plant and animal breeding
DESCRIPTION
Plant and animal cloning (grade 9 in year 0708)TRANSCRIPT
![Page 1: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/1.jpg)
Plant and Animal Plant and Animal BreedingBreeding
![Page 2: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/2.jpg)
Artificial Selection & Artificial Selection & Breeding for selected traitsBreeding for selected traitsselection of plants or animals for
desirable traits by humans through carefully planned breeding
![Page 3: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/3.jpg)
Artificial Selection & Breeding for Artificial Selection & Breeding for selected traitsselected traits
Isolation of natural populations↓
Selective breeding of organisms showing traits useful of humans
↓Useful genotypes exits more often
(producing more offspring) than other genotype
↓Change in allele frequency towards
genotypes useful to humans
![Page 4: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/4.jpg)
Aims of artificial selection Aims of artificial selection
1. create new breeds or varieties
![Page 5: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/5.jpg)
![Page 6: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/6.jpg)
Aims of artificial selection Aims of artificial selection preserve good species
![Page 7: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/7.jpg)
Aims of artificial selection Aims of artificial selection domesticate wild plants and
animals Wildebeest Ostrich
![Page 8: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/8.jpg)
![Page 9: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/9.jpg)
Common types of artificial Common types of artificial selectionselectionInbreedingOutbreedingPolyploidy
![Page 10: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/10.jpg)
InbreedingInbreedingmating between genetically
closely related individualsincrease the number of
homozygous genotypes ◦reduced variability◦decrease in heterozygosity
![Page 11: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/11.jpg)
InbreedingInbreedingself-fertilizationcrossing the offspring of the
same parentsbackcrossing with one of the
parents
![Page 12: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/12.jpg)
InbreedingInbreedingdecrease heterozygous
genotypes by 50% in each generation
![Page 13: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/13.jpg)
Problems of inbreedingProblems of inbreedingreduce in fertilityInbreeding depression - vigour of
the population is gradually reduced
![Page 14: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/14.jpg)
OutbreedingOutbreedingmating between genetically
closely unrelated individualsincrease the number of
heterozygosity ◦more variations◦produce offspring with superior
character (hybrid vigour)
use in combining two beneficial characteristics
![Page 15: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/15.jpg)
PolyploidyPolyploidyAutopolyploidy
◦chromosome sets derived from the same species
◦created by spontaneous duplication
Allopolyploidy
![Page 16: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/16.jpg)
PolyploidyPolyploidyAutopolyploidy
◦chromosome sets derived from the same species
◦created by spontaneous duplication
![Page 17: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/17.jpg)
PolyploidyPolyploidyAllopolyploidy
◦two different diploid species are interbred
![Page 18: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/18.jpg)
AllopolyploidyAllopolyploidythe hybrid form is sterile
◦different sets of chromosomes from both parents are not homologous
◦no pairing during meiosis
![Page 19: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/19.jpg)
AllopolyploidyAllopolyploidyduplicate the genomethe tetraploid became fertile
![Page 20: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/20.jpg)
![Page 21: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/21.jpg)
AllopolyploidyAllopolyploidyget the advantage of inheriting
desirable characteristics from both parents
can be induced artificially by colchicine◦inhibit spindle formation
![Page 22: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/22.jpg)
Methods commonly used in Methods commonly used in plant breedingplant breedingSelectionBackcrossHybridizationPolyploid breeding Mutation breeding
![Page 23: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/23.jpg)
Methods commonly used in Methods commonly used in animal breedinganimal breedingSelectionArtificial insemination
![Page 24: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/24.jpg)
Artificial insemination Artificial insemination Collection of semen from a maleDilution and artificial introduction
of sperm into female reproductive tract
Horses - Artificial Insemination
![Page 25: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/25.jpg)
Artificial insemination Artificial insemination the semen can be stored in liquid
nitrogen for a long timeone male can be used to fertilize
a large number of females semen can be sent over long
distances commonly used in cattle
breeding
![Page 26: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/26.jpg)
![Page 27: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/27.jpg)
Plant cloningPlant cloningA clone is a group of genetically
identical cells or an individual derived from a single ancestral cell, tissue or individual by repeated asexual divisions
Cloning is the production of genetically identical individuals
![Page 28: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/28.jpg)
Cloning is naturally Cloning is naturally occurring occurring Organisms which reproduce
asexually give rise to progeny by mitotic nuclear divisione.g. binary fission, vegetative propagation
produces exact copies of the parental genotype
Gardeners frequently maintain clones of desirable varieties of plants by vegetative propagation.
