenesis, and hypoxia. In fact,

in order to divest the cell of its anti-tumoregenic effects, in approximately 50% of

human cancers, p53 gene is mutated and in the majority of the rest it is

deactivated through alternative mechanisms such as overactivating p53 inhibitors

or silencing its co-activators ( Bieging et al., 2014).

In normal conditions, p53 has a very short half life due to the activity of its E3

ligase Mouse Double Minute 2 (MDM2), leading to p53 proteosomal degradation.

p53 is activated by both external and internal stimuli that promote its nuclear

accumulation. p53 activation involves stabilization of the protein and

enhancement of its DNA binding (Yee and Vousden 2005) . The sum of the

pathways induced by p53 activation will determine whether the cell will undergo

growth arrest or apoptosis. The latter is shown to be crucial for p53 suppression of

tumors (Haupts et al., 2003).

Apoptosis is a recognized mechanism of programmed cell death. It is both a

homeostatic mechanism to maintain cell populations and a defense mechanism in

reaction to cell damage (Elmor, 2007). Apoptosis is a complex cascade of events

that primarily involves activation of a group of proteases called caspases. The

mechanism of apoptosis is very complex and is composed of two main pathways:

extrinsic or death receptor pathway and intrinsic or mitochondrial pathway

(Figure 4). These two pathways in the end converge and cleave caspases 3,7, and

6 resulting in DNA fragmentation, degradation of cytoskeleton, formation of

apoptotic bodies, and expression of cell surface ligands for phagocytic cell

(Haupts et al., 2003). Caspase 3 is the main executioner caspase which is

activated by all initiator caspases. It activates the endonuclease Caspase-Activated

DNase (CAD) which degrades chromosomal DNA. Caspase 3 also reorganizes

and disintegrates the cell into apoptotic bodies (Elmore, 2007).

20

The extrinsic pathway of apoptosis involves activation of death receptors that are

members of the Tumor Necrosis Factor (TNF) receptor superfamily. Upon TNF

activation a death-inducing signaling complex is formed leading to autolytic

activation of initiator caspase, caspase 8. Caspase 8 then goes on to catalyze the

activation of caspase 3 (Elmore, 2007). p53 can activate the extrinsic apoptotic

pathway through the induction of genes encoding receptors involved. For

example, p53 may enhance levels of Fas, a member of TNFR family, at the cell

surface by promoting its translocation to the membrane. This may allow p53 to

rapidly sensitize cells to Fas. The type of receptor overexpressed by p53 seems to

be cell type specific (Zilfou and Lowe, 2009).

Mechanism of intrinsic pathway of apoptosis is much more complex. The intrinsic

pathway of apoptosis is based on permeabilization of the mitochondria

membrane. Opening of the Mitochondrial Permeability Transition (MPT) pores

leads to loss of mitochondrial potential and release of pro-apoptotic proteins:

cytochrome c and Second Mitochondria-derived Activator of Caspases/ Direct

IAP-Binding protein with Low PI (Smac/DIABLO). Released cytochrome c

complexes with Apoptotic protease activating factor 1 (Apaf-1) and procaspase 9,

forming an “apoptosome” which activates caspase 9. Smac/DIABLO complex

promote apoptosis by inhibiting Inhibitors of Apoptosis Proteins (IAP) (Galluzzi

et al., 2011).

Mitochondrial membrane permeability is regulated through B-cell lymphoma 2

(Bcl-2) family of proteins. There are 25 genes identified in the Bcl-2 family that

are either pro-apoptotic or anti-apoptotic (Czabotar et al., 2014). Bcl-2 and B-cell

lymphoma-extra large (Bcl-xL) are two examples of anti-apoptotic members of

this family. Downregulation of both Bcl-2 and Bcl-xL in various cancer types has

led to induction of apoptosis or enhancement of chemosensitivity (Yamanaka et

al., 2006; McDonnell and Korsmeyer, 1991). Pro-apoptotic members of Bcl-2

family on the other hand, carry out their function either by neutralizing the anti-

21

apoptotic members or activating the pro-apoptotic effector Bcl-2 associated x

protein (Bax).

Figure4: Mechanism of apoptotic program cell death. Apoptosis is a complex

cascade of events that primarily involves activation of a group of proteases called

caspases. It is composed of two main pathways: extrinsic or death receptor

pathway and intrinsic or mitochondrial pathway. (Adapted from Elmore, 2007)

Bax exerts its effect through opening the mitochondrial membrane channels as

well as forming oligomeric pores (Czabotar et al., 2014). P53 upregulated

modulator of apoptosis (Puma) and Noxa are members of the Bcl-2 family that

22

are pro-apoptotsis. Puma was shown to change Bax conformation and promote its

translocation to the mitochondria (Yu et al., 2001).

