phylogeographic and environmental dna ... - digitalcommons@emu

Eastern Michigan UniversityDigitalCommons@EMU

Master's Theses and Doctoral Dissertations Master's Theses, and Doctoral Dissertations, andGraduate Capstone Projects

2016

Phylogeographic and environmental DNA analysisof the mudpuppy (necturus maculosus maculosus)Amber Stedman

Follow this and additional works at: http://commons.emich.edu/theses

Part of the Biology Commons

This Open Access Thesis is brought to you for free and open access by the Master's Theses, and Doctoral Dissertations, and Graduate Capstone Projectsat DigitalCommons@EMU. It has been accepted for inclusion in Master's Theses and Doctoral Dissertations by an authorized administrator ofDigitalCommons@EMU. For more information, please contact [email protected].

Recommended CitationStedman, Amber, "Phylogeographic and environmental DNA analysis of the mudpuppy (necturus maculosus maculosus)" (2016).Master's Theses and Doctoral Dissertations. 784.http://commons.emich.edu/theses/784

http://commons.emich.edu?utm_source=commons.emich.edu%2Ftheses%2F784&utm_medium=PDF&utm_campaign=PDFCoverPages

http://commons.emich.edu/theses?utm_source=commons.emich.edu%2Ftheses%2F784&utm_medium=PDF&utm_campaign=PDFCoverPages

http://commons.emich.edu/etd?utm_source=commons.emich.edu%2Ftheses%2F784&utm_medium=PDF&utm_campaign=PDFCoverPages

http://commons.emich.edu/etd?utm_source=commons.emich.edu%2Ftheses%2F784&utm_medium=PDF&utm_campaign=PDFCoverPages

http://commons.emich.edu/theses?utm_source=commons.emich.edu%2Ftheses%2F784&utm_medium=PDF&utm_campaign=PDFCoverPages

http://network.bepress.com/hgg/discipline/41?utm_source=commons.emich.edu%2Ftheses%2F784&utm_medium=PDF&utm_campaign=PDFCoverPages

http://commons.emich.edu/theses/784?utm_source=commons.emich.edu%2Ftheses%2F784&utm_medium=PDF&utm_campaign=PDFCoverPages

mailto:[email protected]

Phylogeographic and Environmental DNA Analysis of the Mudpuppy (Necturus

maculosus maculosus)

by

Amber Stedman

Thesis

Submitted to the Department of Biology

Eastern Michigan University

in partial fulfillment of the requirements

for the degree of

MASTER OF SCIENCE

in

Biology

Thesis Committee:

Katherine Greenwald, Ph.D, Chair

Steven Francoeur, Ph.D

Margaret Hanes, Ph.D

November 15, 2016

Ypsilanti, MI

ii

Acknowledgments

I would like to thank my advisor, Katy Greenwald, and my committee members,

Dr. Hanes and Dr. Francoeur, for their guidance and support throughout the research and

writing process. I would also like to thank Herpetological Resource and Management,

with a special thanks to Dave Mifsud and Maegan Stapleton, for their admirable

dedication to this project, especially during cold Michigan winters. I also owe a great

deal to the many groups and individuals that have contributed tissue samples to this

study. It was humbling to see so many passionate people willing to take the extra time to

contribute to this study. Thank you to Tom Goniea, Jaquie Craig, Andrew Briggs, Kiley

Briggs, Krista Larson, Mason Murphy, Jeff Briggler, Rich King, Jenny Sutherland, Jean-

Francois Desroches, Jeff LeClere, Tim Matson, Richard Kik, MDNR, USGS, USFWS,

MODNR, Cleveland Museum of Natural History, and Environment and Climate Change

Canada. Finally, thank you to my family, friends, and fellow graduate students, whose

support and encouragement proved invaluable.

iii

Abstract

Understanding species’ genetic diversity allows for informed management that preserves

evolutionary potential. Informed management becomes crucial as genetic diversity

declines and species become susceptible to threats such as climate change. For some

species, it can be difficult to determine whether extant populations persist in an area.

Genetic tools allow us to address both of these issues. Phylogeographic analyses allow

managers to understand a population’s genetic makeup with respect to other populations,

facilitating decisions that preserve local adaptation and evolutionary potential.

Environmental DNA analysis complements traditional survey techniques and increases

confidence when determining species’ range. Here, we explore the phylogeography of

the mudpuppy’s western range and examine the feasibility of using eDNA to complement

traditional surveys. Results show a deep ancestral split between the eastern and western

portions of the mudpuppy’s range. Environmental DNA results show differential

amplification between eDNA samples and negative controls, although the methods

require further optimization.

iv

Table of Contents

Acknowledgments ............................................................................................................. ii

Abstract ............................................................................................................................. iii

List of Tables .................................................................................................................... v

List of Figures ................................................................................................................... vi

Chapter 1:

Introduction .................................................................................................... 1

Methods.......................................................................................................... 7

Results ............................................................................................................ 9

Discussion ...................................................................................................... 15

Chapter 2:

Introduction .................................................................................................... 19

Methods.......................................................................................................... 23

Results ............................................................................................................ 25

Discussion ...................................................................................................... 31

References ......................................................................................................................... 33

v

List of Tables

Table Page

1 Sample sizes for each watershed included in this study ..............................................9

2 Pairwise Fst comparisons of cyt b sequences ..............................................................13

3 Primer sequences used for cyt b gene ..........................................................................14

4 Primer sequences used for eDNA analysis ..................................................................26

vi

List of Figures

Figure Page

1 Range of Necturus spp. .................................................................................................. 5

2 Cyt b haplotypes across the entire geographic range assessed in this study ................. 11

3 Maximum likelihood tree of haplotypes ........................................................................12

4 Haplotype network of cyt b haplotypes .........................................................................13

5 Isolation by distance graph ............................................................................................14

6 Regression line relating log quantity of tissue DNA to C(t) cycle ................................26

7 Aquarium eDNA sample (A1) .......................................................................................27



10 Aquarium eDNA sample (B1) .....................................................................................28



13 Distilled H2O Control 1 ................................................................................................30



1

Chapter 1: Phylogeography of the Mudpuppy (Necturus maculosus maculosus) and the

Implications for Future Conservation and Management Efforts

Introduction

Without baseline genetic information to guide management practices, species may

be managed inefficiently or in a way that limits adaptive potential. To preserve adaptive

potential in populations, it is important to practice evolutionarily enlightened

management (Ashley et al. 2003). Decisions regarding management of species

frequently ignore the evolutionary implications. Sometimes this is simply a result of lack

of genetic data. It is also often a result of the misconception that evolution occurs too

slowly to be relevant to conservation (Avise 1995).

