Oral Diseases (2000) 6, 278–281 2000 Macmillan Publishers Ltd All rights reserved 1354-523X/00 $15.00

www.nature.com/od

Periodontal Disease

Papillon-Lefevre syndrome: analysis of HLA antigens

H Nitta 1, H Kato1, M Umeda2, S Kuwata2, I Ishikawa1

1Department of Periodontology, Faculty of Dentistry, Tokyo Medical and Dental University, Tokyo, Japan;2The Third Department ofInternal Medicine, Teikyo University School of Medicine, Tokyo, Japan

OBJECTIVES: Papillon-Lefevre syndrome (PLS) is a raredisease associated with prepubertal periodontitis. Ourprevious studies demonstrated that three unrelatedpatients with PLS showed the similar antigen-specificimmune responses to Actinobacillus actinomycetemcomit-ans. The initiation of antigen-specific immune responseswas involved with human leukocyte antigens (HLA) onantigen-presenting cells. The aim of this study was toexamine HLA haplotypes in the three patients with PLS.SUBJECTS AND METHODS: The three PLS patients,their mothers and the father of one patient participatedin this study. HLA class I and class II antigens weredetermined serologically and DNA typing for DRB1 andDQB1 was performed using the restriction fragmentlength polymorphism-polymerase chain reactionmethod.RESULTS: The distribution of serologic HLA haplotypes,in two of three patients, was found to be quite similar.The DNA typing revealed that DRB1*0406, DRB1*08032,DQB1*0302, DQB1*06011 genotypes were shared in thetwo patients. The probability of sharing these four DNAtypes in unrelated individuals was nearly 1:40,000 in theJapanese population.CONCLUSION: Our results suggest that HLA antigenmay be included as a possible host factor in the pathogen-esis of PLS and that a genetically controlled immuneresponse may account for an increased susceptibility toperiodontal infection.Oral Diseases (2000) 6, 278–281

Keywords: Papillon-Lefevre syndrome; Actinobacillus actino-mycetemcomitans; HLA; periodontal disease

Introduction

Papillon-Lefevre syndrome (PLS) was initially described in1924, being characterized by palmar-plantar hyperkeratosisand severe destruction of the periodontal tissue in the

Correspondence: Hiroshi Nitta, Department of Periodontology, Faculty ofDentistry, Tokyo Medical and Dental University, 1–5-45, Yushima,Bunkyo-ku, Tokyo 113–8549, Japan. Tel: 00 81 3 5803 5488,Fax: 00 81 3 5803 0196, E-mail: nitta.periKdent.tmd.ac.jpReceived 27 October 1999; revised 6 March 2000; accepted 9 March 2000

deciduous and permanent dentition (Papillon and Lefe`vre,1924). The estimated prevalence of the syndrome isbetween 1 and 4 per million infants (Gorlinet al, 1964),and it is considered to be an inherited autosomal recessivedisorder (McKusick, 1996). The cause of PLS remainsunclear. Two main factors are currently thought to beresponsible for periodontal destruction in PLS patients. Oneis the presence of periodontopathic bacteria includingActinobacillus actinomycetemcomitans, Capnocytophaga,Porphyromonas gingivalis, Campylobacter rectus, or spiro-chetes (Newmanet al, 1977; Rateitschak-Pluss and Schro-eder, 1984; Preus and Gjermo, 1987). Although no singlespecies or bacterium has been consistently associated withPLS, A. actinomycetemcomitanshas been identified in themajority of PLS patients studied (Tinanoffet al, 1986;Preus, 1988). The other factor is humoral or cellular alter-ations such as a reversed ratio of T-helper to T-killer cells(Lu et al, 1987), impaired lymphocyte reactivity to themitogens (Haneke, 1979), and impaired neutrophil chemo-taxis (Djawari, 1978; Firatliet al, 1996). These immune-mediated deficiencies that may be associated with underly-ing inherited genetic defects have been considered toexplain the pathogenesis of PLS.

We have treated three unrelated patients with PLS(Ishikawaet al, 1994; Boutsiet al, 1997). We found thesepatients showed similar antigen-specific immune responsesto A. actinomycetemcomitansdetermined by Westernimmunoblot. This evidence suggested that immunogeneticsare involved in the pathogenesis of PLS. Human leukocyteantigens (HLA) on antigen-presenting cells play a role inthe initiation of antigen-specific immune responses. Thepresent study was aimed to determine the HLA haplotypesin three PLS patients and their parents.