Studies on Noxa indicate its interaction and disruption of anti-apoptotic Bcl-2

family members, resulting in the activation of caspase 9 (Oda et al., 2000). p53

has a pivotal role in regulating Bcl-2 family of proteins. Induction of apoptosis by

p53 involves both transcription-dependent and transcription-independent

functions of p53. p53 upregulates pro-apoptotic genes containing p53-responsive

elements such as Puma, Noxa and Bax while down regulating the anti-apoptotic

members Bcl-xL, Bcl-2 and Mcl-1 (Haupt et al., 2003). p53 also directly binds

and activates Bax and inactivates Bcl-xL without the need to regulate their genes(

Geng et al., 2010; Bharatham et al., 2011).

Table 1: p53 activating small molecule drugs

utilized in hematological malignancies. (Adapted from Saha et al., 2013b)

23

Given the tumors suppressive effects of p53, developing means to activate p53

has been subjected to intensive studying. Some of the potential approaches for

cancer therapeutics targeting p53pathway includes: p53 gene therapy, drugs

activating targets of p53, and small molecules activating p53 or disrupting p53

inhibitors (Table1) (Wang and Sun, 2010).

1.2.2. PRIMA-1met

P53- dependent reactivation and induction of massive apoptosis (PRIMA-1) is a

small molecule initially identified in a cell-based assay for screening of chemical

libraries searching the National Cancer Institute database. In this assay, PRIMA-1

was able to induce cell death in osteosarcoma cell line Saos-2 expressing p53

mutant His 273 under a tetracycline driven promoter (Bykov et al., 2002). A

methylated form of PRIMA-1, dubbed PRIMA-1met, was later discovered and

reported to be biologically more active than the original compound (Bykov et al.,

2005). Both compounds’ ability to induce cell death has been confirmed in

several solid tumors and hematological malignancies in-vitro, in-vivo, and ex-

vivo on primary samples (Aryee et al., 2013; Bao et al., 2011; Ali et al., 2011;

Nahi et al., 2008) .

In a break through study, Lambert and colleagues identified the kinetic and

chemical properties of PRIMA-1 and PRIMA-1met (Lamber et al., 2009). It was

reported that half of the starting material of both PRIMA-1 and PRIMA-1MET

was decomposed in 32.6 hr in-vitro. They also identified the decomposition rate

of PRIMA-1 in-vitro and in animal models to be 4h and 1h respectively. PRIMA-

1 was then uncovered to be rapidly excreted into the urine in their mouse model.

Methylene quinuclidinone (MQ) is one of the compounds derived from PRIMA-1

and PRIMA-1met during decomposition. MQ has a double bond which is highly

reactive and prone to nucleophilic additions (Lamber et al., 2009). Thiol groups

are favorable targets for MQ in this reaction. Further investigations confirmed that

production of MQ is essential for PRIMA-1 biological effects. The importance of

24

thiol modification in the apoptotic effects of PRIMA-1 was also proven using

inhibitors of thiol modification. Mutant p53 (mut p53) has many exposed thiol-

containing cysteine residues on its surface making it a suitable target for PRIMA-

1. Formation of disulfide bonds as the result of these exposed thiol groups can

potentially lock mut p53 in an unfolded conformation. Disruption of these

unwanted disulfide bonds by MQ can result in mut p53 proper folding and

efficient binding to DNA (Lamber et al., 2009). Wild-type p53 (wt p53) was also

shown to be able to form bonds with MQ depending on the degree of its unfolded

status (Lamber et al., 2009).

PRIMA-1met has shown great cytotoxicity towards various solid tumors and

hematological malignancies (Zandi et al., 2011; Zache et al., 2008; Ali et al.,

2011). Results from PRIMA-1met recent phase I/II clinical trial in prostate cancer

and several hematological malignancies have also been promising (Lehmann et

al., 2012). Most of PRIMA-1met’s adverse effects were reversible and mild ones

such as fatigue, dizziness, headache, and confusion. No bone marrow toxicity was

detected (Lehmann et al., 2012).

The exact molecular mechanism of PRIMA-1met effects is still elusive and seems

to be quite dependent on cellular context. As was mentioned before, PRIMA-1met

was initially discovered as a mut-p53 reactiving small molecule. Some studies on

breast, colon, and small cell lung cancer cell lines portrayed a mut p53-dependent

mechanism through knock down studies (Lambert et al., 2010; Zandi et al., 2011;

Lambert et al., 2009). Zandi et al. reported PRIMA-1met effects through

activating mut p53 and upregulating its downstream transcriptionally regulated

targets such as p21, MDM2, and Bax in small cell lung cancer (Zandi et al.,

2011). Others have reported nucleolar translocation of p53 and its stabilization by

Heat Shock Protein 70 (HSP70) (Rokaeus et al., 2007). PRIMA-1met also

activates mutant p53 through phosphorylation at its serine 15 and upregulates the

expression of p53 and its proapototic targets, Bax and puma in colorectal cell

lines (Lambert et al., 2010).