There are, however, numerous instances in which evolution is relevant to

conservation (Ashley et al. 2003). In our efforts to conserve biodiversity, we must

remember that genetic diversity is considered a component of biodiversity (Holland and

Hadfield 2002). Thus, knowledge of the distribution of genetic diversity over space and

the preservation of genes is a way of preserving biodiversity. When conservation

resources are limited, knowledge of where increased genetic diversity lies can assist in

making informed management decisions. In practice, this can mean prioritizing a

population that is genetically distinct relative to other populations. As a way of

recognizing distinct evolutionary lineages it is helpful to designate Evolutionary

Significant Units (ESUs). Although the definition of an ESU varies (Allendorf and

Luikart 2007) it can be broadly defined as a unique evolutionary lineage or lineages,

which have diverged from other lineages for a significant period of time. The

organization of populations into ESUs can aid management decisions and facilitate the

2

preservation of genetic diversity (Holland and Hadfield 2002). Furthermore, if captive

breeding or translocation should be required, ESUs can assist in deciding which

individuals ought to be bred and where individuals may be effectively relocated or re-

introduced to avoid outbreeding depression (Soltis and Gitzendanner 1999).

Genetic studies have also identified cryptic species, which may go unrecognized

until genetic studies can establish species status. While they remain unrecognized,

cryptic species may not be fully protected since only species, subspecies, or distinct

population segments can receive official designation under the U. S. Endangered Species

Act (Allendorf and Luikart 2007). This lack of resources for cryptic species may result in

continual decline until their status is elucidated. In the case of the red-legged frog (Rana

aurora) the range of the protected subspecies R. a. draytonii was not fully known until

mtDNA analysis of the full range of R. aurora. The discovery of this cryptic species in

new areas may lead to allocation of conservation protection to new areas where R. a.

draytonii is now known to occur (Shaffer et al. 2004).

Phylogeographic studies may also determine the extent of hybridization occurring

between lineages. If hybridization is detected, it may warrant the implementation of new

management strategies or a revised species designation. For the mottled duck (Anas

fulvigula) hybridization with mallard ducks (Anas platyrhynchos) threatens the

preservation of pure mottled duck lineages (McCracken et al. 2001).

Evolutionary history may also be clarified through phylogeographic methods

using measures of genetic diversity. Assuming an even rate of mitochondrial substitution

across areas, those populations with greater diversity represent older populations and are

likely sources from which individuals migrated to other areas (Nersting and Arctander

3

2001). Overall, the characterization of a species’ genetic diversity and evolutionary

history allow for the implementation of better management practices that work to

maximize evolutionary potential. The preservation of adaptive potential in animals

becomes especially relevant when considering the potential effects of climate change

where few practical management interventions exist (Scoble and Lowe 2010).

The global decline of amphibians was initially recognized at the First World

Congress of Herpetology in 1989, but data indicate that declines had begun as early as the

1970s. Since then, accumulated data show that amphibians comprise one of the most

imperiled animal taxa, experiencing higher extinction rates than both birds and mammals

(Stuart et al. 2004). Many population declines were reported in areas that were otherwise

considered pristine (Blaustein and Wake 1990). Depending on the specific environment,

causes of these declines are likely to vary, and many declines may be a result of complex

interactions among multiple causative agents that exacerbate the decline (Rohr and

Palmer 2013).

Though a single unifying cause cannot be identified, studies suggest that the

disproportionately high rates of declines and extinctions among amphibians are largely

due to habitat destruction and modification (Barrett and Guyer 2008), disease (Kilpatrick

et al. 2009), climate change (Li et al. 2013), pollution (Ficken and Byrne 2013), and

overexploitation (Natusch and Lyons 2012). Although we know that amphibian

populations are disproportionately declining worldwide, many species are still

understudied and categorized as data deficient according to the International Union for

the Conservation of Nature (IUCN). The proportion of amphibians considered “Data

Deficient” also rivals that of birds and mammals and studies suggest these species may be

4

at a higher risk of extinction than their more formally assessed counterparts (Stuart et al.

2004; Howard and Bickford 2014). With increasing alteration of natural habitat

threatening the persistence of amphibian populations, information regarding current

population status is greatly needed to inform best management practices.

The mudpuppy is unique among most amphibians since it is a strictly aquatic,

neotenic species that retains larval characteristics into adulthood. They are also the

second largest North American salamander after the hellbender (Cryptobranchus

alleghaniensis). Mudpuppies belong to family Proteidae, which contains two extant

genera: Necturus and Proteus. Of these genera, only Necturus can be found in North

America. Within Necturus, there are five extant species, all residing in eastern North

America (N. maculosus, N. alabamensis, N. beyeri, N. lewisi, and N. punctatus) (Gendron

2000; Harding 1997). The term mudpuppy can be used to describe two subspecies: N. m.

maculosus and N. m. louisianensis. In this study, we focused only on N. m. maculosus.

Mudpuppies can be found throughout the Great Lakes region, parts of Southern

Canada, as far east as Vermont, south to Louisiana, and west to Oklahoma and Minnesota

(Fig. 1). Recent geographical analyses suggest that mudpuppies may have migrated from

west to east during the Nipissing Phase when water levels were sufficiently high to

connect the Mississippi River to Lake Michigan and allow colonization of previously

glaciated regions (Mills and Hill 2016). Though they are geographically widespread,

mudpuppies are a behaviorally secretive species that tends to be most plentiful in habitats

containing cover objects such as flat rocks, logs, and planks or retreats such as crayfish

burrows, undercut banks, and tree roots (Lannoo 2005). Throughout their range

mudpuppies are known to occupy a variety of aquatic habitats including lakes, reservoirs,

5

canals, and streams. Unlike many other amphibians, mudpuppies are also quite cold-

tolerant and remain active even when the water’s surface is covered in ice. Mudpuppies

feed mostly on insects, crustaceans, and earthworms (Lagler and Goellner 1941) but have

also been known to feed on small fish, amphibians (including other mudpuppies) and

carrion (Holman 2012). Mudpuppies may live for more than 20 years and reach sexual

maturity between 4-6 years of age (>200 mm total length). Adults will move to shallow

water to breed beginning in October or November and females will begin laying eggs as

early as April. Females will attach eggs to the underside of rocks or other solid substrate

and will guard the nest from fish and crayfish (Holman 2012).

Figure 1: Range of Necturus spp. (Gendron 2000).

6

When they were first described, mudpuppies were reported as being common

(Eycleshymer 1906) but have since been reported as declining in parts of their range

(Harding 1997; King et al. 1997). Instances of direct, human-caused mortality have

contributed to these declines. Historically, biological supply companies would harvest

mudpuppies by the millions to be used in comparative anatomy classes. At the time,

mudpuppies were an ideal specimen for their relative abundance and minimal cost to

universities. Furthermore, there are reports of some fishermen mistaking mudpuppies for

predators of game fish or a danger to humans. These misconceptions have led some to

leave mudpuppies to die on ice or be cut from hooks rather than be returned humanely to

the water (Holman 2012). Another direct threat facing mudpuppy populations includes

mortality due to lampricide application (Gilderhus and Johnson 1980), which was

initiated around 1960 as an additional method of controlling invasive sea lamprey

populations. Both adult and juvenile mudpuppy mortality has been linked to 3-

trifluoromethyl-4-nitrophenol (TFM) application, but whether TFM disproportionately

affects juveniles is still unclear (Matson 1990; Boogaard et al. 2003).