Subjects and methods

SubjectsWe have already described the clinical features and treat-ment process of three patients with Papillon-Lefe`vre syn-drome previously (Ishikawaet al, 1994; Boutsiet al, 1997).The three patients visited the periodontal clinic of theTokyo Medical and Dental University because of severeprepubertal periodontitis. They were all female. Patient Awas 3 years and 11 months old, Patient B was 7 years and7 months and Patient C was 5 years and 11 months at the

Pappillon-Lefevre syndromeH Nitta et al

279Table 1 Primers and restriction endonucleases for genotyping of DRB1 and DQB1 alleles

Primer Endonuclease

DRB1 gene exon 2

Forward primerDR1B1AMPA (DR1) TTCTTGTGGCAGCTTAAG Sau96I, HphI, PstIDR2B1AMPA (DR2) TTCCTGTGGCAGCCTAAGAGG RsaI, HphI, XmnIDR4B1AMPA (DR4) GTTTCTTGGAGCAGGTTAAAC RsaI, HhaI, HphI, MnIIDRAMPA3 (DR8, DR12) AGTACTCTACGGGTGAGTGTT RsaI, EcoRII, HhaI, HphI, XmnIDRAMPA4 (DR3, DR11, DR13, DR14) TTTCTTGGAGTACTCTSCGTC RsaI, HhaI, HphI, EcoRIIDRAMPA5 (DR7, DR9, DR10) TTCCTGTTGCAGGGTAAGTATA

Reverse primerDRBAMPB GAAGCTTCACAGTGCAGCGGC

DQB1 gene exon 2

Forward primerDQBAMPA AGGGATCCCCGCAGCGGATTTCGTG

Reverse primerDQBAMPB1 (DQ1) CACCTGCAGATCCCGCGGTACGCCACCTC BsaHI, HaeIII, HhaI, RsaIDQBAMPB2 (DQ2, DQ3, DQ4) CACCTGCAGTGCGGAGCTCCAACTGGT BsaHI, HaeIII, HhaI, Sau96I

first visit. The three patients, the mothers of all threepatients and the father of one (Patient C) participated inthis study. All individuals were clinically examined todetermine the presence of palmar-plantar hyperkeratosisand periodontitis.

HLA serological typingBlood (10 ml) was drawn by venipuncture into a vacuumtube containing 250 units of sodium heparin. Lymphocyteswere isolated by density-gradient centrifugation andwashed twice with Macoy’s 5a medium. B cells were thenseparated using nylon-wool. HLA A, B, and C typing wasperformed using the National Institutes of Health standardcomplement-dependent microcytotoxicity assay. T celldepleted, B-cell enriched lymphocytes were HLA DR andDQ typed by extended incubation cytotoxicity testing (Katzet al, 1987).

HLA Class II genotypingGenomic DNA was extracted from peripheral polymorpho-nuclear leukocytes using phenol-chloroform. Polymorphicregions in the second exon of the HLA-DRB1 and DQB1genes were amplified by the PCR method using group-specific primers (Olerup and Zetterquist, 1992; Otaet al,1992; Sengar and Goldstein, 1994; Mitsunagaet al, 1995a,1995b) (Table 1).

The PCR mixture (100ml) consisted of 1mg of genomicDNA, 50 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, 0.2 mMdeoxynucleotide triphosphate (dNTP) (dATP, dCTP,dGTP, dTTP) (Amersham Pharmacia Biotech, Uppsala,Sweden), 50 pmol primers, 2U Taq DNA polymerase(QIAGEN, Hilden, Germany). Thermocycling profiles con-sisted of initial denaturation for 2 min at 95°C, amplifi-cation through 30 cycles (1 min at 95°C, 2 min at 60°, and1 min at 72°C, with a final extension at 72°C for 5 min).PCR amplification products (5ml) were digested with 5units of allele-specific endonucleases (Table 1) for 2 haccording to the manufacturer’s instructions. Cleaved DNAwas then resolved by electrophoresis on 10% polyacrylam-

Oral Diseases

ide gels in a minigel apparatus (Atto, Tokyo, Japan). TheRFLP bands of digested DNA fragments were stained withethidium bromide then detected using ultraviolet light.HLA genotypes were determined on the basis of the RFLPprofiles. The nomenclature of DRB1 and DQB1 alleles wasassigned according to factors of the HLA system, as sug-gested by the World Health Organization NomenclatureCommittee in 1994 (Bodmeret al, 1994).