25

Despite previous reports of mut p53-dependent effect of PRIMA-1met, Ali and

colleagues described the cytotoxic effect for PRIMA-1met in Acute Myeloid

Leukemia (AML) primary samples to be independent of p53 status (Ali et al.,

2011). The same phenomenon was observed in melanoma cell lines when

PRIMA-1met did not show any significant difference in apoptosis between mut

p53 and wt p53 cell lines both in-vitro and in-vivo (Bao et al., 2011). Recently,

Saha et al. has taken this story one step further and demonstrated that PRIMA-

1met exerted its effect in a p53-independent manner in MM ( Saha et al., 2013a).

In this study, PRIMA-1met was denoted to activate p73 which led to induction of

apoptosis in a Noxa- dependent fashion (Saha et al., 2013a). A study conducted

by Tessoulin et al. confirms Saha et al.’s findings in regards to p53-independent

PRIMA-1met –induced apoptosis that is deiven by activation of Noxa (Tessoulin

et al., 2014).

Based on current knowledge of PRIMA-1met chemistry, theoretically, changes in

the activity of any protein containing a thiol group by PRIMA-1met is possible as

long as the structural and sterical context of the thiol group allows such reaction.

Therefore, activating other targets beside p53 that lead to cell death is quite

possible. As highlighted in the previous paragraph, one such possible target was

recently proposed to be p73 (Saha et al., 2013a). Thioredoxin Reductase 1 is

another target which was discovered to be inhibited and converted to an NADPH

oxidase enzyme independent of cell lines’ p53 status leading to an increase in

Reactive Oxygen Species (ROS) production in the cells and consequently their

apoptosis (Peng et al., 2013). Furthermore, Tessoulin and colleagues also

confirmed that disrupting the GSH/ROS balance through impairing glutathione

synthesis in MM plays an important role in PRIMA-1met -induced apoptosis

(Tessoulin et al., 2014). Taken all together, these findings provide an explanation

for the previously observed effects of PRIMA-1met on tumor cells lacking p53.

26

Figure5: PRIMA-1met structure and mode of action: Methylene

quinuclidinone (MQ) is one of the compounds derived from PRIMA-1met during

decomposition. PRIMA-1met was initially discovered in an screening for

compound activating mutp53. Wild-type p53 (wt p53) was also shown to be able

to form bond with MQ depending on the degree of its unfolded status.

27

1.3. Rationale, Hypothesis, and Experimental Aims

Molecular tools that take advantage of apoptotic effects of p53 to eradicate cancer

cells have been greatly researched in hematological malignancies both in the lab

and clinics. PRIMA-1met is one such compound that has shown great killing

abilities against various solid and hematological cancers. Despite the vast number

of studies, given the conflicting reports, we are still in the dark in regards to the

PRIMA-1met mechanism of action (Figure 5). It is therefore paramount that

separate functional and mechanistic studies are conducted for each cancer type

using specific and targeted tools.

On the one hand, current treatments are lacking in managing WM patients and

their side effects are greatly affecting patients’ quality of life. On the other hand,

PRIMA-1met has shown promising results in both pre-clinical and phase I/II

clinical studies in a number of haematological malignancies such as CLL and MM

that are closely related to WM in both clinical presentations and genetic makeup.

Therefore, we hypothesized that PRIMA-1met has anti-tumor activity against

WM cell lines and primary samples. This study is an attempt to provide the pre-

clinical framework for evaluation of PRIMA-1met either alone or in combination

with current therapies as a novel therapeutic approach for treatment of WM

patients.

The aims of this study are:

1) To investigate the anti-tumorigenic effects of PRIMA-1met on WM:

Explore whether PRIMA-1met induces cell death in WM cell line and primary

samples. Examine the mode of PRIMA-1met- induced cell death. Evaluate the

effect of PRIMA-1met on WM cell migration and colony formation.

2) To elucidate the signaling pathway affected by PRIMA-1met: Assess the

expression of apoptotic markers such as PARP and caspase cleavage, p53, and

MDM2 through western blot analysis of lysates from cells treated with PRIMA-

1met.

28

3) To examine the combinatory effect of PRIMA-1met and current WM

therapies: Using the correct concentration range found in Aim 1, determine what

type of drug interactions will PRIMA-1met show in combination with sub-

therapeutic doses of bortezomib or dexamethasone in WM cell line.

29

Chapter2:

PRIMA-1MET Induces Apoptosis in Waldenström's Macroglobulinemia

Independent of p53

Introduction:

Waldenström’s Macroglobulinemia (WM) is a low grade lymphoplasmacytic

lymphoma characterized by infiltration of bone marrow with malignant B cells

and IgM monoclonal gammopathy (Ansell et al., 2010). Reports show an increase

in WM’s incidence over the past 20 years (Gertz, 2012). In US, almost 1500 new

cases of WM are reported annually (Shaheen et al., 2012). WM patients are quite

heterogeneous with respect to clinical presentation, varying from an

asymptomatic to highly aggressive disease, and their responses to treatment.