Some of the indirect threats to mudpuppies include habitat degradation through

siltation, pollution, and climate change (Lanoo 2005; Holman 2012). Together, these

direct and indirect threats to survival are likely to act synergistically, exacerbating the

current decline. In Michigan, mudpuppies are currently considered a Species of Special

Concern (Michigan Department of Natural Resources). Due to their sensitivity to

environmental pollutants, mudpuppies are also thought to serve as an indicator species,

and their decline suggests a concurrent decline in overall ecosystem health (Welsh and

Ollivier 1998; Barrett and Guyer 2008). Given this alarming trend, this species warrants

7

further study and implementation of evolutionarily enlightened conservation practices.

An understanding of the population history of the mudpuppy and current genetic diversity

can aide in more effective management of this species.

Little information exists regarding the genetic diversity of the mudpuppy.

However, a study by Chellman (2011) analyzed the genetic variation of mudpuppy

populations in nine river drainages across Ohio, New York, Massachusetts, and Vermont.

The author concatenated cyt b and d-loop sequences and found nine unique haplotypes

and significant genetic structure among populations. To investigate the genetic diversity

in the unexamined western portion of the mudpuppy’s range, I conducted a

phylogeographic analysis in five watersheds spanning six U.S. states and two Canadian

provinces. A phylogeographic analysis may detect historical population structure.

Additionally, it may help identify populations that are genetically diverse. Such

genetically distinct populations may warrant separate management as a way to avoid the

effects of outbreeding depression and maximize evolutionary potential (Allendorf and

Luikart 2007; Sabatino and Routman 2009). Based on historic population structure,

populations can be organized into evolutionary significant units (ESUs) or management

units (MUs), which may be used to guide future management (Pan et al. 2014; Palsboll et

al. 2006).

Methods

The phylogeographic analysis included mudpuppies from six states in the U. S.

(Iowa, Kentucky, Ohio, Michigan, Minnesota, and Missouri) and two Canadian provinces

(Ontario and Quebec). Most tissue samples were collected from tail tips of mudpuppies.

However, some Canadian samples were derived from liver tissue. To collect tail tips,

8

mudpuppies were restrained in clear plastic tubes sufficiently wide to accommodate body

width and reduce discomfort, while also restricting movement. The tip of the tail was

placed on a surface sterilized with ethanol and a small section, measuring a few

millimeters, was removed from the end of the tail using a razor blade sterilized with

ethanol. Since different people collected our samples from numerous locations, there

may have been slight alterations to the methods just described. All samples were stored

at -20°C in 95% ethanol until DNA extraction. A Qiagen Dneasy Blood and Tissue Kit®

was used to extract genomic DNA following the manufacturer’s protocol. We then

amplified a 746 bp segment of the cytochrome b (cyt b) region of the mitochondrial

genome with primers (Table 3) developed by Moritz et al. (1992). Each reaction

contained 4µl of MyTaqTM Red Mix, 1 µM of each primer, 50–100 ng of genomic DNA,

and distilled H2O for a total volume of 10 µl. The PCR program consisted of an initial

denaturation of 2 min at 95 °C followed by 35 cycles of denaturation at 95 °C for 30s,

annealing at 50 °C for 1 min, and extension at 72 °C for 2 min. A final extension cycle

followed for 5 min at 72 °C. Successful amplification was confirmed using a 1% agarose

gel. Those reactions that were successful were sequenced at the University of Michigan

DNA Sequencing Core (Ann Arbor, MI). Forward and reverse sequences were edited

using Geneious ver. 6.1.8. A total of 272 mudpuppies were successfully sequenced at cyt

b. A haplotype tree using a minimal spanning network was generated using TCS in

Popart ver 1.7. A phylogenetic tree was created in Mega ver. 7.0.16 using maximum

likelihood. The tree followed the Hasegawa-Kishino-Yano model of evolution, which

was deemed most appropriate by Mega given our data. A cyt b sequence from Necturus

beyeri was included as an outgroup. Molecular diversity was measured using DNAsp

9

ver. 5 and Arlequin ver. 3.5 was used to measure population-level diversity. For

Arlequin analysis, populations were grouped by watershed. We had samples from five

different watersheds including: Great Lakes, Mississippi, Red River, Missouri, and Ohio

(Table 1). To determine whether increasing geographic distance correlates with

increasing genetic distance, I used a Mantel test. Genetic distances were supplied by

pairwise Fst values and geographic distances were obtained by measuring the pairwise

distances in kilometers between the midpoints of sampling areas within each watershed.

Table 1: Sample sizes for each watershed included in this study.

Watershed Sample Size

Great Lakes 128

Mississippi 113

Red River 24

Missouri 4

Ohio 3

Results

A total of 272 cyt b sequences, measuring 746 bp, were analyzed. Cyt b

sequences represented six U.S. states (OH, IA, MI, MN, MO, and KY) and two Canadian

provinces (ON and QC). The cyt b sequences contained 21 unique haplotypes. The most

prevalent haplotype of the cyt b sequences was haplotype D, which was found

exclusively in Iowa and Minnesota. Haplotype B was the second most prevalent

haplotype and was found exclusively in eastern states and provinces (OH, MI, KY, ON,

10

and QC; Fig. 2). Our phylogenetic tree of cyt b sequences shows a distinct separation

between eastern and western haplotypes (Fig. 3). Haplotype I is shown to be the

intermediate haplotype linking the two most common haplotypes (B and D; Fig. 4).

Haplotype B is one of the most ancestral haplotypes and gave rise to many eastern and

western haplotypes. The tree also demonstrates that many haplotypes are separated by

short genetic distances, which is the result of many haplotypes being separated by only

one or two mutations.

Measures of sequence diversity revealed that cyt b has a haplotype gene diversity

(Hd) of 0.612 ± 0.017 (SD). Nucleotide diversity (π) was 0.00715, and the number of

mutations per site (θ) was 0.12286. The average number of nucleotide differences

between samples (k) was 5.320.

There was a high degree of population differentiation. The Fst value across all

populations for cyt b analysis was 0.82. Variation among populations at this locus

accounted for 81.95% of the total variation while within population variation accounted

for 18.05% of the total variation (Table 2). Likewise, our Mantel test supports a

correlation between increasing geographic distance and increased genetic distance

(R2=0.63, p<0.05; Fig 5).

11

Figure 2: Cyt b haplotypes across the entire geographic range assessed in this study. The genetic divide between eastern and western groups is clearly visible.

12

Figure 3: Maximum likelihood tree of haplotypes.

13

Figure 4: Haplotype network of cyt b haplotypes.

Table 2: Pairwise Fst comparisons of cyt b sequences. Asterisks indicate significant values. Great Lakes Mississippi Red River Ohio Missouri

Great Lakes -

Mississippi 0.83998* -

Red River 0.87513* 0.00769 -

Ohio -0.13158 0.81540* 0.89921* -

Missouri 0.79202* 0.70969* 0.77570* 0.66667* -

A

B

C

D

E

F

G

H

I

J

KL

M

N

O

P

QR

ST

U

10 samples

1 sample

cluster1

cluster2

cluster3

cluster4

cluster5

cluster6

cluster7

cluster8

cluster9

cluster10

cluster11

cluster12

cluster13

cluster14

cluster15

14

Figure 5: Isolation by distance graph. This figure shows that genetic distance increases

as geographic distance increases (R2=0.63, p<0.05).