Results

Patient A has been treated for a period of 12 years fromthe ages of 3 years to 15 years. She has 28 permanent teethwith a healthy periodontium at present. Patient B was fol-lowed for a period of 9 years from ages of 7 years to 16years. She lost the lower left incisor as a result of periodon-tal disease and the lower right first molar because ofadvanced dental caries. The other 26 permanent teeth wereperiodontally healthy at present. Patient C was followed fora period 6 years from the ages of 5 years to 12 years. Shelost the upper left first molar as a result of periodontal dis-ease and the lower right first molar because of advanceddental caries. The remaining dentition is present in goodcondition. Palmar-plantar hyperkeratosis and destructiveperiodontitis were not evident in the mothers of the threepatients. Mild periodontitis, but not palmar-plantar hyper-keratosis was identified in the father of Patient C.

The serologic HLA haplotypes of the three patients andtheir families are shown in Table 2. The haplotypes weresimilar in Patients B and C. They shared three of six HLAclass I serotypes and all the same class II serotypes (A11,A24, B62, Cw4, DR4, DR8, DQw1 and DQw3).

The HLA DRB1 and DQB1 genotypes of the threepatients and their parents are shown in Table 3. DNAtyping revealed DRB1*0406, DRB1*08032, DQB1*0302and DQB1*06011 genotypes in the two patients that sharedthe same serological HLA class II haplotypes. Patient A didnot share any DQB1 genotypes with the other two patients.

Pappillon-Lefevre syndromeH Nitta et al

280

Oral Diseases

Table 2 Individual HLA phenotypes

Subjects A B C DR DQ

Patient A 2, 33 61, 44 –, – 14, 13 1, –Patient B 24, 11.1 62, 67 4, 7 4, 8 1, 3Patient C 11.1, 2 62, 46 4, 1 4, 8 1, 3Mother of Patient A 2, – 61, 46 –, 1 14, 8 1, –Mother of Patient B 24, – 62, 35 4, 3 4, – 1, –Mother of Patient C 2, 11 54, 62 1, 4 4, – 1, 3Father of Patient C 2, 3 46, 44 1, 5 8, – 1, –

HLA serotyping was performed using the National Institutes of Healthstandard complement-dependent microcytotoxicity assay

Table 3 Individual HLA DRB1 and DQB1 genotypes

Subjects DRB1 DQB1

Patient A 1302, 1401 0604 or 09, 05031Patient B 0406, 08032 0302, 06011Patient C 0406, 08032 0302, 06011Mother of Patient A 08032, 1401 06011, 05031Mother of Patient B 0406, 0410 0302, 05032Mother of Patient C 0406, – 0302, 0602Father of Patient C 08032, – 06011, –

Polymorphic regions in the second exon of the HLA-DRB1 and DQB1genes were amplified by the PCR method using group-specific primers.PCR amplification products were digested allele-specific endonucleases.HLA genotypes were determined on the basis of the RFLP profiles

Discussion

We found that these patients showed similar antigen-specific immune responses toA. actinomycetemcomitansdetermined by western immunoblot (Ishikawaet al, 1994;Boutsi et al, 1997). This suggested that immunogeneticsmight be involved in the pathogenesis of PLS. The majorhistocompatibility complex (MHC) molecule-antigen pep-tide complex on the surface of antigen-presenting cells isrecognized by T-cell receptor (TcR) on helper T-cells. Theability of MHC molecules to bind antigen peptide affectsantigen-specific immunological function, including thespecificity or avidity of antibody (Rudenskyet al, 1991).Therefore we determined HLA type in those patients andtheir parents. In the present study, we found that two ofthree PLS patients shared the same DR and DQ genotypes.The immune response to periodontopathic bacteria isinfluenced by the MHC. We demonstrated that the antibodyresponse to someA. actinomycetemcomitansantigens wascontrolled by the MHC in the mouse model (Nitta and Ishi-kawa, 1993). In humans, Dyer reported an associationbetween HLA class II antigens and IgG reactivity againstCapnocytophagain periodontitis patients with or withoutdiabetes (Dyeret al, 1997). The similar immunoblot profileagainstA. actinomycetemcomitansin the PLS patients maybe partly due to the similarity of HLA types.