Given current therapies, WM remains incurable, and most patients eventually

relapse (Gertz, 2013).

P53 is a well-known tumour suppressor protein responding to cellular stresses

through regulating cell cycle, DNA damage repair mechanism and inducing

senescence and apoptosis (Vousden and Prives, 2009; Green and Kroemer, 2009).

At steady state, p53 level is kept substantially low through a tight feedback

regulation by negative regulators such as MDM2 (Choek et al., 2011). Over the

past decade, more than 150 trials exploiting p53 have been conducted taking

advantage of its pro-apoptotic effects on tumor cells (Choek et al., 2011). PRIMA-

1met is a small molecule initially identified as a mutant p53 activator in cellular

screen of a small molecular library (Bykov et al., 2002). PRIMA-1met has shown

promising results in in-vitro and xenograft models of several solid tumours such

as breast, hepatic and colon cancer as well as haematological malignancies closely

related to WM such as CLL (Zandi et al., 2011; Bao et al., 2011; Liang et al.,

2009; Nahi et al., 2008). A recent phase I/II clinical trial of PRIMA-1met in

prostate cancer and AML also demonstrated promising results in terms of toxicity

30

and general tolerance, making it a good candidate for further exploration in other

neoplasias (Lehman et al., 2012). Although initially thought to act through

inducing apoptosis by restoring the wild type conformation to mutant p53(

Lamber et al., 2009), recent evidence points towards its ability to induce apoptosis

irrespective of p53 status or even in a p53-independent manner; therefore, the

exact pathway affected by PRIMA-1met is highly controversial and seems to be

cell type specific (Nahi et al., 2004; Supiot et al., 2008; Ali et al., 2011; Saha et

al., 2013).

To date, the effects of PRIMA-1met in WM have not been explored at either

preclinical or clinical levels. The purpose of the current study is to examine the

anti-tumour effects of PRIMA-1met in WM cells and explore the underlying

mechanism.

Materials and Methods

Patient samples and cell lines

Bone marrow samples were collected from WM patients during routine diagnostic

procedures. This study received written approval from the University Health

Network Research Ethics Board, Toronto, in accordance with the Declaration of

Helsinki. WM cell line, BCWM-1 (Ditzel Santoz et al., 2007), was kindly

provided by Dr. Treon’s lab. This cell line was maintained for no more than 3

months in standard culture medium RPMI 1640 medium containing 10% fetal

bovine serum, 2 mM L-glutamine, 50U/ml penicillin, and 50 µg/mL streptomycin

at 37°C in a 5% CO incubator. Freshly isolated primary WM cells were separated

by Ficoll Hypaque density gradient (Sigma Aldrich, St. Louis, MO, US). To

separate the cells with Ficoll Hypaque, the blood samples were diluted in PBS and

EDTA buffer with 2 in 1 ratio of blood to buffer. 35 ml of this diluted cell

suspension was then carefully layered on 15ml of Ficoll Hypaque and centrifuged

31

at 400×g for 30 minutes at 20˚C. Lymphocyte located at the interface layer were

carefully pipetted out and transferred to a new tube for washing. Then, 3 volume

of buffer used in the first step was added and mixed with the cells by gently

pipetting. The mixture was centrifuged at 100×g for 10 min at 20˚C and the

supernatant was removed. The lymphocyte pellet was again re-suspended in 6ml

buffer and centrifuged at 100×g for 10 min at 20˚C.The pelleted primary WM

cells were re-suspended in above mentioned culture medium and incubated at

37°C in a 5% CO incubator and used the next day for experimentation.

Drug treatment

PRIMA-1metwas purchased from Cayman Chemical and dissolved in dimethyl

sulfoxide (DMSO) to make a 10 mM stock solution and stored at -200 C. In each

experiment, the final DMSO concentration was kept constant and did not exceed

0.05% (v/v). In some experiments, cells were simultaneously exposed to PRIMA-

1met and dexamethasone (Cayman Chemical, Ann Arbor, MI,US) or bortezomib

(Orthobiotech, Horsham, PA,US) . After drug treatment, cells were harvested and

subjected to further analysis as described below.

Cell viability, apoptosis, colony formation and migration assays

Cell viability was assessed by MTT ((3-[4,5-dimethilthiazol-2yl]-2,5-diphenyl

tetrazolium bromide)) (mention the company and address). Briefly, cells were

cultured in 96-well micro-titer plates with different concentrations of the drugs for

48 h. To assess the effect of PRIMA-1met on cell viability and proliferation of

primary samples, 20 × 104 cells/ml and for BCWM-1 cell line, 30 × 104 cells/ml

were cultured in 96-well plates and then treated with the drug for 48 h. After

incubation, MTT (0.5 mg/ml) was added and the cells were further incubated for

an additional 4 h. This was followed by the addition of acidified isopropanol to

the wells and overnight incubation at 37°C to solubilize the dye crystals.