![Page 29: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/29.jpg)
Plant cloningPlant cloning
Materials needed for cloning:
Somatic cells (primordial cells)
Culture medium
![Page 30: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/30.jpg)
Tissue cultureTissue culture• Each somatic cell contains all the
information required to code for an entire organism.
• The cells to be cloned are allowed to grow in a medium containing suitable nutrients and hormones to form a mass of genetically identical cells called callose.
![Page 31: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/31.jpg)
The callose are then separated and induced to produce new individuals
![Page 32: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/32.jpg)
Advantages of plant Advantages of plant cloningcloningmaintain desirable traits in
selected plantsrapid way of propagating plants
in a short period of timeplants are grown in sterile
medium (disease-free)
![Page 33: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/33.jpg)
Advantages of plant Advantages of plant cloningcloningplants are grown in sterile
medium (disease-free)
![Page 34: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/34.jpg)
Advantages of plant Advantages of plant cloningcloningmaintain the genetic uniformityless space is needed
![Page 35: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/35.jpg)
![Page 36: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/36.jpg)
Animal cloningAnimal cloningFirst clone animal (1997)by Professor Ian Wilmut works at
the Roslin Institute in Edinburgh, which specializes in research on farm and other animals
![Page 37: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/37.jpg)
Animal cloning - DollyAnimal cloning - DollyAn unfertilized egg was collected
from a Scottish blackface sheep
![Page 38: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/38.jpg)
Animal cloning - DollyAnimal cloning - DollyThe nucleus of the unfertilized
egg cells was removed (enucleated)
![Page 39: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/39.jpg)
Animal cloningAnimal cloningThe nucleus from a mammary
gland cell taken from a sheep Y.
![Page 40: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/40.jpg)
Cloning of DollyCloning of DollyThe nucleus transfer to the
enucleated cell.An electro fusion was given
![Page 41: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/41.jpg)
Cloning of DollyCloning of DollyIncubate the new cell in a culture
medium for 6 days ◦ embryo formed
![Page 42: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/42.jpg)
Cloning of DollyCloning of DollyThe embryo was implanted into
the uterus of another blackface sheep (surrogate / foster mother)
![Page 43: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/43.jpg)
Cloning of DollyCloning of DollyThe foster mother gave birth to
Dolly (baby sheep)
![Page 44: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/44.jpg)
![Page 45: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/45.jpg)
![Page 46: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/46.jpg)
![Page 47: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/47.jpg)
Implications of animal cloningmaintain the desirable traits in
selected animals Increase the population of
endangered species
![Page 48: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/48.jpg)
Cloning on extinct animal -Thylacine - the largest known
carnivorous marsupial of modern times
Native to Australia and New Guinea
![Page 49: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/49.jpg)
What’s the next?