Table 3: Primer sequences used for cyt b gene. MVZ15 5’-GAACTAATGGCCCACACWWTACGNAA-3’

MVZ16 5’-AAATAGGAARTATCAYTCTGGTTTRAT-3’

-0.2

0

0.2

0.4

0.6

0.8

1

1.2

0 200 400 600 800 1000 1200 1400 1600

GeneticDistance(Fst)

GeographicDistance(km)

15

Discussion

The results of this study are the most geographically widespread analysis of

mudpuppy genetics to date. A similar study of mudpuppy populations in the northeastern

United States found nine unique mitochondrial haplotypes (Chellman 2011). Our study,

which analyzed mudpuppies from a broader geographic region found 21 haplotypes for

cyt b sequences. Similar to the study by Chellman (2011) our data also indicate

significant population structure across the region we analyzed, as demonstrated by high

Fst values. High Fst values are typical of population comparisons over large distances

where gene flow becomes increasingly unlikely (Allendorf and Luikart 2007). Given that

some of the groups compared in this study were separated by hundreds of miles, such a

high Fst value would be expected.

The results of the Mantel test support the idea that increasing geographic

separation between populations correlates with increased genetic distance between

populations, possibly as a result of reduced gene flow between populations or varying

selective forces in different environments. .Eight of ten pairwise Fst comparisons showed

significant genetic differentiation between watersheds (Fst>0.25), a result likely

influenced by reduced gene flow and different selective pressures. One of the two

exceptions was a comparison between the Mississippi and Red River watersheds.

Samples from these two locations were separated by the least distance (<400 km) and

thus gene flow was likely to have occurred much more recently between these two

watersheds than in other pairwise comparisons. .The second exception occurred when

comparing the Great Lakes watershed to the Ohio watershed. In this case the geographic

16

distance between the waterhsheds was greater (~600 km). However, the lack of a

significant Fst result may be due to low sample size in the Ohio watershed.

For both cyt b and concatenated sequence analysis, most of the genetic variation

was found among rather than between populations. This is not surprising given that some

of the populations in this study have been separated for hundreds of miles and thousands

of years. Additionally, overall sequence diversity was low, a result that may be partially

influenced by the relatively large body size of mudpuppies compared to other

salamanders (Mezhzherin 2002).

The phylogenetic tree of cyt b sequences indicates a deep evolutionary split

between eastern and western haplotypes. The divergence of eastern and western

haplotypes suggests that there is significant genetic separation between these two broad

regions. During the Wisconsinan glaciation (80,000–10,000 BP) the Great Lakes region,

where many mudpuppies currently reside, would have been inhospitable, as this region

was covered with glacial ice. During this time, mudpuppies would have to have persisted

in refugia either east or west of the Great Lakes region. For the purposes of determining

likely colonization routes, the mudpuppy may be assessed similarly to fish species since

the mudpuppy’s migratory route would have also proceeded solely along aquatic routes

(Hecht and Walters 1955). A study by Mandrak and Crossman (1992) examines the

likely colonization routes of fish with present-day distributions in Ontario, Canada. They

identified three possible refugia: Missourian, Mississippian, and Atlantic Coastal. Of the

three refugia, most fish were believed to have originated from the Mississippian

refugium. Another study comparing current distributions to ancient lake maxima in

Southern Ontario suggests the most probable time of colonization to have occurred

17

during the Nippissing phase (4,000-5,000 BP) (Mills and Hill 2016). During this time,

Lake Michigan would have had a connection to the Mississippi river via the Sag Channel,

which then connected to Illinois River (Hansel et al. 1985). A third study suggests a

Mississippian origin and subsequent northward colonization from Minnesota via a

drainage reversal that caused the Red River of the North to flow into ancient Lake

Agassiz and into the Hudson Bay (Hecht and Walters 1955). Although it is plausible that

mudpuppies colonized the Great lakes region from western refugia following the retreat

of the Wisconsinan glaciation, definitively resolving the migration route may require

additional genetic data. One interesting exception to the overall pattern of east-west

separation is the grouping of Iowa haplotype T with the eastern group. This may be a

result of homoplasy or human introduction since descent from eastern animals is

unlikely.

These data provide insight into the genetic evolution of mudpuppy populations

and may help elucidate patterns of migration across the United States. These data can

also be used to identify genetically unique populations and determine how these

populations may be best managed in the future (Ashley et al. 2003; Pearse and Crandall

2004). Given the deep separation between eastern and western groups, based on the

phylogenetic tree and Fst analyses, all watersheds with significantly high Fst values

should be managed as separate entities to avoid outbreeding depression. Separate

management of these watersheds will help preserve local adaptations needed for survival.

As a general rule, organisms removed from their environment should be returned as

closely as possible to their original location especially since much remains unknown

about the fine-scale genetic structure within watersheds. Within a single watershed,

18

microsatellite markers may be useful for revealing fine-scale molecular structure. If

more molecular markers are analyzed, we may find that the Great Lakes and Ohio

watershed should also be managed separately. Similarly, additional markers may reveal

significant genetic differentiation between the Red River watershed and the Mississippi

watershed.

19

Chapter 2: Evaluating the Utility of Environmental DNA (eDNA) Analysis to Detect the

Presence of Mudpuppies (Necturus maculosus maculosus)

Introduction

Environmental DNA (eDNA) consists of extra-organismal DNA deposited in the

air, water, or soil (Díaz-Ferguson and Moyer 2014). This type of DNA can originate

from several sources including: sloughed skin, gametes, mucous secretions, feces, and

urine (Barnes et al. 2014; Furlan et al. 2015). Once in the environment, the lifespan of

eDNA is determined by several forces including: temperature, pH, conductivity, salinity,

and microbial community composition (Dejean et al. 2011; Barnes et al. 2014; Strickler

et al. 2015). The lifespan of eDNA also depends on whether it is extracellular,

intracellular, free-floating, or adsorbed to particles (Barnes et al. 2014). Together, these

forces limit the stability and lifespan of eDNA. Due to its short lifespan, from hours to

weeks, in the environment, eDNA has been used as an indicator of the recent presence of

organisms. Scientists began analyzing eDNA in the mid-1980s to describe microbial

communities in marine sediments (Díaz-Ferguson and Moyer 2014). Recently, eDNA

has also been used to monitor invasive species (Ficetola et al. 2008; Jerde et al. 2011),

estimate biodiversity (Thomsen et al. 2012), and survey for threatened and endangered

species (Goldberg et al. 2011).

The mudpuppy (Necturus maculosus maculosus) is an ideal candidate for the

implementation of eDNA surveys in future monitoring efforts. Since mudpuppies are

both aquatic and behaviorally secretive, it can be difficult to assess presence using

traditional monitoring methods (Ficetola et al. 2008). Compared to traditional survey

20

methods eDNA surveys in other taxa have saved time (Jerde et al. 2011; Sisgaard et al.