Following incubation, the optical density of the wells was read with a microplate

32

reader set at a test wavelength of 570 nm and a reference wavelength of 630 nm.

In combination treatments both drugs were added to the wells simultaneously and

the treated cells were incubated for 72h. To examine apoptotic cell death, WM

cells were treated with various concentrations of PRIMA-1met for 48h and then

harvested, washed twice with PBS to get rid of PRIMA-1met and stained with

Annexin V-FITC (Abcam, MA,US) and propidium iodide (Sigma-Aldrich, St.

Louis, MO) using the companies protocols for flowcytometric analysis. Becton

Dickinson Canto II FCF 8 color analyzer was used for flowcytometry. Data were

analyzed using FlowJo software. The extent of apoptosis was quantified as

percentage of Annexin-V positive cells. For colony formation assays, WM cells

(5×104 cells/mL) were plated into 6well plates in 1 mL RPMI medium (20% FBS)

containing 1% methylcellulose and maintained with DMSO control or the

indicated concentration of PRIMA-1met. Ten days after plating, the total number

of colonies was calculated and enumerated by morphologic assessment, as

previously described ( Trudet et al., 2007). Migration assays were conducted with

24-well Transwell insert chambers (8 µm insert; Costar, Corning

Inc.,Corning,NY,USA) according to the manufacturer’s instruction. In brief, WM

cells (5×104 cells/mL) in FBS media were added to the upper chamber in the

presence or absence of PRIMA-1met at the indicated concentrations and allowed

to migrate for 8 hours at 37ºC to the lower chamber containing media with 10%

FBS. The migration of control DMSO-treated cells on the Transwell was

normalized to 100%. All the readouts from viability, apoptosis, colony and

migration assays were from measurements of at least three experiments.

Immunoblotting

Western blot analysis was performed to evaluate several protein targets in whole

cell lysates obtained from the cells treated with PRIMA-1met in the absence or

presence of siRNAs. Whole cell lysates were prepared by lysing the cell pellets

for 10 min on ice in a buffer composed of 150 mM NaCl, 50 mM Tris-HCl (pH

33

8.0), 5 mM EDTA, 1% (v/v) Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride

(PMSF), 20 µg/ml aprotinin and 25 µg/ml leupeptin. Protein concentrations were

measured by using a Nano Drop 1000 spectrophotometer (ThermoFisher

Scientific Inc., San Diego, CA, USA). Equal amounts of protein were resolved

using 12% SDS-polyacrylamide gel electrophoresis and transferred to a

polyvinylidene diflouride (PVDF) membrane (Perkin Elmer Inc., Waltham, MA,

USA). After blocking for 1 h at room temperature with PBS containing 3%

bovine serum albumin (BSA), the membrane was incubated with specific

antibodies for at least 1 h at room temperature or overnight at 40C. After washing

the membrane 3×10 minutes, the membrane was incubated with a horseradish

peroxidase (HRP)-labeled secondary antibody for 1 h at room temperature. The

blots were washed again for 3×10 minutes and were developed using a

chemiluminescent detection system (ECL, Perkin Elmer). Primary antibodies

were from the following manufacturers: Santa Cruz Biotechnology (Santa Cruz,

CA,USA): MDM2, P73 (H-79) and β-actin; Biolegend (San Diego, CA,USA):

p53 (DO-7); Roche (Manheim, Germany) : PARP. Goat anti-mouse and anti-

rabbit secondary antibodies conjugated to horseradish peroxidase were purchased

from Cell Signaling Technology (Beverly, MA, USA).

Knockdown of selective target genes

BCWM-1 cells were transfected with target specific siRNAs for p53 (Invitrogen,

Carslbad, CA, USA) or p73 (Invitrogen) or control scrambled siRNA

(Invitrogen) using the Cell Line Solution Kit V (Amaxa, GmbH, Cologne,

Germany) according to the manufacturer's instruction with the Amaxa

Nucleofector II device (Amaxa) Program T-030. Following transfection, cells

were treated with PRIMA-1met using the same steps explained in cell viability

assay and analyzed for its effect on cell viability by MTT assay. These

experiments were done in triplicates. For qPCR analysis of knocked down p73,

cell lysate from knocked down and control scrambled siRNA cells were subjected

to RNeasy qiagen kit for RNA purification using company’s protocol. Resulted

34

RNA was then used to make cDNA using QuantiTect Rev. Transcription kit by

qiagen using their protocol. P73 primer set (Forward: 5′-CACGTTTGA-

GCACCTCTGGA and Reverse: 5′ GAACTGGGCCATGACAGATG) was used

in combination with promega (Madison, WI, USA) GoTaq real time PCR kit for

quantification. GAPDH and 18S are two primers used as the internal control in

these experiments. The resulted read outs were normalized using the internal

controls resulting in Δct. The Δcts were then used for ΔΔct and fold change (2^-

(ΔΔCT) calculations. qPCR experiments were done in triplicates.