![Page 50: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/50.jpg)
Implications of animal cloningtissue from cloning of human
embryo for curing Parkinson’s disease
![Page 51: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/51.jpg)
Implications of animal cloning
![Page 52: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/52.jpg)
Recombinant DNA Recombinant DNA technologytechnology1. Transferring a particular gene to
a self-replicating chromosome (usually in bacteria)
2. Amplification of the resulting recombinant DNA molecule
![Page 53: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/53.jpg)
Recombinant DNA Recombinant DNA technologytechnology
![Page 54: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/54.jpg)
Recombinant DNA Recombinant DNA technologytechnology1. Transferring a particular gene to
a self-replicating chromosome (usually in bacteria)
2. Amplification of the resulting recombinant DNA molecule
![Page 55: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/55.jpg)
Recombinant DNA Recombinant DNA technologytechnologyalso called gene manipulation genetic engineering
![Page 56: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/56.jpg)
Genetic Engineering
![Page 57: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/57.jpg)
Basic steps of recombinant Basic steps of recombinant DNA technologyDNA technologyidentifying a target geneisolating the target geneinserting the target gene into a
vector transferring the vector containing
the target gene into a host cell for producing a certain gene product
harvesting and purifying the gene product
![Page 58: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/58.jpg)
Isolate the target geneIsolate the target geneuse restriction enzymesproduced by bacteria which cut
on the DNA at particular sites (recognition sites)
![Page 59: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/59.jpg)
1978 Nobel Prize Physiology or Medicine
Werner Arber
Hamilton Smith
Daniel Nathans
![Page 60: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/60.jpg)
Restriction enzymesRestriction enzymescan be extracted from bacterial
culturescut the double helix at specific
sites along the sequencesmost recognize sequences of
DNA with 4, 6 or 8 bases
![Page 61: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/61.jpg)
Donor DNA
(Target DNA)
Restriction enzymes
(restriction endonucleases)
Break at specific site
![Page 62: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/62.jpg)
Restriction enzymesRestriction enzymesact as powerful scissors create sticky ends
![Page 63: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/63.jpg)
Formation of recombinant Formation of recombinant DNA moleculeDNA moleculeapply the restriction enzyme in
vitro with 2 different DNA fragments
![Page 64: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/64.jpg)
DNA ligaseDNA ligasecan join ‘sticky ends’ of the DNA
fragments
![Page 65: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/65.jpg)
Ways to locate the genes Ways to locate the genes Short gun sequencingTop-down sequencing
![Page 66: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/66.jpg)
Shotgun approach
Genome from an organism
Restriction enzymes
Fragments of DNA
(some just contains the base sequences of a gene)
Gene probe
Desired base sequence
![Page 67: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/67.jpg)
Shotgun approachShotgun approach• not specific
• but useful when no idea about the sequence of the desired gene
![Page 68: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/68.jpg)
Shotgun Shotgun sequencingsequencingDNA is broken up randomly into
numerous small segmentssequenced using the chain
termination method Multiple overlapping reads for the
target DNA are obtained
![Page 69: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/69.jpg)
Shotgun Shotgun sequencingsequencingStrand Sequence
Original XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX
First shotgun sequence
XXXAGCATGCTGCAGTCATGCTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTAGGCTAXXXX
Second shotgun sequence
XXXAGCATGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCTGCAGTCATGCTTAGGCTAXXXX
Reconstruction
XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX
![Page 70: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/70.jpg)
Bottom up sequencing Bottom up sequencing
![Page 71: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/71.jpg)
Complementary DNA Complementary DNA (cDNA)(cDNA)conversion of mRNA into DNA can be used to find out the
location of gene
![Page 72: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/72.jpg)
Protein
Amino acids sequence
Nucleotides sequence
Only restricted to small gene with short DNA
![Page 73: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/73.jpg)
Structure of mRNAStructure of mRNA
with a poly A tail d
all eukaryotic mRNA molecules contain a poly-A tail
for stabilization of mRNA molecule during transcription
![Page 74: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/74.jpg)
cDNAcDNAusing a poly-T oligomer as a
primer(Primer is a short single-stranded DNA or RNA that functions as the starting site for the elongation of a new chain)
![Page 75: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/75.jpg)
cDNAcDNAThe poly-T oligomer binds to the
complementary poly-A tail of mRNA
![Page 76: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/76.jpg)
Formation of cDNAFormation of cDNAIn the presence of
enzyme ,reverse transcriptase a single strand of cDNA copy is formed
![Page 77: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/77.jpg)
Release of the cDNARelease of the cDNAcDNA can be released by the
addition of alkali