2015), money (Biggs et al. 2015; Sisgaard et al. 2015), and have detected the presence of

species in sites where a species was declared absent in traditional surveys (Dejean et al.

2011; Biggs et al. 2015). Furthermore, eDNA surveys do not require physical handling

of animals and result in a lesser degree of habitat disturbance compared to traditional

surveys (Jones 1992; Thomsen and Willerslev 2015). This can be a great advantage

when surveying threatened and endangered species as habitat degradation is cited as a

cause of decline for many, and human handling of species risks disease transfer, undue

stress, and injury for the animals involved.

Freshwater environments are the most common habitat for studies isolating

macro-organismal DNA with dozens of studies published to date. Taxa surveyed in

freshwater environments include mammals, insects, crustaceans, mollusks, reptiles, fish,

and amphibians. The most common taxa surveyed in freshwater are amphibians and fish

(Thomsen and Willerslev 2015). The first amphibian freshwater eDNA study focused on

the detection of invasive bullfrog species in France (Ficetola et al. 2008). Other

amphibian studies have focused on using eDNA as a tool for detecting the presence of

behaviorally secretive species (Goldberg et al. 2011) and species of conservation concern

(Thomsen et al. 2012; Olssen et al. 2013; Santas et al. 2013; Biggs et al. 2015) where low

densities make these species particularly difficult to monitor using traditional survey

methods alone.

In addition to investigating the relative success of eDNA amphibian surveys,

several studies have also begun to elucidate the caveats involved with this type of

research. Although it has been demonstrated that eDNA exhibits a general pattern of

21

exponential decay following the removal of an organism (Barnes et al. 2014), estimates

of how long eDNA may persist in the environment vary. For example, Thomsen et al.

(2012) showed that eDNA was able to persist for two weeks following the removal of

two amphibian species (Pelobates fuscus and Triturus cristatus) from mesocosms.

However, in a similar experiment using Lithobates catesbeianus housed in aquaria,

Dejean et al. (2011) were able to detect eDNA 25 days after the removal of tadpoles from

aquaria. Given that both studies were conducted in laboratory settings, it is possible that

eDNA would have an increased rate of degradation in a natural setting where a multitude

of environmental variables would affect degradation rate. This is demonstrated by Pilliod

et al. (2014) who found that following a 24-hour introduction and subsequent removal of

Idaho Giant Salamanders from a previously unoccupied stream, no eDNA was detectable

after only one hour following the removal of the salamanders.

Since environmental factors will influence the rate of eDNA degradation, other

studies have begun to describe some of the environmental effects on the rate of eDNA

degradation. Some studies on amphibian eDNA have found higher rates of decay with

increased exposure to UV radiation (Pilliod et al. 2014; Strickler et al. 2015).

Furthermore, Strickler et al. (2015) suggest that higher temperatures combined with an

acidic (pH= 4) or neutral pH (pH= 7) will also increase the rate of eDNA degradation.

Despite having a rapid degradation rate, eDNA surveys have been demonstrated to

outperform traditional surveys, particularly when a species occurs in low densities

(Pilliod et al. 2013; Biggs et al. 2015).

Even though eDNA surveys present numerous advantages compared to traditional

surveys, there are also several drawbacks to these types of surveys. One of the main

22

concerns when conducting eDNA surveys is contamination (Thomsen and Willerslev

2015). Given that there is no way to reliably assess contamination issues, it is crucial to

prevent contamination of samples both during the collection of samples, when

contamination may occur between sites or through the use of common equipment, and

during sample processing when it is possible to contaminate samples with genomic DNA

stored in labs. Therefore, vigilance in the collection and processing of eDNA samples is

key to avoiding false positives. To help determine whether contamination occurred, it is

useful to have negative controls in the field and in the lab by bringing containers filled

with sterile water to collection sites and subsequently filtering that water using the same

equipment and methods used to process eDNA samples. Field controls can aid in

assessing whether any contamination occurred while collecting samples as a result of

contaminated equipment, improper handling, or contaminated storage during transport.

Lab controls can help assess the degree to which lab equipment or workspace may be

contaminated, which is especially important if one is working in a lab containing

genomic DNA of the organism of interest. Including multiple replicates and a threshold

value of positive replicates before indicating presence of a species can also aid in

reducing error rate (Schmidt et al. 2013; Rees et al. 2014).

Although it is known that eDNA has a relatively short lifespan, estimates on its

lifespan vary from less than a day (Foote et al. 2012) to approximately one month

(Dejean et al. 2011), and it is unclear just how long ago an animal was present in a given

location since studies measuring the lifespan of eDNA vary widely. Furthermore,

although eDNA is often correlated with species presence, such a correlation may not

always be accurate since the DNA may be from deceased individuals, feces of an animal

23

that consumed the species of interest, resuspended sediments, or introduced ballast water

(Rothlisberger and Lodge 2013; Roussell et al. 2015; Turner et al. 2015). In aquatic

habitats, eDNA may also be transported far from where the animal is located (Deiner and

Altermatt 2014). Species abundance is also difficult to discern with eDNA analysis.

Quantitative PCR (qPCR) may help correlate population size with signal strength, but

whether reliable inferences may be made remains to be seen (Thomsen and Willerslev

2015). Ultimately, the design of protocol to limit contamination, the inclusion of

multiple replicates, and the concurrent use of traditional surveys will ensure the most

accurate assessment of population status.

Our goals for this preliminary experiment were to determine if eDNA is a feasible

method for detecting the presence of mudpuppies. At this stage, we may be able to detect

issues with filtration methods, contamination, primer specificity, primer binding, and

PCR conditions. Although mudpuppies may still occur at high densities in some areas,

their tendency to remain hidden throughout the day makes them a difficult species to

survey using traditional methods. Mudpuppies tend to have limited movements with

male and female home ranges measured at 75.6 m2 and 17.5 m2 respectively, which would

tend to support assumptions of recent presence in an area (Gendron 2000). Given that

mudpuppies inhabit a variety of permanent bodies of water, including lakes and rivers,

we may find differential success of eDNA studies in these habitats, which is an area of

research that may be investigated with field sampling.

Methods

Prior to conducting an eDNA field study, it is necessary to ensure that DNA can

be successfully amplified from animals in a controlled setting. To this end, two one-liter

24

water samples were collected from an aquarium housing two juvenile mudpuppies.