Statistical analysis

The synergistic effect [combination index (CI)

35

in the range that was previously reported by our lab to be non-toxic to PBMNCs

and BMMNCs (Saha et al., 2013). To confirm the anti-WM potential of PRIMA-

1met, primary cells derived from two previously untreated WM patients with

more than 90% bone marrow involvement were treated with DMSO control or

increasing doses of PRIMA-1met for 48 hours. Cells were then examined for

viability by MTT assay. A significant decrease in the viability of WM primary

cells was observed with similar or even lower IC50 values as were observed in the

cell line (Figure1). To explore whether this reduction in cell survival in WM cells

was due to apoptosis, we performed Annexin V/PI staining to measure the

percentage of apoptotic cells. PRIMA-1met (25μM) induced more than 50%

apoptosis in BCWM-1 cells which is in complete accordance with the results

obtained from cell survival assay (Figure2).

PRIMA-1met inhibits colony formation and migration in WM cells

Having shown the effect of PRIMA-1met on viability and apoptosis, we next

examined the effects of PRIMA-1met on WM cells migration and colony

formation. PRIMA-1met significantly inhibited colony formation in BCWM-1

cells in a dose-dependent manner (Figure4A, P

36

in a significant decrease in cell survival compared with the single agents (P<

0.005) after 72h treatment (Figure5A and B). When combined with low

concentrations of these drugs, synergistic effects were observed (CI

37

Discussion:

In this report for the first time we demonstrated the anti-tumor activity of

PRIMA-1met in WM cell line and patient samples. Treatment of WM cells with

PRIMA-1met resulted in significant inhibition of viability associated with

apoptosis induction. PRIMA-1met also inhibited colony formation and migration

of WM cells in a dose-dependent manner. These observations pinpoint the

potential antiproliferative and apoptotic effects of PRIMA-1met on WM cells. It

also prompts us to speculate that it may antagonize WM cells viability and

migration in the context of bone marrow microenvironment which is known to

play an important role in WM pathogenesis (Agarwal and Ghobrial, 2013).

Importantly, similar effects of PRIMA-1met have also been observed in other

tumor cell types (Bao et al., 2011; Messina et al., 2012; Aryee et al., 2013)

We found that PRIMA-1met induced apoptosis in BCWM-1 cells was associated

with downregulation of Bcl-xL and cleavage of caspase 9 but not caspase 8 (Data

not shown), implying the activation of intrinsic/ mitochondrial pathway of

apoptosis. These findings are in accordance with previous reports in breast cancer

and melanoma cells treated with PRIMA-1met (Bao et al., 2011; Liang et al.,

2009; Supiot et al., 2008). Although PRIMA-1met was initially discovered as a

p53 reactivating agent (lambert et al., 2009), further studies especially in

hematological malignancies could not confirm the role of p53 in PRIMA-1met-

induced apoptosis (Nahi et al., 2004; Supiot et al., 2008; Ali et al., 2011; Saha et

al., 2013). Our initial western blot analysis did not show any significant change in

p53 level after PRIMA-1met treatment. Furthermore, selective knockdown of p53

may not have a direct role in PRIMA-1met- induced apoptosis of WM cells.

Additionally, the same p53-independent effects of PRIMA-1met was reported by

our group in MM and by others in AML, CLL and prostate cancer cell lines (Nahi

et al., 2004; Saha et al., 2013; Nahi et al., 2006). Interestingly, PRIMA-1met

treatment of WM cells resulted in activation of p73, another member of p53 super

family which shares structural and functional similarities with p53(levrero et al.,

38

2000). p73 is a well-known tumor suppressor which due to its non-mutated state

in most cancers has attracted much attention as a potential drug target. Our knock-

down study also demonstrated that p73-silenced cells did not undergo apoptosis in

response to PRIMA-1met treatment supporting the possible role of p73in PRIMA-

1met-induced appoptosis. Interestingly, the latter results are consistent with the

findings in our previous study in multiple myeloma (Saha et al., 2013). It should

be noted that other possible mediators of PRIMA-1met effects in WM couldn’t be

ruled out, especially in light of recent findings highlighting the significance of

ROS production in PRIMA-1met induced cell death25; thus it would be interesting

to analyze the oxidative stress pathways in PRIMA-1met-treated WM cells in

future studies.

Moreover, we also found down-regulation of anti-apoptotic marker Bcl-xL in

WM cells following PRIMA-1met treatment. This finding together with above-

mentioned cleavage of caspase 9 imply that mitochondrial/intrinsic pathway of

apoptosis may be involved in PRIMA-1met-induced apoptosis in WM cells. In

fact, involvement of latter pathway in PRIMA-1met-induced cell death has been

indicated in lung cancer and MM cells (Zandi et al, 2011;Lambert et al., 2010) .