The two patient of the three shared DRB1*0406, DRB1*08032, DQB1*0302, and DQB1*06011. The haplotype fre-quencies for DRB1*0406-DQB1*0302 is 8.2% in Japanesepopulation, and for DRB1*08032-DQB1*06011 is 6.4%(Imanishi et al, 1992). The probability of sharing the fourDNA types can be estimated as nearly 1:40,000. The sig-

nificance of this matching between two patients with thesame rare disorder has never been reported before. Patientswith PLS may possess unfavorable immune responsesagainst antigens ofA. actinomycetemcomitansthat are asso-ciated with certain HLA-DR/DQ types.

Ohyama et al (1996) showed that the frequency ofDRB1*1401, DRB1*1501, DQB1*0503 and DQB1*0602is higher in early-onset periodontitis patients than in healthycontrols (Ohyamaet al, 1996). Two of the PLS patients inthe present study did not carry any of these genotypes butthe other patient carried DQB1*0503.

Recently a few genetic linkage studies for early-onsetperiodontitis or syndromes with severe periodontitis andpalmar-plantar hyperkeratosis have been performed. Wanget al. reported preliminary results from the largest early-onset periodontitis linkage studies performed to date (Wanget al, 1996; abstract). Their results suggested a genetic link-age for HLA region of chromosome 6 and chromosome9q32–33. Our notion that HLA plays a role in the pathogen-esis of periodontal disease, is supported by these findings.Hart et al (1997) did not identify genetic linkage betweenpolymorphic DNA loci within 2 cytokeratin gene familiesand the disease phenotype in Haim Munk syndrome as wellas PLS. More recently, three separate studies showed thata gene for PLS was identified on chromosome 11q byhomozygosity mapping (Fischeret al, 1997; Laasset al,1997; Hartet al, 1998).

Our results suggest that HLA antigens may be includedas possible host factors in the pathogenesis of PLS and thata genetically controlled immune response may account foran increased susceptibility to periodontal infection.

Acknowledgements

This study was supported in part by Grant-in-Aid for ScientificResearch (No. 12672028) from the Ministry of Education, Scienceand Culture of Japan.

ReferencesBodmer JG, Marsh SG, Albert EDet al (1994). Nomenclature for

factors of the HLA system, 1994.Tissue Antigens44: 1–18.Boutsi EA, Umeda M, Nagasawa Tet al (1997). Follow-up of

two cases of Papillon-Lefe`vre syndrome and presentation oftwo new cases.Int J Periodont Rest Dent17: 334–347.

Djawari D (1978). Deficient phagocytic function in Papillon-Lefevre syndrome.Dermatologica156: 189–192.

Dyer JK, Peck MA, Reinhardt RAet al (1997). HLA-D typesand serum IgG responses to Capnocytophaga in diabetes andperiodontitis.J Dent Res76: 1825–1832.

Firatli E, Tuzun B, Efeoglu A (1996). Papillon-Lefe`vre syndrome.Analysis of neutrophil chemotaxis.J Periodontol67: 617–620.

Fischer J, Blanchet-Bardon C, Prud’homme JFet al (1997). Map-ping of Papillon-Lefe`vre syndrome to the chromosome 11q14region.Eur J Hum Genet5: 156–160.

Gorlin RJ, Sedano H, Anderson VE (1964). The syndrome ofpalmo-planter hyperkeratosis and premature periodontaldestruction of the teeth.J Pediatr 65: 896–908.

Haneke E (1979). The Papillon-Lefe`vre syndrome: keratosis pal-moplantaris with periodontopathy. Report of a case and reviewof the cases in the literature.Hum Genet51: 1–35.

Hart TC, Stabholz A, Meyle Jet al (1997). Genetic studies ofsyndromes with severe periodontitis and palmoplantar hyper-keratosis.J Periodont Res32: 81–89.

Pappillon-Lefevre syndromeH Nitta et al

281Hart TC, Bowden DW, Ghaffar KAet al (1998). Sublocalizationof the Papillon-Lefe`vre syndorome locus on 11q14-q21.Am JMed Genet79: 134–139.