Water samples were vacuum-filtered on site using a hand-powered vacuum pump kit with

Thermo Scientific™ Nalgene™ Analytical Test Filter Funnels connected to a one-liter

Erlenmeyer flask. Each filter funnel setup was individually packaged with a 0.45 μm

cellulose nitrate filter installed on each setup. One liter of distilled water was also filtered

as a negative control. After the water was filtered, forceps treated with DNA-away were

used to transfer each filter into 1.5 ml tubes filled with 95% ethanol. Tubes were stored

in a -20°C freezer until DNA extraction. DNA was extracted using a Qiagen Dneasy

Blood and Tissue Kit®. Following extraction samples were amplified using primers

developed by Stephen Spear (Table 4; unpublished). The PCR program consisted of an

initial denaturation of 95 °C for 15 min followed by 50 cycles of denaturation at 94 °C

for 60 s and annealing/extension at 60 °C for 60 s. Each reaction contained 7.5μl of

MyTaqTM Red Mix, 15 nm of each primer, 5 nm of fluorescent probe, 3 µl DNA and

distilled H2O for a total volume of 15µl. Reactions were amplified using a Chromo 4TM

qPCR machine (BIO-RAD). Since eDNA analysis is prone to false type I and type II

errors, three replicates of each aquarium sample and three replicates of the distilled H2O

control were included to reduce erroneous conclusions. Following amplification, the

threshold fluorescence value indicating successful amplification in eDNA samples was

set by finding the best-fit line relating log quantity DNA to C(t) value using tissue

standards. The C(t) value indicates the cycle at which the DNA has achieved a threshold

level of amplification. Tissue standards were determined to have reached a C(t) value

when the DNA amplification curve moved beyond the baseline region and into the

exponential region.

25

Results

A regression line of log quantity tissue standard DNA to C(t) value (Fig. 6)

determined the most appropriate threshold value for the amplified samples. The most

appropriate threshold fluorescence value for the tested samples was -2.6. The two one-

liter samples collected from an aquarium housing juvenile mudpuppies show some

positive eDNA amplification using qPCR since five out of six reactions reached a

threshold value of amplification. However, there was a large amount of background

noise, and though five out of six reactions reached threshold, none of the reactions

remained above the threshold value for the duration of the qPCR run (Figs. 7–15). To

improve this protocol, we may include more tissue DNA standards with concentrations

that would be expected to closely match those found in the environment to more

accurately determine an appropriate threshold value. Additionally, we may consider

including a greater number of eDNA replicates in the qPCR reaction to increase

confidence in our conclusions. Each of the negative controls had threshold values below

-2.6, indicating no amplification (Figs. 22–24). The amplification efficiency measures the

percentage of DNA amplified after each cycle. The average amplification efficiency of

tissue standards was 34.66 ± 20.24% SD. The average amplification efficiency of

aquaria samples was 23.81 ±15.35% SD. There was no difference in amplification

efficiency between tissue standards and aquaria samples (t=1.07, df=11, p=0.30). The

average C(t) value for tissue standards was 37.03 ± 10.48. The average C(t) value for

aquaria samples was 39.90 ± 12.14. There was no difference between the C(t) values of

26

tissue standards and aquarium samples (t=0.46, df=11, p=0.65). The next phase of this

research will focus on amplification of freshwater samples.

Table 4: Primer sequences used for eDNA analysis

NEMA F AGCAACAGCCTTTGTAGGGTA

NEMA R TCGCCTTATCGACGGAGAATC

Biosearch probe (Quasar

670) CGTACTACCATGAGGCCAAATATCCTTC

Figure 6: Regression line relating log quantity of tissue DNA to C(t) cycle.

27

Figure 7: Aquarium eDNA sample (A1). This sample shows sufficient amplification

to cross the threshold value of -2.6.



28



Figure 10: Aquarium eDNA sample (B1). This sample shows sufficient amplification


29





30

Figure 13: Distilled H2O Control 1. This sample shows no threshold amplification.


31


Discussion

The successful amplification of mudpuppy eDNA from an aquarium

housing captive animals demonstrates that our methods are able to successfully detect

the DNA of interest in a concentrated and controlled system. Furthermore, our

demonstrated lack of amplification of negative water samples suggests that there were

no major contamination issues. This is a required first step in any eDNA study as it

can help detect issues with filtration methods, contamination, primer specificity,

primer binding, and PCR conditions (Pilliod et al. 2012; Goldberg et al. 2016). The

lack of a statistically significant difference in amplification efficiency and C(t) values

between eDNA samples and tissue samples suggests that eDNA samples amplified

just as effectively as a group compared to the group of tissue samples. When

sampling from natural environments, we may find that eDNA amplification is

hindered compared to tissue DNA extracts as a result of a greater concentration of

32

inhibitors in the environment, environmental degradation, or low copy number

(Dejean et al. 2011; Barnes et al. 2014; Jane et al. 2015).

The next step in this study will be to test whether mudpuppy eDNA can be

amplified in a natural environment where increased environmental degradation will

make detection more difficult than captive environments. Sampling from

environments with known populations of mudpuppies will be a priority to establish a

positive control for our methods in a natural system. After establishing that our

methods can successfully detect mudpuppy eDNA from natural settings, we may be

able to correlate eDNA amplification with demographic data (Kelly et al. 2014). We

may also find that eDNA amplification correlates with habitat quality. As one of the

overarching goals of mudpuppy conservation is the successful restoration of desirable

breeding habitat, it would be useful for conservationists to know whether a given

restoration site is being utilized by mudpuppies. Although traditional survey methods

can assist in answering this question, eDNA analysis of a given site can be completed

more easily with less disturbance to animals and habitat (Hunter et al. 2015; Rees et

al. 2014).

33

References

Allendorf F.W., G. Luikart. 2007. Conservation and the genetics of populations. Blackwell Publishing, Malden, MA, 642 pp.

Ashley, M.V., Willson, M.F., Pergams, O.R., O’Dowd, D.J., Gende, S.M., and Brown, J.S.

(2003). Evolutionarily enlightened management. Biological Conservation 111, 115–123. Avise, J.C. 1995. Mitochondrial DNA polymorphism and a connection between genetics and

demography of relevance to conservation. Conservation Biology 9, 686-690. Barnes, M.A., Turner, C.R., Jerde, C.L., Renshaw, M.A., Chadderton, W.L., and Lodge, D.M.

(2014). Environmental Conditions Influence eDNA Persistence in Aquatic Systems. Environmental Science & Technology 48, 1819–1827.

Barrett, K., and Guyer, C. (2008). Differential responses of amphibians and reptiles in riparian and stream habitats to land use disturbances in western Georgia, USA. Biological Conservation 141, 2290–2300.

Biggs, J., Ewald, N., Valentini, A., Gaboriaud, C., Dejean, T., Griffiths, R.A., Foster, J., Wilkinson, J.W., Arnell, A., Brotherton, P., et al. (2015). Using eDNA to develop a national citizen science-based monitoring programme for the great crested newt (Triturus cristatus). Biological Conservation 183, 19–28.

Blaustein, A.R., and Wake, D.B. (1990). Declining amphibian populations: a global phenomenon. Trends in Ecology and Evolution 5, 203–204.

Boogard, M.A., Bills, T.D., and Johnson, D.A. (2003). Acute toxicity of TFM and a TFM/Niclosamide mixture to selected species of fish, including lake sturgeon (Acipenser fulvescens) and mudpuppies (Necturus maculosus), in laboratory and field exposures. Journal of Great Lakes Research 29, 529–541.

Brown, W.M., George, M., and Wilson, A.C. (1979). Rapid evolution of animal mitochondrial DNA. Proceedings of the National Academy of Sciences 76, 1967–1971.