![Page 78: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/78.jpg)
Synthesis of DNA double Synthesis of DNA double helixhelixwith the help of DNA polymerase
![Page 79: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/79.jpg)
VectorsVectorsa self-replicating DNA molecule
that carries a foreign DNA segment to a host cell for amplification
come from bacterial plasmids and viruses
![Page 80: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/80.jpg)
PlasmidPlasmida small circular molecule of
double stranded DNA present in bacterial cell
carries a minor fraction of the bacterial genome ◦code important traits
![Page 81: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/81.jpg)
Advantages of using plasmid Advantages of using plasmid as vectoras vectorlow molecular weight (contains
several thousand base pairs)
![Page 82: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/82.jpg)
Advantages of using plasmid Advantages of using plasmid as vectoras vectorplasmid replicates autonomouslyindependent of the chromosomes
in bacteria
![Page 83: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/83.jpg)
Advantages of using plasmid Advantages of using plasmid as vectoras vectorcontains antibiotic resistance
genes which facilities selection
![Page 84: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/84.jpg)
Advantages of using plasmid Advantages of using plasmid as vectoras vectorcontain a number of unique
cleavage sites for the actions of several different restriction enzymes
![Page 85: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/85.jpg)
Isolation of plasmid from Isolation of plasmid from bacteriabacteriaby breaking up the bacterial cellsseparation by centrifugation
![Page 86: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/86.jpg)
Cleavage of plasmid Cleavage of plasmid cleavage by the same restriction
enzyme used in cutting the short length of DNA (target gene) to be inserted
form the same sticky ends
![Page 87: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/87.jpg)
Insertion of plasmid to Insertion of plasmid to host cellhost cellwith the help of DNA ligase
![Page 88: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/88.jpg)
Insertion of plasmid to Insertion of plasmid to host cellhost cellthe resulting plasmids can be
replicated if they are introduced into a bacterial host cells
![Page 89: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/89.jpg)
Introducing the target gene Introducing the target gene into the host cellinto the host cellDNA molecules can be taken up
by pre-treating the bacterial cells with a solution containing Ca2+ ions followed by a rapid heat shock(42oC)
![Page 90: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/90.jpg)
Introducing the target gene Introducing the target gene into the host cellinto the host cellapply a brief electrical shock that
generates temporary pores in the bacterial cell membrane
![Page 91: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/91.jpg)
Production of human insulin Production of human insulin from genetically engineered from genetically engineered bacteriabacteriaType I Diabetes
◦failed to produce sufficient insulin ◦due to insufficient insulin by Islets of
Langerhans in the pancreas ◦can only get insulin from the
panaceas from cows or pigs
![Page 92: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/92.jpg)
Problems of using insulin Problems of using insulin from other animalsfrom other animalsthough the insulin is biologically
active but the amino acid sequences are slightly different from those of humans
some patients are stimulated to produce antibodies against the injected insulin
![Page 93: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/93.jpg)
Structure of human insulin Structure of human insulin consists of two separate
polypeptides chains: A and Bjoined together by special
disulphide bridges (S~S)A-chain contains 21 amino acidsB-chain is 30 amino acids long
![Page 94: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/94.jpg)
Structure of human insulin Structure of human insulin two chains originate from a large
gene product called preproinsulin
![Page 95: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/95.jpg)
Structure of human insulin Structure of human insulin function of C-chain is to bring the
A-chain and B-chain together in the correct alignment
![Page 96: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/96.jpg)
Structure of human insulin Structure of human insulin A-chain and B-chain will join to
form a mature insulin
![Page 97: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/97.jpg)
Genetically engineered Genetically engineered human insulinhuman insulinisolate 2 synthetic DNA
fragments (genes)◦encoding A-chain and B-chain
Introduce the 2 genes into plasmids
![Page 98: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/98.jpg)
Genetically engineered Genetically engineered human insulinhuman insulinthe plasmids are introduced into
2 E. coli bacteriaproduce the chain A and chain B
polypeptides separately
![Page 99: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/99.jpg)
Genetically engineered Genetically engineered human insulinhuman insulinthe polypeptides are extracted
and purifiedmixed under appropriate
conditions to produce functional human insulin
![Page 100: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/100.jpg)
Applications of recombinant Applications of recombinant DNA technologyDNA technology
Production of therapeutic proteins for pharmaceutical uses◦Human insulin◦Blood clotting factor VIII◦Human growth hormone◦Protein coat of hepatitis B virus
![Page 101: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/101.jpg)