Nonetheless, further investigation is required to decipher the mechanism of

PRIMA-1met-induced apoptosis in WM cells.

Finally, we showed that PRIMA-1met-induced cell death could be synergistically

enhanced in combination with dexamethasone or bortezomib. It is interesting to

note that both agents are known to inhibit NF-κB which in turn inhibits p53super

family (Mujtaba and Dou, 2011; Distelhorst, 2002) denoting a possible

mechanism underlying the synergistic effects of PRIMA-1met in combination

with dexamethasone or bortezomib.

Taken all together, our findings suggest that treatment of WM cells with PRIMA-

1met leads to induction of p73-mediated, p53-independent apoptosis by down-

regulation of Bcl-xL and possibly through the intrinsic pathway of apoptosis. Our

39

study provides a rationale for a future in-depth investigation into the molecular

mechanism of PRIMA-1met-induced cell death in WM and applying to

established WM xenograft models.

Figures:

Figure1: The effect of PRIMA-1met on WM cell lines and patient samples. The

growth suppressing effect of different concentrations of PRIMA-1met in BCWM

(IC50= 21µM), Patient sample 1 (IC50= 10), Patient sample 2 (IC50= 30) was

studied using MTT assay after 48hour incubation; n= 3, error bars show SEM.

40

Figure 2: The apoptotic effect of PRIMA-1met in BCWM-1 (wild type P53). The

apoptotic effect of different concentrations of PRIMA-1met in BCWM-1 was

studied using Annexin-V/PI Flowcytometry after 48 hour incubation; n= 3, error

bars show SEM. * P=

41

Figure3: The effect of PRIMA-1met in BCWM-1 cells. Total levels of the

indicated proteins were evaluated by Western blot analysis in BCWM-1 cells after

treatment with 50µM PRIMA-1met 1Met at several time points.

42

Figure 4: Anti-tumour activities of PRIMA-1met in WM cells. Dose dependent

decrease in BCWM-1 colony formation abilities was measured by colony assay

after 7 days. Dose dependent decrease in BCWM-1 cell migratory abilities was

measured by Boyden chamber assay after 8 hours of incubation.; n= 3, error

bars=SEM, * P=

43

Figure5: Effects of PRIMA-1met in combination with current WM therapeutics

(A) Synergism was assessed by (CI) combination index analysis for

dexamethasone and RIMA-1 after 72hrs, CI=0.63. (B)RIMA-1met has synergistic

B

44

effects with bortezomib(velcade) on BCWM-1 cells,72hrs,CI=0.85.Error

bars=SEM, ** P=

45

Figure7: PRIMA-1met cytotoxicity is P73 dependent. (A) si-p73 knock down

was confirmed by q-PCR analysis of p73 m-RNA (B) PRIMA-1met was unable to

reduce the cell survival measured by MTT assay in p73-silenced cells as much as

scrambled control. Error bars=SEM, * P=

46

Chapter 3

Discussion

Current standard treatment regimens for WM have been unable to cure the disease and drug

induced toxicities remain a major concern for clinicians in the field (Buske et al., 2013). The

most promising combinations so far for WM patients have been bortezomib combinations used

in clinical trials with ORR of 80-90% but few CRs and with long term third grade neurological

toxicities for many patients under the treatment (Treon, 2013). p53 is capable of induction of cell

cycle arrest, apoptosis and senescence as the major sensor of cellular stress. Given the mutated

status of p53 in more than 50% of all cancer types, in the past decade, considerable energy has

been focused on p53 apoptotic effects and developing p53 activating agents both at preclinical

and clinical level (Wang and Sun, 2010). Most of these compounds are only cytotoxic toward

cancer cells. PRIMA-1met is one of these therapeutics used in various cancer types, especially

hematological malignancies, that has shown great potential (Aryee et al., 2013; Bao et al., 2011;

Ali et al., 2011; Nahi et al., 2008). This thesis is focused on determining PRIMA-1met’s

therapeutic potential and mode of action in WM. Using various functional assays; our results

demonstrate that PRIMA-1met is a very potent therapeutic agent for WM.