Caccone, A., Milinkovitch, M.C., Sbordoni, V., and Powell, J.R. (1997). Mitochondrial DNA rates and biogeography in European newts (genus Euproctus). Systematic Biology 46, 126–144.

Cochran P.A. (1991). Distribution of the mudpuppy, Necturus maculosus, in Minnesota in relation to postglacial events. The Canadian Field-Naturalist 105, 400-402.

Chellman, I.C. 2011. Population demographics and genetic diversity of mudpuppies (Necturus maculosus) in Vermont. Unpublished Master’s thesis. University of Vermont, Burlington, Vermont.

Clark, A.C., Befus, K.M., and Sharman, G.R. (2010). A model of surface water hydrology of the

34

Great Lakes, North America during the past 16,000 years. Physics and Chemistry of the Earth. 53, 61-71.

Deiner, K., and Altermatt, F. 2014. Transport distance of invertebrate environmental DNA in a

natural river. PLoS One 9, e88786.

Dejean, T., Valentini, A., Duparc, A., Pellier-Cuit, S., Pompanon, F., Taberlet, P., and Miaud, C. (2011). Persistence of Environmental DNA in Freshwater Ecosystems. PLoS ONE 6, e23398.

Díaz-Ferguson, E.E., and Moyer, G.R. (2014). History, applications, methodological issues and perspectives for the use environmental DNA (eDNA) in marine and freshwater environments. Revista de Biología Tropical 62, 1273–1284.

Eycleshymer, A.C. 1906. The habits of Necturus maculosus. The American naturalist. 40:123–136.

Ficetola, G.F., Miaud, C., Pompanon, F., and Taberlet, P. (2008). Species detection using

environmental DNA from water samples. Biology Letters 4, 423–425.

Ficken, K.L.G., and Byrne, P.G. 2013. Heavy metal pollution negatively correlates with anuran species richness and distribution in south-eastern Australia: Heavy metal pollution and anuran species richness. Austral Ecology 38, 523–533.

Foote, A.D., Thomsen, P.F., Sveegaard, S., Wahlberg, M., Kielgast, J., Kyhn, L.A., Salling, A.B., Galatius, A., Orlando, L., and Gilbert, M.T.P. (2012). Investigating the Potential Use of Environmental DNA (eDNA) for Genetic Monitoring of Marine Mammals. PLoS ONE 7, e41781.

Furlan, E.M., Gleeson, D., Hardy, C.M., and Duncan, R.P. (2015). A framework for estimating the sensitivity of eDNA surveys. Molecular Ecology Resources n/a-n/a.

Gendron, A.D. (2000). COSEWIC status report on the mudpuppy (Necturus maculosus) in Canada. Unpublished Report. Ottawa, Canada. 95 pp.

Gilderhus, P.A., and Johnson, B.G.H. 1980. Effects of sea lamprey (Petromyzon marinus) control in the great lakes on aquatic plants, invertebrates, and amphibians. Canadian Journal of Fisheries and Aquatic Sciences 37, 1895–1905.

Goldberg, C.S., Pilliod, D.S., Arkle, R.S., and Waits, L.P. 2011. Molecular Detection of Vertebrates in Stream Water: A Demonstration Using Rocky Mountain Tailed Frogs and Idaho Giant Salamanders. PLoS ONE 6, e22746.

Goldberg, C.S., Turner, C.R., Deiner, K., Klymus, K.E., Thomsen, P.F., Murphy, M.A., Spear, S.F., McKee, A., Oyler-McCance, S.J., Cornman, R.S., et al. (2016). Critical considerations for the application of environmental DNA methods to detect aquatic species. Methods in Ecology and Evolution. 2016, 1-9.

35

Hansel A.K., D.M. Mickelson, A.F. Schneider, and Larsen C.E. 1985. Late Wisconsinan and Holocene History of the Lake Michigan Basin in Quaternary Evolution of the Great Lakes, eds. P.F. Karrow and P.E. Calkin. Geological Association of Canada Special Paper 30.

Harding, J.H. 1997. Amphibians and reptiles of the Great Lakes Region. 1st ed. University of Michigan Press, Ann Arbor, MI. 378 pp.

Hecht M.K., and V. Walters. 1955. On the northern limits of the salamander Necturus

maculosus. Copeia 251-252. Holland, B.S., and Hadfield, M.G. (2002). Islands within an island: phylogeography and

conservation genetics of the endangered Hawaiian tree snail Achatinella mustelina. Molecular Ecology 11, 365–375.

Holman, J.A. (2012). The amphibians and reptiles of Michigan. Wayne State University Press,

Detroit, MI. 291 pp. Howard, S.D., and Bickford, D.P. 2014. Amphibians over the edge: silent extinction risk of Data

Deficient species. Diversity and Distributions 20, 837–846.

Hunter, M.E., Oyler-McCance, S.J., Dorazio, R.M., Fike, J.A., Smith, B.J., Hunter, C.T., Reed, R.N., and Hart, K.M. (2015). Environmental DNA (eDNA) Sampling Improves Occurrence and Detection Estimates of Invasive Burmese Pythons. PLOS ONE 10, e0121655.

Jane, S.F., Wilcox, T.M., McKelvey, K.S., Young, M.K., Schwartz, M.K., Lowe, W.H., Letcher, B.H., and Whiteley, A.R. (2015). Distance, flow and PCR inhibition: eDNA dynamics in two headwater streams. Molecular Ecology Resources 15, 216–227.

Jerde, C.L., Mahon, A.R., Chadderton, W.L., and Lodge, D.M. (2011). “Sight-unseen” detection of rare aquatic species using environmental DNA: eDNA surveillance of rare aquatic species. Conservation Letters 4, 150–157.

Jones, J.B. (1992). Environmental impact of trawling on the seabed: a review. New Zealand Journal of Marine and Freshwater Research 26, 59–67.

Kelly, R.P., Port, J.A., Yamahara, K.M., and Crowder, L.B. (2014). Using Environmental DNA to Census Marine Fishes in a Large Mesocosm. PLoS ONE 9, e86175.

Kilpatrick, A.M., Briggs, C.J., and Daszak, P. (2009). The ecology and impact of chytridiomycosis: an emerging disease of amphibians. Trends in Ecology & Evolution 25, 109–118.

King, R.B., Oldham, M.J., Weller, W.F., and Wynn, D. (1997). Historic and Current Amphibian and Reptile Distributions in the Island Region of Western Lake Erie. American Midland Naturalist 138, 153.

36

Lagler, K.F., and Goellner, K.E. 1941. Notes on Necturus maculosus (Rafinesque), from Evans Lake, Michigan. Copeia 1941, 96.

Lannoo, M.J. 2005. Amphibian declines: the conservation status of United States species. 1st ed. University of California Press, London, England. 1115 pp.

Li, Y., Cohen, J.M., and Rohr, J.R. 2013. Review and synthesis of the effects of climate change

on amphibians. Integrative Zoology 8, 145–161.

Matson, T.O. 1990. Estimation of numbers for a riverine Necturus population before and after TFM lampricide exposure. Kirtlandia 45, 33–38.

Mandrak, N.E. and Crossman, E.J. 1992. Postglacial dispersal of freshwater fishes into Ontario. Canadian Journal of Zoology 70, 2247-2259.