Diagnosis of genetic Diagnosis of genetic diseasesdiseasescompare the nucleotides
sequences of affected patients and unaffected individuals◦diabetes◦pancreas cancer◦cystic fibrosis◦haemophilia◦AIDS
![Page 102: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/102.jpg)
Production of enzymes for Production of enzymes for industrial applicationsindustrial applicationsbiological detergents
◦protease and amylaseBrewing industryTextile industryBaking industry
◦cellulaseLeather industry
![Page 103: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/103.jpg)
Transgenic technologyTransgenic technologytransfer a desirable gene from
another species to a recipient organism
form a new character which is beneficial to human
produce transgenic animals and transgenic plants Genetically Modified Organisms (GMO)
![Page 104: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/104.jpg)
![Page 105: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/105.jpg)
• Introducing new genes from another Introducing new genes from another organismorganism
![Page 106: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/106.jpg)
Bt gene
![Page 107: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/107.jpg)
![Page 108: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/108.jpg)
![Page 109: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/109.jpg)
DNA Fingerprinting
![Page 110: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/110.jpg)
Sir Professor Alec Jeffreys
![Page 111: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/111.jpg)
Background information
No. of base pairs in human: 3 billion
No. of coding gene: 30,000
about 95% of the base pairs are non-coding
about 30-40% of the base pairs consists of short sequence of repeats
some of the repeats are joined together in cluster (tandem)
![Page 112: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/112.jpg)
DNA fingerprintingDNA fingerprintingOn the DNA there are region
which do not code for polypeptides ◦Exon – coded for polypeptide◦Intron – non-coding DNA sequences
![Page 113: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/113.jpg)
![Page 114: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/114.jpg)
Non-coding sequenceNon-coding sequencemake up over 90% of the
genomeabout half of them carry short
repetitive sequences of nucleotides – tandem repeats
![Page 115: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/115.jpg)
The tandem repeats are known as satellite DNA.
Some just have a small number of repeats: minisatillites.
• Different individual have a different number of tandem repeated
• Minisatillate known as variable number tandem repeats (VNTRs)
![Page 116: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/116.jpg)
Procedure
Extraction
![Page 117: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/117.jpg)
![Page 118: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/118.jpg)
![Page 119: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/119.jpg)
Amplification:
Polymerase Chain Reaction (PCR)
![Page 120: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/120.jpg)
Polymerase Chain Reaction (PCR)
1. Denature: made single-stranded
2. Add DNA polymerase
3. Add primer (a short DNA sequence)
![Page 121: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/121.jpg)
Treatment with restriction enzyme
• cut DNA into smaller fragments
• contain minisatellites
• length of the DNA fragments remains unchanged
![Page 122: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/122.jpg)
Agrose gel electrophoresis
• agrose gel with pores
• Separate the DNA fragments according to size
• DNA carries negative charge and will move to positive pole if a voltage is applied to it.
• Smaller size: move faster
• Bigger size: move slower
![Page 123: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/123.jpg)
Splitting the DNA into single strands
• by alkaline treatment
![Page 124: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/124.jpg)
Addition of a radioactive probe
• Identify the location of the minisatillites
• number of tandem repeats can be shown as bands
![Page 125: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/125.jpg)
Applications of DNA fingerprinting
• Identification of criminal
• very sensitiveType of sample Amount of DNA (ng); 1ng = 10-9 g
Blood 20,000 – 40 000 ng / ml
Stain 1 cm2 in area ~ 200 ng
Stain in 1 mm2 area ~ 2 ng
Semen 150, 000 – 300, 000 ng / ml
Postcoital vaginal swab 0 – 3, 000 ng
Hair
Plucked 1 – 750 ng / hair
shed 1 –12 ng / hair
Saliva 1, 000 – 10, 000 ng / ml
Urine 1 – 20 ng / ml
Fig. 8 DNA content in biological sample
![Page 126: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/126.jpg)
Number of Bands Odds against a chance match
4 250 to 1
6 4000 to 1
8 65000 to 1
10 1 million to 1
12 17 million to 1
14 268 million to 1
16 4300 million to 1
18 68000 million to 1
20 1 million million to 1
Fig. 9 The chance occurrence of Band matching
Chance occurrence of band matching
![Page 127: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/127.jpg)
Settling paternity disputesSettling paternity disputes• every child must inherit one copy
of a pair of homologous chromosome from each parent
![Page 128: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/128.jpg)
Mother Father
![Page 129: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/129.jpg)
![Page 130: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/130.jpg)
![Page 131: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/131.jpg)
Genetic disorder and its diagnosis
• due to mutation
Sickle cell anaemia
Haemophilia
![Page 132: Plant and Animal Breeding](https://reader033.vdocuments.mx/reader033/viewer/2022061116/5464fffbb4af9f41078b45d9/html5/thumbnails/132.jpg)