Imanishi T, Akaza T, Kimura Aet al (1992). Allele and haplotypefrequencies for HLA and complement loci in various ethnicgroups. In: Tsuji K, Aizawa M, Sasazuki T, eds.HLA 1991.Oxford University Press: Oxford, pp 1065–1220.

Ishikawa I, Umeda M, Laosrisin N (1994). Clinical, bacteriologi-cal, and immunological examinations and the treatment processof two Papillon-Lefevre syndrome patients.J Periodontol65:364–371.

Katz J, Goultschin J, Benoliel Ret al (1987). Human leukocyteantigen (HLA) DR4. Positive association with rapidly pro-gressing periodontitis.J Periodontol58: 607–610.

Laass MW, Hennies HC, Preis Set al (1997). Localisation of agene for Papillon-Lefe`vre syndrome to chromosome 11q14-q21by homozygosity mapping.Hum Genet101: 376–382.

Lu HK, Lin CT, Kwan HW (1987). Treatment of a patient withPapillon-Lefevre syndrome. A case report.J Periodontol58:789–793.

McKusick VA (1996).Mendelian Inheritance in Man. 12th edn.Johns Hopkins University Press: Baltimore.

Mitsunaga S, Oguchi T, Moriyama Set al (1995a). MultiplexARMS-PCR-RFLP method for high-resolution typing of HLA-DRB1. Eur J Immunogenet22: 371–392.

Mitsunaga S, Oguchi T, Tokunaga Ket al (1995b). High-resol-ution HLA-DQB1 typing by combination of group-specificamplification and restriction fragment length polymorphism.Hum Immunol42: 307–314.

Newman M, Angel I, Karge Het al (1977). Bacterial studies ofthe Papillon-Lefe`vre syndrome.J Dent Res56: 545.

Nitta H, Ishikawa I (1993). Analysis of the genetic control ofantibody response toActinobacillus actinomycetemcomitansbyimmunoblotting inbred strains of mice.Oral Micro Immunol8:141–145.

Oral Diseases

Ohyama H, Takashiba S, Oyaizu Ket al (1996). HLA Class IIgenotypes associated with early-onset periodontitis: DQB1molecule primarily confers susceptibility to the disease.JPeriodontol67: 888–894.

Olerup O, Zetterquist H (1992). HLA-DR typing by PCR ampli-fication with sequence-specific primers (PCR-SSP) in 2 hours:an alternative to serological DR typing in clinical practiceincluding donor-recipient matching in cadaveric transplan-tation. Tissue Antigens39: 225–235.

Ota M, Seki T, Fukushima Het al (1992). HLA-DRB1 genotyp-ing by modified PCR-RFLP method combined with group-specific primers.Tissue Antigens39: 187–202.

Papillon MM, Lefevre P (1924). Deux cas de keratodermie pal-maire symetrique familiale (maladie de Meleda) chez le frereet la soeur, Coexistence dans les deux cas d’alterationsdentaires graves.Bull Soc Fr Dermatol Syphiligr31: 82–87.

Preus H, Gjermo P (1987). Clinical management of prepubertalperiodontitis in 2 siblings with Papillon-Lefe`vre syndrome.JClin Periodontol14: 156–160.

Preus HR (1988). Treatment of rapidly destructive periodontitisin Papillon-Lefevre syndrome. Laboratory and clinical obser-vations.J Clin Periodontol15: 639–643.

Rateitschak-Pluss EM, Schroeder HE (1984). History of periodon-titis in a child with Papillon-Lefe`vre syndrome. A case report.J Periodontol55: 35–46.

Rudensky A, Preston-Hurlburt P, Hong SCet al (1991). Sequenceanalysis of peptides bound to MHC class II molecules.Nature353: 622–627.

Sengar DP, Goldstein R (1994). Comprehensive typing of DQB1alleles by PCR-RFLP.Tissue Antigens43: 242–248.

Tinanoff N, Tanzer JM, Kornman KSet al (1986). Treatment ofthe periodontal component of Papillon-Lefe`vre syndrome.JClin Periodontol13: 6–10.

Wang S, Sun C, Gillanders Eet al (1996). Genome scan for sus-ceptibility loci to the complex disorder early onset periodontitis.Am J Hum Genet59: abstr 1386.