McCracken, K.G., Johnson, W.P., and Sheldon, F.H. 2001. Molecular population genetics, phylogeography, and conservation biology of the mottled duck (Anas fulvigula). Conservation Genetics 2, 87–102.

Mezhzherin, S.V. 2002. Correlation between genetic variability and body size in vertebrates. Russian Journal of Genetics 38, 1060-1065.

Michigan Department of Natural Resources. 2015. Michigan’s Wildlife Action Plan 2015-2025. Available at: http://www.michigan.gov/documents/dnr/17_appendix1_sgcn_rationales_500078_7.pdf.

Mills, P.B. and Hill, D.J.E. 2016.. Ancient lake maxima and substrate-dependent riverine migration have defined the range of the Mudpuppy (Necturus maculosus) in southern Ontario following the Wisconsinan Glaciation. The Canadian Field-Naturalist 130, 158-163.

Moritz, C., Schneider, C.J., and Wake, D.B. 1992. Relationships within the Ensatina eschscholtzii complex confirm the ring species interpretation. Systematic Biology 41, 273-291.

Natusch, D.J.D., and Lyons, J.A. 2012. Exploited for pets: the harvest and trade of amphibians and reptiles from Indonesian New Guinea. Biodiversity and Conservation 21, 2899–2911.

Nersting, L.G., and Arctander, P. 2001. Phylogeography and conservation of impala and greater kudu. Molecular Ecology 10, 711–719.

Olson, Z.H., Briggler, J.T., and Williams, R.N. 2013. An eDNA approach to detect eastern hellbenders (Cryptobranchus a. alleganiensis) using samples of water. Wildlife Research 39, 629.

Palsbøll, P.J., Berube, M., and Allendorf, F.W. 2006. Identification of management units using population genetic data. Trends in Ecology & Evolution 22, 11–16.

37

Pan, T., Wang, H., Hu, C.-C., Shi, W.-B., Zhao, K., Huang, X., and Zhang, B.-W. (2014). Range-wide phylogeography and conservation genetics of a narrowly endemic stream salamander, Pachyhynobius shangchengensis (Caudata, Hynobiidae): implications for conservation. Genetics and Molecular Research 13.

Pearse, D.E., and Crandall, K.A. (2004). Beyond FST: analysis of population genetic data for conservation. Conservation Genetics 5, 585–602.

Pilliod, D.S., Goldberg, C.S., Arkle, R.S., Waits, L.P., and Richardson, J. (2013). Estimating occupancy and abundance of stream amphibians using environmental DNA from filtered water samples. Canadian Journal of Fisheries and Aquatic Sciences 70, 1123–1130.

Pilliod, D.S., Goldberg, C.S., Arkle, R.S., and Waits, L.P. (2014). Factors influencing detection of eDNA from a stream-dwelling amphibian. Molecular Ecology Resources 14, 109–116.

Pilliod, D.S., Goldberg, C.S., Laramie, M.B., and Waits, L.P. (2012). Application of environmental DNA for inventory and monitoring of aquatic species. US Geological Survey Fact Sheet 3416, 4.

Rees, H.C., Maddison, B.C., Middleditch, D.J., Patmore, J.R.M., and Gough, K.C. (2014). REVIEW: The detection of aquatic animal species using environmental DNA - a review of eDNA as a survey tool in ecology. Journal of Applied Ecology 51, 1450–1459.

Rohr, J.R., and Palmer, B.D. (2013). Climate Change, Multiple Stressors, and the Decline of Ectotherms: Climate Atrazine and Amphibians. Conservation Biology 27, 741–751.

Rothlisberger, J., and Lodge, D. (2013). The Laurentian Great Lakes as a beachhead and a gathering place for biological invasions. Aquatic Invasions 8, 361–374.

Roussel, J.-M., Paillisson, J.-M., Tréguier, A., and Petit, E. (2015). The downside of eDNA as a survey tool in water bodies. Journal of Applied Ecology 52, 823–826.

Santas, A.J., Persaud, T., Wolfe, B.A., and Bauman, J.M. (2013). Noninvasive Method for a Statewide Survey of Eastern Hellbenders Cryptobranchus alleganiensis Using Environmental DNA. International Journal of Zoology 2013, 1–6.

Sabatino, S.J., and Routman, E.J. (2009). Phylogeography and conservation genetics of the hellbender salamander (Cryptobranchus alleganiensis). Conservation Genetics 10, 1235–1246.

Schmidt, B.R., Kéry, M., Ursenbacher, S., Hyman, O.J., and Collins, J.P. (2013). Site occupancy models in the analysis of environmental DNA presence/absence surveys: a case study of an emerging amphibian pathogen. Methods in Ecology and Evolution 4, 646–653.

Scoble, J., and Lowe, A.J. (2010). A case for incorporating phylogeography and landscape genetics into species distribution modelling approaches to improve climate adaptation and conservation planning: Incorporating molecular marker information into species modelling. Diversity and Distributions 16, 343–353.

38

Shaffer, B., H., Fellers, G.M., Randal Voss, S., Oliver, J.C., and Pauly, G.B. (2004). Species boundaries, phylogeography and conservation genetics of the red-legged frog (Rana aurora/draytonii) complex. Molecular Ecology 13, 2667–2677.

Sigsgaard, E.E., Carl, H., Møller, P.R., and Thomsen, P.F. (2015). Monitoring the near-extinct European weather loach in Denmark based on environmental DNA from water samples. Biological Conservation 183, 46–52.

Soltis, P.S., and Gitzendanner, M.A. (1999). Systematics and the conservation of rare species. Conservation Biology 13, 471-483.

Strickler, K.M., Fremier, A.K., and Goldberg, C.S. (2015). Quantifying effects of UV-B, temperature, and pH on eDNA degradation in aquatic microcosms. Biological Conservation 183, 85–92.

Stuart, S.N., Chanson, J.S., Cox, N.A., Young, B.E., Rodrigues, A.S.L., Fischman, D.L., and Waller, R.W. (2004). Status and trends of amphibian declines and extinctions worldwide. Science 306, 1783–1786.

Thomsen, P.F., and Willerslev, E. (2015). Environmental DNA – An emerging tool in conservation for monitoring past and present biodiversity. Biological Conservation 183, 4–18.

Thomsen, P.F., Kielgast, J., Iversen, L.L., Wiuf, C., Rasmussen, M., Gilbert, M.T.P., Orlando, L., and Willerslev, E. (2012). Monitoring endangered freshwater biodiversity using environmental DNA: species monitoring by environmental DNA. Molecular Ecology 21, 2565–2573.

Turner, C.R., Uy, K.L., and Everhart, R.C. (2015). Fish environmental DNA is more concentrated in aquatic sediments than surface water. Biological Conservation 183, 93–102.

Welsh, H.H., and Ollivier, L.M. (1998). Stream Amphibians as Indicators of Ecosystem Stress: A Case Study from California’s Redwoods. Ecological Applications 8, 1118.

phylogeographic and environmental dna ... - digitalcommons@emu

Documents