In the first section of this thesis, I aimed to validate the anti-tumorigenic effects of PRIMA-1met

on WM cells using various functional assays which to our knowledge has never been

investigated before. In this study we used the BCWM-1 cell line, one of the two existing cell

lines of WM that bears wild type p53 the same as 95% of WM population (Kristinsson et al.,

2009). The first objective was pursued through studying the effects of PRIMA-1met on three

major aspects of WM pathogenesis: viability, clonogenecity and migration. Following subjection

of BCWM-1 cells to PRIMA-1met, we detected reduction in cell viability, an increase in cell

surface staining with Annexin V, and an induction of PARP cleavage which collectively point

out the induction of apoptosis in WM by PRIMA-1met. More importantly, a more significant

decrease in cell viability was discovered in primary WM samples grown in the presence of

PRIMA-1met. The rise in cell death in response to PRIMA-1met in BCWM-1 cells was observed

in dosage range previously reported to have no cytotoxicity toward Peripheral Blood

47

Mononuclear cell (PBMNCs) and Bone Marrow Mononuclear cells (BMMNCs) and was well

below 300 µM which is the in-vitro equivalent of the reported maximum tolerated dose set by a

recent phase I/II clinical trial for PRIMA-1met (Saha et al.,2013a; Lehmann et al., 2012). Earlier

reports also demonstrate reduction in cell viability and induction of cell cycle arrest in various

solid tumors such as breast, lung cancer, and hematological malignancies closely related to WM,

e.g. CLL and MM, in response to PRIMA-1met ((Aryee et al., 2013; Bao et al., 2011; Ali et al.,

2011; Nahi et al., 2008; Nahi et al., 2008; Saha et al., 2013a).

I next examined the effects of PRIMA-1met on WM cologenicity through a methylcellulose

based colony assay. We observed a significant decline in the number of resulted colonies which

suggest a strong anti-clonogenic effect for PRIMA-1met. These results are supported by previous

reports of reduced clonogenicity in MM after PRIMA-1met treatment (Saha et al., 2013a). We

recognize the importance of a serial replating assay to further confirm our result but practical

limitations such as low number of resulted colonies and slow doubling time prevented us from

doing so. These results, however, lead us to speculate that PRIMA-1met not only affects general

WM cancer cells but it also affect the tumor initiating cells.

Bone marrow regulates the growth, proliferation and drug resistance in WM cells, therefore, their

homing to the bone marrow through migratory mechanism is essential for WM pathogenesis

(Ngo et al., 2008; Poulain et al., 2009). Moreover, in 20% of WM cases which are also more

aggressive in nature, WM cells use their migratory abilities to disseminate throughout the body

(Shaheen et al., 2012). Hence, in the next step, we noticed a declining trend in migration for

PRIMA-1met treated WM cells as evidence for yet another important anti-tumorigenic effect of

PRIMA-1met in WM. In their investigations of PRIMA-1met on MM, Saha et al. also described

similar results to our migration assay findings (Saha et al., 2013a). CXCR4 is a lymphocyte cell

surface adhesion molecule which is highly expressed in WM and is recently found to be one of

the drivers of WM tumor progression (Treon et al., 2014a; Hunter et al., 2014). Since

CXCR4/SDF1 is known to be the major player in MM migration and homing and in light of data

pertain to its importance in WM pathogenesis, we speculate that one of the mechanism through

48

which PRIMA-1met is inhibiting migration in WM is through regulating the levels of surface

CXCR4 (Alsayed et al., 2007).

To gain insight into the mechanism of PRIMA-1met induced apoptosis, we evaluated the

expression of number of apoptotic markers. First, we detected elevated levels of PARP and

caspase 9 cleavage which led us to believe that the mitochondrial pathway of apoptosis is

involved in PRIMA-1met-induced cell death. Changes in expression of various members of

mitochondrial pathway of apoptosis after PRIMA-1met treatment have previously been

demonstrated by several groups. Zandi et al. reported that Bax level was elevated while Bcl-2

was reduced in several small cell lung cancer cell lines following treatment with PRIMA-1met

(zandi et al., 2011). In another study, an si-RNA knock down of Noxa in MM render the cells

incapable of undergoing apoptosis in response to PRIMA-1met treatment leading to the author’s

conclusion that Noxa is a major player in causing apotosis in these cell lines (Saha et al., 2013a).

We on the other hand were unable to detect any changes in the levels of Noxa (data not shown)

and only came across decreasing levels of Bcl-xL after PRIMA-1met treatment. Therefore, it

seems that although PRIMA-1met exerts its apoptotic effects through intrinsic pathway of

apoptosis, the exact executioner in this pathway is cell type specific.

PRIMA-1 and its more potent form PRIMA-1met were initially discovered as activators of

mutant p53 in Saos-2 cells (Bykov et al, 2002; Bykov et al., 2005). In a later study, Bao et al.

discovered that PRIMA-1met was more effective in inducing apoptosis in wild type p53

melanoma cells (Bao et al., 2011); while, several recent studies have indicated the PRIMA-

1met’s potency in p53 null or knocked-down cell lines especially in hematological malignancies

(Ali et al., 2011; Supiot et al., 2008). To elucidate the role of p53, we evaluated the effects of

p53 knockdown in PRIMA-1met cytotoxicity towards WM. Following the knockdown in

BCWM-1 cells, they were able to undergo apoptosis in response to PRIMA-1met to the same

extent as before the knockdown, leading us to conclude that PRIMA-1met effects are p53

independent. P73 is another member of the p53 tumor suppressor superfamily which shares 80%

structural and some functional similarities with p